 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
REGULAR ARTICLES |
*
Consiglio Nazionale delle Ricerche Cellular and Molecular Pharmacology
Center, Milan,
Italy.,a
Consiglio Nazionale delle Ricerche Institute of Advanced Biomedical
Technologies, Milan, Italy.
II Paediatric Clinic, Milan, Italy.
§
Department of Pharmacology, University of Milan, Milan, Italy.
Correspondence to Dr. Bice Chini, Consiglio Nazionale delle Ricerche Cellular and Molecular Pharmacology Center, via Vanvitelli 32, 20129 Milan, Italy. Phone: +39 02 70146271; Fax: +39 02 7490574; E-mail: B.Chini{at}csfic.mi.cnr.it
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
A number of families of patients suffering from the X-linked form of NDI have been genetically studied, and the gene responsible for congenital NDI has been mapped to the subtelomeric region of the long arm of the X chromosome (band Xq28), where it colocalizes with the V2 vasopressin receptor gene (AVPR2) whose mutations have been found to be responsible for the disease (2). It has also been reported that autosomal recessive and dominant forms of NDI are caused by mutations in the aquaporin 2 gene (AQP2), a water channel located in the basolateral membrane of collecting duct cells (3). It has been recently demonstrated that AQP1 (a gene encoding for a water channel located on the basolateral surface of proximal tubules and thin descending limb cells) and CLC-K1 (a gene encoding a kidney-specific chloride channel) cause NDI in knockout mice (4,5,6), but it remains to be seen whether mutations in the human counterparts of these genes are responsible for rare forms of congenital NDI.
However, the vast majority of cases of genetic NDI in humans are caused by mutations in the AVPR2 gene (7), a transmembrane protein localized on the basolateral membrane of the polarized epithelial cells of the kidney nephron, and one of the specific targets of the arginine vasopressin (AVP) antidiuretic hormone. Mutations of the vasopressin V2 receptor gene are spread throughout its coding region (7); a number of these have been studied at the functional level, and the defects altering the activity of the mutant receptors have been investigated (8,9,10,11,12,13,14,15,16,17). Although these studies have greatly contributed to our understanding of its structural-functional relationships, various aspects of V2 receptor function are still elusive.
Here we report the results of mutational screening in 20 patients belonging to 18 unrelated NDI families of Italian origin and the identification of nine novel AVPR2 mutations. Two novel missense mutations involving residues located in regions known to be crucial for receptor function were reproduced and analyzed in vitro. Mutation A84D involves a residue adjacent to an aspartic acid located in helix two, which is known to participate in the regulation of receptor activation in a number of G protein-coupled receptors (18); mutation W99R affects a residue located at the beginning of the first extracellular loop, a region involved in determining high-affinity agonist binding and receptor selectivity (19,20). The effects of the two mutations on receptor processing, sorting, and function were investigated.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
DNA Sequencing of the AVPR2 Gene
Genomic DNA was extracted from peripheral blood using standard methods (DNA
isolation kit for mammalian blood; Boehringer, Mannheim, Germany). The AVPR2
gene was amplified in four portions and sequenced. PCR amplification was
performed using the following primer pairs (the numbers refer to their
nucleotide position in the genomic sequence [accession no. L22206], and F and
R to their forward and reverse orientation): 36F (CCATCCCTCTCAATCTTCCC)/776R
(CGCCAGCACCAGGCCATT); 576F (GCACAGCACCCTCTCTAACC)/1218R
(AGGTGACATAGGTGCGACGG); 1089F (GCCTTCTCGCTCCTTCTCAG)/1586R
(GGTGGAGGATCTAGGTTGGG); 1575F (GCCATCCTGAACCCAACCTA)/2019R
(TGAAGCTCTCCTCATACAGC). Thirty amplification cycles were performed consisting
of denaturation at 94°C for 1 min, annealing at 59°C for 1 min, and
polymerization at 72°C for 1 min. The PCR amplification products were
sequenced using a dideoxy protocol (Thermosequenase radiolabeled terminator
cycle sequencing kit; USB-Amersham) according to the manufacturer's
instructions.
