 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Section of Nephrology, Yale University, School of Medicine, New Haven,
Connecticut
ACLARA Biosciences, Mountain View, California
Section of Nephrology, University of Freiburg, Freiburg,
Germany
§
Beth Israel Deaconess Medical Center, Harvard Medical School, Boston,
Massachusetts
||
University of Utrecht, Utrecht, The Netherlands.
Correspondence to Dr. Zhen-Xiang Liu, Section of Nephrology, Yale University, School of Medicine, 333 Cedar Street, LMP 2093, P.O. Box 208029, New Haven, CT 06520-8029. Phone: 203-785-7111; Fax: 203-785-7068; E-mail: zhen-xiang.Liu{at}yale.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and ras/mitogen-activated protein kinase (MAPK) pathways
(8,9,10,11),
which are required for epithelial cell migration and morphogenesis
(12,13,14).
The actual intracellular effectors of these signaling pathways in renal tubule
formation remain unknown, although they are likely to involve regulation of
the actin cytoskeleton, cell—cell interacting proteins such as
cadherins, and cell—matrix interacting proteins such as integrins. A candidate intracellular protein that seems to be important in developmental renal epithelial tubule formation is formin IV, a member of the formin gene family, which encodes the mouse limb deformity gene products (15,16,17,18). Although the biologic function of formin is unknown, disruption of the formin gene locus results in developmental limb defects as well as renal aplasia and dysgenesis. Specifically, the renal agenesis involves failure of ureteric bud outgrowth and early nephrogenesis, suggesting that the protein products of this gene locus are critical to the tubulogenic phenotype. Alternative splicing of the formin gene product is believed to generate five isoforms: Ia, Ib, II, III, and IV (16,19) (Figure 1). Recently, Wynshaw-Boris and co-workers (20) found that although each formin isoform is expressed in the pronephros, mesonephric tubule and duct, and ureteric bud of developing metanephros, the renal phenotype is dependent predominantly on disruption of the formin IV gene.
|
The observation that formin proteins are required for early developmental tubule formation in the kidney led us to postulate that formin IV may be a downstream target of tubulogenic receptors such as c-met. We therefore chose to examine the expression of formin proteins in renal tubular epithelial cells and to determine whether this expression was regulated by activation of c-met. We found that murine inner medullary collecting duct cells express formin IV and that it primarily co-localizes with actin at the periphery of cell clusters in quiescent cells. After stimulation with HGF, formin IV rapidly translocates away from the cell periphery into a cytosolic and nuclear location in a MAPK-dependent manner. Finally, we found that formin IV can be phosphorylated by activated extracellular signal-regulated kinase (ERK), suggesting that this phosphorylation may be the regulatory event in its translocation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Identification of Formin Isoforms
PCR was performed to determine whether mIMCD-3 cells express the mRNA for
formin IV. mRNA was prepared from mIMCD-3 cells as described previously
(23). Formin IV—specific
primers LdEx6 s, ATGGAGGAGGTTGGTAACTCTCTC (at the 5' end of exon 6) and
primer LdEx8an, AGCAGCCTGGTATTCTGCTTC (in exon 8) were designed to amplify
formin exons 6 to 8 and are predicted to give a 1503-bp fragment of formin
IV.
Protein Analysis
Cells were made quiescent by serum starvation for 24 h. HGF stimulation was
performed by incubating the cells for the indicated times with 40 ng/ml HGF
(Sigma). In experiments that examined MAPK inhibition, cells were preincubated
for 20 min with 20 µM U0126 or vehicle control before stimulation. Cell
lysates for protein analysis were performed as described previously
(23). Briefly, plates of
subconfluent cells were washed with ice-cold phosphate buffered saline (PBS),
lysed with ice-cold NP-40 lysis buffer (137 mM NaCl, 20 mM Tris, 1 mM
MgCl2, 1 mM CaCl2, 10% glycerol, 0.5% Nonidet P-40, 2 mM
sodium vanadate, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin and
leupeptin [pH 7.5]), scraped from the dish with a cell scraper, and collected
into an microcentrifuge tube. In other experiments, cells were lysed in a
low-calcium buffer (RIPA: 150 mM NaCl, 50 mM Tris, 1.0% Nonidet P-40, 0.5%
deoxycholate, 0.1% sodium dodecylsulfate, 2 mM sodium vanadate, 1 mM
phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin and leupeptin [pH 8]). The
sample was centrifuged for 10 min at 12,000 x g at 4°C to
remove the nucleus, and the supernatant protein content was determined using
the Bradford assay. For subcellular fractionation, the supernatant was
centrifuged at 100,000 x g for 30 min at 4°C to yield the
NP-40 insoluble pellet (P100) and detergent soluble supernatant (S100)
fractions (24). Fifty µg of
each solubilized cell lysate was resolved by 6% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and transferred to
Immobilon (Millipore, Bedfod, MA).