Peptides and Chemicals
The synthetic vasopressin (AVP) was obtained from Bachem (Switzerland). The
iodinated V2 antagonist
d(CH2)5[o-ethyl-D-Tyr2,Val4),Tyr--NH29]-AVP
(21) was a generous gift of C.
Barberis (Institut National de la Santé et de
la Recherche Médicale, Montpellier, France).
The [3H]AVP (60 to 80 Ci/mmol) came from Dupont-New England Nuclear
(Boston, MA), and all of the other reagents were from Sigma Chemical Co. (St.
Louis, MO).
Cell Transfection and Mutagenesis
The human V2 cDNA (22) and
a human V2 cDNA bearing a myc tag at its NH2 end were a
generous gift of Dr. C. Barberis. The myc-tagged V2 cDNA was
subcloned into an M13 vector to obtain mutants by means of
oligonucleotide-directed mutagenesis (Sculptor kit; Amersham). After insertion
into a eukaryotic expression vector under the control of the CMV promoter
(pRK5), the wild-type (WT) and mutant receptors were transiently transfected
into COS7 cells (American Type Culture Collection, Manassas, VA) by means of
electroporation. The COS7 cells were grown in Dulbecco's modified Eagle's
medium (DMEM) (Life Technologies BRL) supplemented with 10% fetal calf serum
(Sigma), 100 IU/ml penicillin, and 10 µg/ml streptomycin (Life Technologies
BRL), in 5% CO2 in air, at 37°C. The electroporation (280 V,
960 µF; Bio-Rad gene pulser electroporator) was performed in a total volume
of 300 µl, with 20 µg of carrier DNA (vector without any insert) or 75
ng of plasmid DNA (vector with a subcloned insert) and 107 cells in
electroporation buffer (50 mM K2HPO4; 20 mM
CH3COOK, 20 mM KOH).
Western Blot Analysis
Forty-eight hours after electroporation, the cells were washed twice with
cold phosphate-buffered saline (PBS), scraped from the plate, and collected by
means of centrifugation. The cell pellet from each plate was resuspended in 50
mM Tris-HCl, pH 6.8, and Laemmli buffer was added. The samples were boiled for
5 min, separated (25 µl/lane) by means of sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (10% acrylamide), and transferred to
nitrocellulose (0.45 µm) for 4 h at 380 mA (constant current) with 25 mM
Tris, 192 mM glycine, and 20% methanol as the transfer buffer. After transfer,
the nitrocellulose sheets were stained with Ponceau S to visualize the protein
bands and were then immunoblotted. The unbound sites were blocked overnight at
4°C in TBS (150 mM NaCl, 20 mM Tris, pH 7.4) containing 5% nonfat dry milk
and 0.1% Tween 20 (blocking solution). The blots were washed five times (5 min
each time) with TBS containing 0.1% Tween 20 (TBST), and then incubated for 2
h with a 1:2000 dilution of anti-myc antibody in blocking solution.
After washing in TBST, the blots were incubated for 1 h with
peroxidase-conjugated anti-mouse polyvalent immunoglobulins (dilution 1:5000;
Sigma) in blocking solution and then finally washed five times with TBST. The
bound antibodies were visualized using SuperSignal Substrate, Western blotting
(Pierce, Rockford, IL).
Metabolic Labeling, Immunoprecipitation, and Glycosidase
Treatment
Forty-eight hours after transfection, the samples were labeled by means of
a 2-h pulse of 100 µCi/ml
L-[35S]methionine/L-[35S]cysteine (PRO-MIX; Amersham
Pharmacia) in methionine/cysteine-free DMEM, supplemented with 5% dialyzed
fetal bovine serum (FBS), antibiotics, and L-glutamine, and then underwent
overnight chase incubation in complete medium. After washing with PBS, the
cells were lysed in 0.2 ml of 1% (wt/vol) SDS containing 0.067
trypsin-inhibiting units/ml aprotinin and 1 mM phenylmethylsulfonylfluoride
(PMSF). The DNA was broken down by means of repeated pipetting and boiling for
4 min, and then 0.8 µl of the following mixture (mix I) was added to each
sample: 1.25% (wt/vol) Triton X-100, 190 mM NaCl, 6 mM
ethylenediaminetetra-acetic acid (EDTA), 50 mM Tris-HCl, pH 7.5, and the
protease inhibitors indicated above. After centrifugation at 13,000 x
g for 10 min at 4°C, 10 µl of myc monoclonal antibody
were added to each supernatant, and the samples were incubated overnight at
4°C. Twenty-five microliters of a 1:1 suspension of protein A-Sepharose
CL-4B beads (Pharmacia) in mix II (four parts of mix I plus one part of 1%
SDS) were added to each sample and incubated for 4 to 5 h at 4°C with
continuous rotation. The immunocomplexes were washed three times for 15 min at
4°C with mix II (1 ml), and once with 50 mM Tris-HCl, pH 6.8, before being
detached from the protein A-Sepharose beads by means of boiling for 5 min in
0.15% (wt/vol) SDS containing 1% (vol/vol) ß-mercaptoethanol. After the
sedimentation of the beads, the supernatants were supplemented with 5 vol of
0.1 M sodium citrate buffer, pH 5.5, and PMSF (1 mM final concentration) and
incubated overnight with 4 µU of endoglycosidase H (Endo H) (Boehringer).
The samples treated with peptide N-glycosidase F (PNGase F) (Boehringer) were
denatured as for the Endo H digestions, but the SDS-containing supernatants
were diluted in a mixture containing sodium phosphate buffer, pH 7.2 (50 mM),
EDTA (20 mM), sodium octyl glucoside (1% wt/vol), and PMSF (1 mM). The samples
were separated by means of SDS-polyacrylamide gel electrophoresis (10%
acrylamide), and the gels were treated with 2,5-diphenyloxazole (PPO) for
fluorography. To maximize sensitivity, we used a miniaturization procedure
that involved soaking the PPO-impregnated gels after water washing in 50%
(wt/vol) polyethylene glycol 3000 (Sigma) at 70°C for 15 min before
drying. The dried gels were exposed on Kodak X-Omat AR-5 films at
-70°C.
Enzyme-Linked Immunosorbent Assay
After electroporation, the cells were plated at a density of 1.5 x
105 cells/well into 96-multiwell plates coated with DMEM containing
10% FBS. Forty-eight hours after transfection, the cells were washed twice
with 100 µl of cold PBS and incubated for 2 h at 4°C with a mouse
monoclonal anti-myc antibody in DMEM (10% FBS) at a dilution of 1:200
(vol/vol). After rinsing with PBS, the cells were fixed for 20 min at room
temperature with 4% paraformaldehyde in PBS, and then washed again with PBS
and incubated for 1 h at 37°C with DMEM containing 10% FBS to saturate all
nonspecific binding, before being incubated with a peroxidase-conjugated
anti-mouse IgG (Sigma) at a dilution of 1:2500 for 1 h at 4°C. After
washing five times with PBS, a peroxidase substrate (tetramethylbenzidine
dihydrochloride; Sigma) dissolved in 0.05 M phosphate-citrate buffer, pH 5.0,
containing fresh 30% hydrogen peroxide was added, and the cells were incubated
for 1 h at 37°C. The reaction was stopped by adding 1 M
H2SO4 and read at 450 nm.