Immunoblots
Proteins were electrophoretically transferred to Immobilon-P membranes and
immunoblotted with the appropriate antibody, followed by detection using a
chemiluminescence system (ECL, Amersham International, Arlington Heights, IL).
To detect the formin proteins, we used anti-FP1, a polyclonal antibody raised
against the conserved carboxy terminus of formins I, II, III, and IV
(25)
(Figure 1). The formin
IV—specific antibody, anti-FIV, was generated in rabbits by the
injection of peptide EEVGNSLSSRDVLEPDKS found in exon 6 of formin IV and was
affinity-purified before use. Quantification was performed by densitometric
analysis of autoradiograms using NIH Image software and reported as mean
± SEM.
Confocal Microscopy
mIMCD-3 or NIH3T3 cells were serum-starved for 24 h and stimulated for the
indicated times with 40 ng/ml HGF and fixed and permeabilized using 80%
methanol/20% acetone. Cells were then washed twice with ice-cold PBS and
exposed to the primary antibody in PBS for 30 min (anti-FIV, 1:100), followed
by PBS wash and exposure to secondary antibody for 30 min (Cy5 conjugated
antirabbit, Jackson Immunoresearch Laboratories, West Grove, PA).
Colocalization with actin was examined using FITC-linked phalloidin with
paraformaldehyde fixation. All samples were mounted with ProLong antifade
(Molecular Probes, Eugene, OR). The confocal images were acquired with a
BioRad MRC1024ES attached to a immunofluorescent microscope (Nikon E800,
Tokyo, Japan). For double-staining experiments, images were acquired
sequentially to avoid dye interference. The LaserSharp V3.1 software (BioRad,
Hercules, CA) was used for image acquisition and postprocessing of the images,
e.g., scaling, merging, exporting.
Expression and Isolation of Formin IV
A cell line stably expressing chicken formin IV, IMCD-LDIV, was created by
transfecting mIMCD-3 cells with a CMV-driven formin IV expression plasmid
(protA-Formin IV) containing four copies of a protein A tag in front of the
formin IV coding sequence for immunoprecipitation
(24). To immunoprecipitate
tagged formin IV, we washed subconfluent cells twice with PBS and refed with
Dulbecco's modified Eagle's/F-12 medium in the absence of fetal calf serum for
24 h, again washed with ice-cold PBS, and lysed in NP-40 lysis buffer at
4°C. Cells were vortexed vigorously and centrifuged for 10 min at 12,000
x g. Protein concentrations of the resulting supernatants were
determined by the Bradford assay. One mg of protein from IMCD-LDIV cell
lysates was immunoprecipitated directly using IgG sepharose beads to
precipitate the protein A tag (Pharmacia, Piscataway, NJ). One mg of protein
from parental mIMCD-3 cells was immunoprecipitated as a control. Beads were
washed three times in PBS, 1% NP-40, and 200 mM sodium vanadate (pH 7.5) and
two times in 10 mM Tris, 100 mM NaCl, 1 mM ethylenediaminetetraacetate, and
200 mM sodium vanadate (pH 7.5) and used in the in vitro MAPK assay
below. Expression of the transfected formin IV was confirmed via SDS-PAGE.
MAPK Assay In Vitro
mIMCD-3 cells were transiently cotransfected with constitutively active MEK
(pCMV-MEK[*]) and ERK 2 (pCMV-41MAPK [plasmids provided by Dr.