Immunofluorescence Studies
After electroporation, COS7 cells were plated at a density of 2 x
106 cells/well into 6-multiwell plates containing sterilized glass
coverslips. Forty-eight hours after transfection, the cells were washed twice
with a low salt solution (LS: 150 mM NaCl, 10 mM phosphate buffer) and fixed
for 20 min at room temperature with freshly prepared 4% paraformaldehyde in
PBS. After rinsing with LS, the cells were incubated for 2 h at room
temperature in GDB (0.2% gelatin, 0.6% Triton X-100, 40 mM phosphate buffer,
0.9% NaCl) containing a 1:200 (vol/vol) dilution of a mouse monoclonal
antibody direct against the myc-epitope. After washing off the
unbound antibody with a high salt solution (HS: 500 mM NaCl, 20 mM phosphate
buffer), the cells were incubated for 1 h at room temperature in GDB
containing a 1:150 dilution (vol/vol) of a Texas-red-conjugated anti-mouse IgG
(Jackson Immunoresearch Laboratories, West Grove, PA). The unpermeabilized
cells were first washed with a PBS solution containing 0.1 mM
CaCl2, 1 mM MgCl2 and incubated for 1 h in ice with
primary antibody in the same solution containing 0.5% bovine serum albumin
(BSA). The cells were then rinsed with LS, HS, and incubated with a secondary
antibody in GDB without Triton X-100; the unbound secondary antibody was
removed by HS and LS washes, and the coverslips were mounted on microscope
slides using a 1:1 (vol/vol) glycerol/PBS solution. The images were obtained
using a Zeiss Axiophot epifluorescence photomicroscope (Oberkochen,
Germany).
Receptor Binding Assay
For the binding determinations of cell surface receptors, the transfected
cells were subcultured into 24-well plates at a density of 4 x
105 cells/well; 72 h after transfection, the cells were washed
twice with binding buffer (146 mM NaCl, 4.2 mM KCl, 0.5 mM MgCl2,
1.0 mM CaCl2, 10 mM Hepes base, 1% glucose, 0.018% L-tyrosine, 1%
BSA, pH 7.4) and placed on ice. Increasing concentrations of
[3H]AVP were added to the wells in the absence or presence of
10-6 unlabeled AVP in a final volume of 200 µl. After incubation
for 2 h at 4°C, the cells were washed three times with cold binding buffer
to remove the unbound radioactivity, and then solubilized with 0.5N NaOH. The
samples were transferred into scintillation vials and counted in a beta
counter after the addition of 3.5 ml of scintillation cocktail (Ultima Gold;
Packard, Meriden, CT).
To prepare the membranes, the transfected COS7 cells were plated into 150-mm Petri dishes. Seventy-two hours after transfection, the cells were homogenized in a glass potter, washed twice, and resuspended in the binding buffer (50 mM Tris HCl, 5 mM MgCl, pH 7.4). When [125I]-labeled-d(CH2)5[o-ethyl-D-Tyr2,Val4,Tyr--NH29]-AVP was used, 5 µg of the membrane proteins were incubated for 60 min at 30°C; when [3H]-AVP was used, the incubation lasted 30 min in the presence of 10 µg of membrane proteins. Nonspecific binding was determined in the presence of 250- to 1000-fold excesses of unlabeled analogs. The bound and free radioactivity was separated by means of filtration over Whatman GF/C filters (Maidstone, United Kingdom) presoaked in 10 mg/ml BSA. The binding isotherms were analyzed using the iterative curve-fitting program LIGAND (23).
cAMP Accumulation Assay
After transfection, the cells were grown in 10-cm Petri dishes for 48 h,
and then washed twice with PBS without Ca2+ and Mg2+
(PBS-), incubated for 15 min at 37°C in PBS-
supplemented with 4 mM EDTA, scraped off using a policeman, and finally
centrifuged. The pellet was resuspended at a density of 106
cells/90 µl in Dulbecco's-PBS supplemented with 5.5 mM
3-isobutyl-1-methylxanthine. Aliquots of 90 µl were left for 15 min at
37°C, treated with assay buffer (baseline) or AVP to a final concentration
of 10-6, and incubated for 10 min at 37°C. cAMP accumulation
was stopped by placing the tubes in liquid nitrogen and boiling for 5 min. The
samples were then centrifuged for 8 min at 12,000 rpm in an Eppendorf
centrifuge, and the supernatants were immediately used for the assay. cAMP was
quantified by means of a competitive binding assay (cAMP [3H] assay
kit, Amersham International) according to the manufacturer's instructions.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
|
Figure 1 schematically shows the location of the identified mutations along the coding sequence of the V2 receptor. It is predicted that four of the novel mutations lead to the premature termination of the protein (a deletion of two nucleotides at position 207 to 208, a nonsense mutation at position 563, a deletion of 13 bp at bases 498 to 510, and a deletion of one nucleotide at position 809). Given that V2 is a G protein-coupled receptor characterized by the presence of seven transmembrane regions, and that all of these mutations will produce a protein lacking the correct number of transmembrane domains, it can be expected that these mutants will lead to a complete loss of function.