Roger Davis]) using Lipofectamine reagent (Life Technologies, Grand Island,
NY). Activated MAPK was immunoprecipitated using IgG sepharose beads with
anti-ERK2 antibody (Santa Cruz Biotech, Santa Cruz, CA) as above. The
sepharose beads containing activated MAPK were resuspended in 5x reaction
buffer (100 µM ATP, 50 mM MnCl2, 50 mM MgCl2, and 100 mM HEPES,
10 µCi 32P [NEN]), and equal amounts added to the
immunoprecipitates from LDIV and parental mIMCD-3 cells. The tubes were
incubated for 30 min at 30°C. Protein sample buffer (2x; see above) was
added, and the tubes were boiled at 95°C for 5 min. The samples were
centrifuged for 5 min, and the supernatants were separated with SDS-PAGE using
a 7.5% gel. The gel was dried and then exposed to autoradiography film
(Amersham).
MAPK Assay In Vivo
mIMCD-3 cells and cells expressing LDIV were serum starved for 20 h before
labeling. Media were removed and replaced with phosphate-free media. Cells
were labeled for 4 h with 0.66 mCi/ml 32P-HPO4. Cells
were treated with either HGF (40 ng/ml in PBS + 0.01% bovine serum albumin) or
vehicle control for 10 min. In experiments with U0126, cells were preincubated
for 20 min with 20 µM U0126 before HGF stimulation. Cell lysates were
prepared and immunoprecipitated with IgG sepharose as described above. Samples
were separated with SDS-PAGE using a 7.5% gel. The gel was dried and then
exposed to autoradiography film (Amersham).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Activation of c-Met Results in an Increase in Detergent-Soluble
Formin IV
To examine potential interactions between formin and the c-met receptor, we
stimulated mIMCD-3 cells with HGF, and 0.5% NP40 whole-cell lysates were
immunoprecipitated with an antibody to the met receptor. These
co-immunoprecipitation experiments failed to detect a direct interaction
between formin IV and activated c-met (data not shown). In agreement with the
work of other laboratories, antiphosphotyrosine blots of formin IV after HGF
stimulation also failed to detect tyrosine phosphorylation of this protein
(data not shown). To determine whether activation of c-met resulted in
regulation of formin protein expression, we stimulated whole-cell lysates of
mIMCD-3 cells for 10 min with HGF, EGF, or PDGF, and immunoblotted them with
the anti-FP1 antibody, and compared them with lysates from unstimulated cells.
In the lysates from HGF-treated cells that were blotted with the FP1 antibody,
there was a 3.7 ± 0.75-fold increase selectively in the upper band of
the 165-kD doublet, which was not observed with EGF or PDGF (n = 4,
Figure 2A). There was no
observed change in the 190-kD formin I isoform with stimulation by HGF (data
not shown). Immunoblotting of a separate experiment with the anti-FIV antibody
confirmed that the regulated isoform was formin IV
(Figure 2A, right). To
determine the timing of the observed increase in formin IV, we stimulated
mIMCD-3 cells with HGF for 0, 1, 5, 10, and 30 min. As shown in
Figure 2B, a detectable
increase in formin IV occurred after 5 min of stimulation with HGF, with the
maximum increase after 10 min of stimulation with HGF and return to baseline
by 30 min. Lysing cells in a low calcium RIPA buffer also resulted in an
increase in solubilized formin IV, although this increase was found to be more
variable (range, 1.5 to 12-fold increase, n = 3).
|
The rapidity of the increase in formin IV after HGF stimulation suggested that the activated c-met receptor potentially induced a translocation of formin IV from the NP-40 insoluble to the soluble compartment. To examine this, we compared the formin IV content of the NP-40 insoluble (P100) fraction and NP-40 soluble (S100) fraction of mIMCD-3 cells after HGF stimulation for 10 min. In control cells, formin IV was detected in both the detergent-soluble and -insoluble fractions, whereas after stimulation with HGF there was a 1.5 ± 0.1-fold reduction in NP-40 insoluble formin IV and a 3.2 ± 0.8-fold increase in NP-40 soluble formin IV (n = 8; Figure 2C). These results suggest that activation of the c-met receptor results in formin IV translocation from the detergent-insoluble to the detergent-soluble protein fraction.
Cellular Localization of Formin IV
It has been proposed that formin IV action requires nuclear localization,
although formin has also been detected in fibroblasts at the cell membrane
co-localized with c-src (24).
On the basis of our detection of formin IV in the NP-40 solubilized fraction
of mIMCD-3 cells after HGF stimulation, we predicted that formin IV might
translocate in an HGF-dependent manner to the cytosol or a detergent-soluble
domain of the cell membrane. To examine this, we performed confocal microscopy
using the affinity-purified FIV-specific antibody. In contrast to the
described location of formin proteins in fibroblasts, formin IV was found to
be most abundant in quiescent epithelial cells at the cell surface in a
distinct band circumscribing cell clusters, with some detection of formin IV
at sites of cell—cell contact and in a perinuclear distribution
(Figure 3A). In contrast, there
was little detectable formin IV in the nucleus of quiescent cells (Figures
3A,
4A, and
5A). Preincubation of the FIV
antibody with an excess of the antigenic peptide eliminated binding at the
cell membrane and diminished the perinuclear staining by approximately 90%
(Figure 3B), demonstrating that
the observed staining is specific for formin IV. In contrast, formin IV was
found predominantly in a distinct perinuclear pattern with very weak membrane
staining in NIH3T3 fibroblasts (Figure
3C). Staining of mIMCD-3 cells with FITC-labeled phalloidin
(Figure 3D) demonstrated that
the formin IV staining observed at the periphery of epithelial cell clusters
(Figure 3E) co-localized with
actin (Figure 3F).
|
|
|
To determine whether HGF regulates the localization of formin IV, we stimulated mIMCD-3 cells with HGF and again examined formin IV localization. Five min after HGF stimulation, the distinct band of formin IV at the cell edge was disrupted and a small fraction of formin IV had translocated into the nucleus (Figure 4). After 10 min of HGF stimulation, the peripheral band of formin IV was further diminished and formin IV was now distributed into the cytosolic compartment, as well as within the nucleus. The degree of this translocation was variable between cell clusters. After 30 min of HGF stimulation, cell—cell contact sites had become disrupted, but formin IV localization was returning toward baseline with extrusion from the nucleus and an increase in formin IV at the cell periphery.
HGF-Induced Translocation of Formin IV is MAPK Dependent
Because formin proteins are known to be phosphorylated on serine and
threonine residues in fibroblasts
(26), the possibility that the
activated c-met tyrosine kinase receptor regulates formin localization via
activation of an intermediate serine/threonine kinase was examined.
Examination of the formin IV primary amino acid sequence indicates that there
are several potential MAPK consensus sites (P-X-S/T-P), including
455PKSP, 647PPTP, 682PVSP, and
693PPTP (the last three being in the proline-rich region of the
protein). Because MAPK is strongly activated by HGF/c-met
(27), a MAPK inhibitor, U0126,
was used to evaluate the potential of HGF to regulate formin via
MAPK-dependent serine/threonine phosphorylation. U0126 is a recently described
potent inhibitor of the ERK1 and 2 kinases MKK1 and MKK2
(28). Preincubating mIMCD-3
cells with U0126 markedly reduced the HGF-induced translocation of formin IV
from the detergent-insoluble to the detergent-soluble fraction (+HGF = 3.7
± 1.1-fold increase in formin IV, +HGF + U0126 = 1.5 ± 0.7-fold
increase in formin IV, n = 6;
Figure 5A). Examination of the
cellular localization of formin IV via confocal microscopy confirmed that
U0126 prevented the translocation of formin IV after HGF stimulation
(Figure 5B). These results
suggest that the MAPK signaling cascade is involved in regulating endogenous
formin IV localization in epithelial cells.