|
It is interesting to note that in one patient, we identified two different
nucleotide substitutions in the AVPR2 coding region: the first is a recurrent
C 
T mutation at position 675 (expected amino acid change Arg202
Cys); the second is a G A replacement at position 1126, which should
cause an amino acid change in the receptor's C-terminal region (Gly352
Asp). The study of 100 chromosomes from Italian subjects indicates that this
substitution does not represent a frequent polymorphism in the general
population (not shown).
Novel missense mutations were identified in five Italian families. It is
predicted that a G A mutation at position 406 changes the residues
located in the third extracellular regions (Cys112 Tyr); a mutation in
the same codon has been described previously (T C at 405) and leads to
a different amino acid replacement (Cys112 Arg)
(24). The T C mutation
at 916 and the T G mutation at 997 are likely to lead to the
substitution of residues located in the sixth and seventh transmembrane
domain, respectively (Leu282 Pro; Leu309 Arg); the C A
mutation at 322 should produce an Ala Asp change at residue 84 in the
second transmembrane domain (A84D mutation); and the T C mutation at
position 366 should lead to a Trp Arg change at residue 99, which is
located in the first extracellular loop (W99R mutation).
Because the last two mutations affect residues located in receptor domains known to be crucial for receptor function (residue 84 is adjacent to the highly conserved aspartic acid of the second transmembrane domain that participates in the regulation of receptor activation; residue 99 is located at the beginning of the first extracellular loop, a domain that is involved in determining high-affinity agonist binding), expression studies of the A84D and W99R V2 receptor proteins were carried out.
Cell Localization and Biochemical Properties of the A84D and W99R
Receptor Mutants
The subcellular localization of the WT V2 receptor, as well as that of the
two novel receptor mutants (A84D and W99R), was immunofluorescently analyzed
using a monoclonal antibody directed against an myc epitope tagged to
the NH2 terminus of the receptor
(Figure 2). The COS7 cells
transfected with the WT V2 receptor showed considerable surface fluorescence,
whereas the untransfected cells were not stained by the antibody (not shown).
Intracellular staining without any surface signal was observed in the cells
transfected with the A84D mutant, whereas the positive surface signal present
in the cells transfected with the W99R mutant indicates that it is capable of
reaching the plasma membrane.
|
To quantify the number of W99R and A84D mutant receptors sorted to the plasma membrane, we performed enzyme-linked immunosorbent assay (ELISA) experiments involving the transiently transfected COS7 cells. As shown in Table 2, the cell surface presence of the W99R mutant was approximately 58% of that of the WT receptor; to our surprise, we also found a small but significant amount of the A84D receptor mutant (16% of WT) on the cell surface.
|
To verify whether the difference in the number of receptors reaching the plasma membrane reflected a difference in the total protein content synthesized within the cells, we analyzed COS7 cells transfected with equal amounts of WT and mutant receptor cDNA by means of Western blots (Figure 3A). In the case of the WT receptor and W99R mutant, three specific bands were found at approximately 35 to 37, 50, and 70 to 75 kD, as described previously (25,26). In contrast, the A84D mutant only showed the 35- to 37-kD and 70- to 75-kD bands (which represent immature receptor forms) (25,26), and the 50-kD band corresponding to the glycosylated mature receptor was undetectable.