We next examined whether formin IV could serve as a substrate for MAPK phosphorylation in vitro and in intact cells. mIMCD-3 cells stably expressing protein A—tagged formin IV (LdIV cells) were immunoprecipitated with IgG sepharose beads. An antibody that recognizes the protein A tag confirmed that the LdIV clone was expressing protein A—tagged formin IV (pA-LdIV), with a size slightly larger than endogenous formin IV as a result of the four repeats of protein A (Figure 5C, left). To determine whether formin IV was a potential target for MAPK phosphorylation, we again used IgG sepharose to immunoprecipitate pA-LdIV from the LdIV clone. These precipitates were then mixed with activated ERK2 in a kinase buffer in the presence of 32P-ATP, eluted, and separated by SDS-PAGE and phosphorylated proteins detected using autoradiography. A phosphorylated band corresponding to pA-LdIV was detected in the LdIV clone but not in control mIMCD-3 cells (Figure 5C, middle). To examine whether formin IV is phosphorylated in intact cells after HGF stimulation, we labeled LdIV cells with 32P-HPO4 followed by incubation in the absence or presence of HGF. pA-LdIV was immunoprecipitated with IgG sepharose and separated by SDS-PAGE, and autoradiography was performed. Formin IV was found to be weakly phosphorylated in quiescent cells, with an increase in the phosphorylation state after HGF stimulation (Figure 5C, right). Preincubation with the MEK inhibitor U0126 resulted in marked inhibition of the HGF-stimulated formin IV phosphorylation. These results indicate that formin IV is phosphorylated in vitro by activated ERK and in vivo after HGF stimulation in a MAPK-dependent manner.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The rapid nature of the increase in formin IV argued against an increase in mRNA production or protein synthesis and suggested either a size change as a result of serine/threonine phosphorylation, i.e., a shift from the lower band of the 162/165-kD doublet to the upper band, or a translocation event rendering the formin IV more soluble in the detergent lysate. Careful examination of the 162/165-kD doublet after HGF stimulation failed to reveal a decrease in the 162 kD band (Figure 2, A and B) in parallel with the increase in formin(165). In addition, the specific formin IV antibody recognized only formin(165) (Figure 2A), ruling out the possibility that the increase in formin(165) band was due to a phosphorylation-dependent size shift of the lower protein. Cell fractionation revealed that formin IV decreased in the detergent-insoluble fraction and increased in the detergent-soluble fractions after HGF stimulation (Figure 2C). The presence of a large pool of detergent-insoluble formin IV was confirmed in the 10,000 x g pellets from epithelial cells lysed with an NP-40/deoxycholate mixture (data not shown).
Confocal microscopy with the formin IV—specific antibody FIV in quiescent mIMCD-3 cells revealed that formin IV was localized differently in these cells than in NIH3T3 fibroblasts. Previous researchers found that immunofluorescence staining of fibroblasts with the FP1 antibody that recognizes all known formin isoforms revealed primarily nuclear and perinuclear staining, with a small fraction of formin staining at the cell membrane co-localized with c-src (24,25). Similarly, Chan and Leder (29) demonstrated with an antibody specific for formin IV that formin IV localized with the nuclear pellet in hypotonic lysates from fibroblasts, with no formin IV in the cytosolic fraction and a lesser amount with the membrane fraction. Confocal localization of formin IV in NIH3T3 cells in the present study revealed primarily perinuclear staining with modest staining at the membrane and within the nucleus (Figure 3C). An antibody to formins I to III detected punctate staining (presumably of formin I based on our Western analysis) primarily within the nucleus (data not shown). Taken together, these results suggest that in quiescent fibroblasts, formin IV localizes around the nucleus (and co-pellets with the nuclear fraction in nondetergent lysates), whereas other formin isoforms (such as formin I) are located within the nucleus.
In contrast to the pattern of staining for formin IV in fibroblasts, in mIMCD-3 epithelial cells, formin IV is primarily localized at the periphery of cell clusters in a dense submembranous band and at sites of cell—cell contact. In addition, there is substantial perinuclear staining for formin IV in a pattern similar to that seen in fibroblasts. The localization of formin IV in a band at the periphery of cell clusters is similar to the actin cytoskeletal arrangement described for other epithelial cells when these cells are grown in subconfluent islands. Staining with FITC-labeled phalloidin confirmed that the dense band at the periphery of cell clusters contained actin and demonstrated co-localization of formin IV with actin at this site (Figure 3F). These results indicate that formin IV expression is regulated differently in fibroblasts and epithelial cells, a possibility that is supported by the evidence from Wynshaw-Boris et al. (20), who found that selective knockout of formin IV results in loss of ureteric bud outgrowth (an epithelial cell event) but not limb deformities.
The mechanism for formin IV localization to the detergent-insoluble domains of the cytoskeleton in quiescent epithelial cells is unclear; however, Chan et al. (30) demonstrated that the proline-rich region in the center of formin can act to bind the SH3 domain of the cytoskeletal protein cortactin and the WW domain of dystrophin, whereas Uetz and co-workers (24) found that this region can bind the SH3 domain of src, either of which could mediate cytoskeletal localization. Indeed, other members of the formin gene family, including cappuccino (drosophila) (31), diaphanous (human, mouse, drosophila) (32,33), and Bni 1p (saccharomyces cervisae) (34,35), have been found to interact with cytoskeletal-associated proteins such as Cdc42, actin, and profilin, where they seem to play a role in actin cytoskeletal regulation during cell polarization and morphogenesis (34,35).
After stimulation with HGF, formin IV rapidly shifted from the dense band at the periphery of cell clusters to a more diffuse staining in the cytoplasm, with a subfraction entering the nucleus and another fraction aligning in linear arrays reminiscent of actin stress fibers. Examination of the formin IV sequence reveals that there are four consensus ERK phosphorylation sites (P-x-S/T-P); three of the four sites clustered in the proline-rich region of the protein where SH3 and WW domain interactions have been demonstrated. Thus, it is possible that c-met activation of the MAPK signaling pathway leads to ERK phosphorylation of formin IV at sites in the proline-rich domain, thereby disrupting associations between this domain and SH3 or WW domain containing proteins that localize it to the membrane. Alternatively, phosphorylation of these sites might result in new associations between formin IV and SH3 or WW domain-containing proteins, thereby targeting formin IV to the nucleus or to newly formed stress fibers.
In support of a central role for the MAPK pathway in regulation of formin IV localization, we found that the selective MEK inhibitor U0126 blocked both the increase in detergent-soluble formin IV and the translocation of formin IV from the actin ring at the cell periphery into the cell cytoplasm after HGF stimulation (Figure 5, A and B). These results were also observed with the alternative MEK inhibitor PD98059 (data not shown), although in a less dramatic manner. In addition, formin IV is a substrate for ERK phosphorylation in vitro, suggesting that activated ERK may directly interact with and phosphorylate formin IV. We recently demonstrated that activated ERK1 and 2 can be recruited to the c-met docking protein GAB-1 after HGF stimulation (36), which could serve to recruit activated ERK to the membrane in proximity to formin IV.
The role of this translocation of formin IV from the actin ring at the cell periphery to a cytosolic and nuclear location after HGF stimulation remains to be determined. One possibility is that formin IV is a transcriptional activator that is held in a non-nuclear location until cells are stimulated to undergo tubulogenesis. Careful examination of the murine ld carboxy terminal truncation mutants of formin by Chan and Leder (29) demonstrated that these proteins fail to associate with a low-speed pellet in hypotonic cell lysates from fibroblasts and are instead found in the free cytosolic fraction. This low-speed pellet was shown to include primarily the cell nuclei, and the failure of nuclear localization in the truncated ld mutants correlated with the phenotype of limb deformity, arguing that nuclear localization in fibroblasts is mediated by the carboxy terminus of formin and is required for at least one aspect of formin action. Although formins have been found to associate with DNA in vitro and are proposed as potential transcriptional regulatory factors (26), their exact role in the nucleus has not been defined. In the present study, formin IV was not found in the nuclei of quiescent epithelial cells, but a fraction of formin IV did translocate into the nucleus within 5 min of stimulation with HGF. The staining pattern for formin IV was markedly different in fibroblasts, where the majority of staining was in a punctate, perinuclear distribution with a small fraction at the membrane. Staining of epithelial cells with an antibody to formin I demonstrated that essentially all of the staining was confined to the perinuclear space and the nucleus with no staining at the cell membrane, supporting the idea that specific formin isoforms are differentially localized in these cells (data not shown).
In summary, epithelial cells express formin IV with localization at the periphery of cell clusters aligned with actin bundles, whereas formin IV is localized in a tight perinuclear distribution in fibroblasts. Stimulation of epithelial cells with HGF results in a rapid, reversible relocalization of formin IV into the cytoplasm and the nucleus, in a MAPK-dependent manner.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. J. Copeland, B. J. Green, S. Burchat, G. A. Papalia, D. Banner, and J. W. Copeland The Diaphanous Inhibitory Domain/Diaphanous Autoregulatory Domain Interaction Is Able to Mediate Heterodimerization between mDia1 and mDia2 J. Biol. Chem., October 12, 2007; 282(41): 30120 - 30130. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
-FIV) revealed that the upper band at
approximately 165 kD was formin IV (right).