|
Compared with the WT receptor, the immature W99R forms corresponding to the 35- to 37-kD and 70- to 75-kD bands seemed to be more abundant than the mature receptor represented by the 50-kD band, suggesting that incorrect protein folding may lead to an increase in the accumulation of nonglycosylated receptors inside the intracellular compartments. Furthermore, the decreased intensity of the 50-kD band correlated with and may explain the reduced surface expression of W99R (58% as quantified by ELISA experiments). Finally, to investigate whether the accumulation of immature W99R forms may perturb the sorting of this protein to the cell surface via the Golgi compartment, we used Endo H and PNGase F treatments to analyze the maturation process of the W99R receptor (Figure 3B). In agreement with the results of previous studies (25,26,27), the WT broad band of 50 kD was resistant to Endo H but sensitive to PNGase F, with the treatment giving rise to a band of approximately 40 kD corresponding to a nonglycosylated mature receptor. These results indicate that the broad 50-kD band corresponds to a receptor form characterized by the presence of sugar moieties that are biochemically modified during their transit through the Golgi complex. Although less intense, the 50-kD band of the W99R mutant retained its resistance to Endo H and sensitivity to PNGase F, indicating that this receptor mutant is correctly processed and reaches the cell surface via the constitutive pathway.
Pharmacologic Properties of the A84D and W99R Receptor Mutants
Given that both the A84D and the W99R mutants were sorted to the plasma
membrane, we investigated whether they retained their binding and signaling
properties.
We began analyzing the binding properties of the mutated and WT receptors by means of binding assays of homogenates and intact cells using the specific [3H]AVP agonist and a recently developed iodinated V2 antagonist kindly provided by C. Barberis (21). The affinities for these compounds were first determined by means of saturation experiments and Scatchard plots in the WT and myc-tagged version of the V2 receptor. The Kd value for [3H]AVP in the homogenates and intact cells was, respectively, 4.2 ± 0.81 nM and 25.3 ± 6.3 nM; the Kd value for the [125I] V2-antagonist was 1.3 ± 0.92 nM in the cell homogenates, with no differences in the Kd values of the tested analogs between the tagged and untagged WT receptors. The calculated Bmax value in the homogenates and intact cells was 2.66 ± 0.8 pmol/mg protein and 435,000 ± 35,700 sites/cell, respectively. Neither the agonist nor the antagonist specifically bound either the homogenates or the intact cells transfected with the A84D and W99R mutants.
Finally, the coupling properties of the A84D and W99R mutants were assayed
in transiently transfected COS7 cells. As shown in
Figure 4A, when the cells
transfected with the W99R receptor were stimulated with a very high
concentration of AVP (10-5), cAMP production increased to 4.22
± 1.03 times the baseline values (n = 3); under the same
conditions, the WT receptor induced a 5.2 ± 0.80-fold increase
(n = 4). In the cells transfected with the A84D mutant (n =
5), cAMP accumulation was 1.56 ± 0.09 times the baseline value, and the
dose-response curves indicated reduced AVP EC50 values in both
mutant receptors compared with WT (Figure
4, B and C). These data indicate that the two receptor mutants
retain their ability to bind to and become activated by the natural AVP
agonist, and to couple to G
s.
|
However, a considerable reduction in agonist affinity is suggested by the
several orders of magnitude decrease in EC50 values, as well as by
our failure to detect any specific binding in saturation experiments. The
reduced affinity relating to the W99R mutation is particularly interesting
because this residue, which is located at the beginning of the first
extracellular loop, is conserved in all of the vasopressin/oxytocin receptors
cloned thus far. The contribution of this residue in determining the agonist
binding site in the first extracellular loop was therefore investigated with
the aid of the available molecular models of the AVP/OT receptors
(19,27,28,29),
in which the position of W99 with respect to the first extracellular loop is
slightly different. In the alignment used by Hibert et al. to build
the model of the V1A and V2 receptors, W99 is located at the end of the second
transmembrane domain of AVP/OT receptors
(19,27,28);
in a more recent model built for the human OTR
(29), it is located in the
first extracellular loop. In both cases, its location at the boundary between
the second -helix and the extracellular space suggests that it may play
a role in stabilizing the ionic bond between the lateral chain of arginine 8
of AVP and the aspartic acid at position 103 of the V2 receptor
(Figure 5), an interaction that
is known to be crucial to the high-affinity binding of vasopressin to the V2
receptor
(19,20).
Mutation W99R not only impairs this possible stabilization, but may also
produce an intramolecular interaction between the lateral chain of D103 and
the new arginine residue introduced at position 99; this ionic bond would
greatly alter the conformation of the first extracellular loop and thus
explain the impaired binding properties of the mutated receptor.
|
Treatment with Chemical Chaperones
Unlike the majority of AVPR2 mutants, which are retained within
intracellular compartments
(27,30),
the A84D and W99R receptors are capable of reaching the plasma membrane where
they can bind to the agonist (although with very low affinity) and become
activated. These properties make them good candidates for pharmacologic
treatments aimed at increasing their sorting to and/or their permanence on the
cell membrane. Chemical chaperones are molecules that have been shown to
facilitate the folding and intracellular transport of membrane proteins,
including the protein product of the most common mutation (
F508) of the
cystic fibrosis transmembrane conductance regulator (CFTR) gene
(31). To test the effect of
chemical chaperones on the AVPR2 mutants, we used glycerol and DMSO at
concentrations that were ineffective on cell viability (not shown) to treat
cells transfected with the WT receptor and the A84D and W99R mutants. Our
results indicate that chemical chaperones have no effect on the intracellular
processing of these receptors (Figure
6).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
In three families, no AVPR2 gene mutations were found, thus confirming the lower frequency of autosomal versus X-linked NDI (30). Only seven of the 15 families with an identified AVPR2 mutation had a positive family history for the disease, thus indicating an approximately 50% occurrence of sporadic cases similar to that observed in an analogous study carried out in North America (17). Given that the mother may be a carrier of the disease in two-thirds of such sporadic cases (17), female testing should be considered an indispensable part of the genetic counseling of NDI families.
No significant variation in phenotype expression was found in the patients from the 15 families carrying AVPR2 gene mutations, despite the differences in the types of mutation, which included three deletions and one nonsense mutation predicted to lead to truncated null receptors, and 11 missense mutations. The effects of the missense mutations on receptor function are less easily predictable because their discrete localization in different receptor domains means that they may knock out various pharmacologic and biologic receptor properties at different steps. It is for this reason that like the LDL gene mutations in familial hypercholesterolemia (32), the AVPR2 mutants have been divided into three different groups on the basis of their effects: (1) a defect in ligand binding; (2) a defect in G protein coupling and activation; and (3) a defect in transport. Because the functional evaluation of the natural mutations causing NDI may be a valuable means of identifying the receptor residues involved in specific receptor tasks, we undertook expression studies of two of the novel missense mutations.
Mutation A84D primarily impaired protein sorting to the plasma membrane. Given that Western blot analysis revealed an accumulation of immature receptor protein inside the cells, only a small amount of the synthesized receptor was able to reach the cell surface; it is worth noting that the mutated receptor reaching the plasma membrane was measurable by means of ELISA but not by means of indirect immunofluorescence. Although the A84D mutant is still able to bind the agonist (as indicated by the fact that it induces an accumulation of intracellular cAMP upon AVP stimulation), our saturation experiments failed to detect any specific binding in transfected cells. This negative finding may be due to the greatly reduced number of receptors present on the cell surface and/or to a greater decrease in receptor affinity induced by the mutation. We tend to favor the second hypothesis because the calculated EC50 for AVP was several orders of magnitude higher in the mutant than in the WT receptor. The reduced agonist affinity may be explained by the proximity of the mutation to the aspartic acid (D85) conserved in all G protein-coupled receptors and known to participate in some of the conformational changes associated with the process of receptor activation; reduced receptor coupling due to perturbations of D85 interactions may lead to a receptor with a reduced affinity for agonists, as has already been shown in the oxytocin and V1A receptor subtypes (28,29).
It is also important to note that our results indicate that the cAMP accumulation assay is by far the most sensitive method of routinely screening AVPR2 mutations, since Western blot, indirect immunofluorescence, and saturation experiments all failed to detect the small but still functional fraction of the correctly sorted A84D mutant.
Mutation W99R induced the replacement of a tryptophan residue located at the beginning of the first extracellular loop, a region known to participate in the formation of the agonist binding pocket (33). Amino acids located in this region have been shown to determine the high-affinity binding properties of agonists (19,20), and previously identified AVPR2 mutations have been shown to gave rise to receptors with defective binding properties (10). W99 is conserved in all of the vasopressin/oxytocin receptors cloned thus far, and its high degree of conservation suggests that it may play a particularly important role in the induction and/or stabilization of the structural features of this region. The results of our expression study indicate that this mutant receptor is synthesized, processed, and transported to the plasma membrane, where it is able to bind and be activated by vasopressin. Folding defects caused partial retention inside the intracellular compartments and a decrease in the abundance of the fully glycosylated mature receptor form that is presumed to reach the plasma membrane. This reduction in mature W99R protein coincided with a decrease in the number of surface receptors, which were evaluated by means of ELISA as being approximately 58% that of the WT receptor. Using the Bmax value obtained for the WT receptor, we estimated that the expression level of the W99R mutant was approximately 1.56 pmol/protein and 261,000 sites/cell, which is still quite a high level of receptor expression. Thus, under our experimental conditions, the failure to detect any specific binding in saturation experiments performed using agonist and antagonist ligands cannot be ascribed to a very low level of W99R expression, but is more likely to be due to a greatly reduced affinity for the tested peptides. Impaired receptor binding is also supported by the very low EC50 value for AVP shown by the dose-response curves of cAMP accumulation. W99 may play an important role in stabilizing the receptor/peptide interaction between D103 and arginine 8 of vasopressin, which has been shown previously to be responsible for the high-affinity binding of highly selective V2 receptor agonists (AVP and deamino-8-Darginine vasopressin). The location of W99 at the beginning of the first extracellular loop suggests that the reduced affinity of the receptor may be due to the formation of an intramolecular salt bridge between R99 and D103, which prevents the establishment of the interaction between D103 and the lateral chain of arginine 8 of vasopressin. Finally, the W99R receptor is a good candidate for testing the efficacy of nonpeptidic agonists in restoring the functional nature of V2 receptors bearing mutations at their agonist binding sites. By binding to different receptor regions, these analogs may activate mutated receptors that no longer respond to classical agonists (AVP and deamino-8-Darginine vasopressin).
Expression and functional studies of AVPR2 mutations (such as the one reported here) thus represent a fundamental step in the development of new pharmacologic tools for the treatment of selected NDI patients.
|
Appendix |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
a See Appendix for contributing investigators and affiliated
organizations. 
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionAppendixReferences |
|---|
V278 in patients with nephrogenic diabetes insipidus impair ligand
binding of the receptor. Biochem Biophys Res Commun211
: 967-977,1995[Medline]
This article has been cited by other articles:
 |
|
 |
|
  J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus. Am J Physiol Renal Physiol, August 1, 2006; 291(2): F257 - F270. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-F. ARTHUS, M. LONERGAN, M. J. CRUMLEY, A. K. NAUMOVA, D. MORIN, L. A. DE MARCO, B. S. KAPLAN, G. L. ROBERTSON, S. SASAKI, K. MORGAN, et al. Report of 33 Novel AVPR2 Mutations and Analysis of 117 Families with X-Linked Nephrogenic Diabetes Insipidus J. Am. Soc. Nephrol., June 1, 2000; 11(6): 1044 - 1054. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
