 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
REGULAR ARTICLES |
*
Nephrourology Unit, Institute of Child Health, University College London
Medical School, London, United Kingdom
Department of Clinical Neurology, Institute of Neurology, University
College London Medical School, London, United Kingdom
Regeneron Pharmaceuticals Inc, Tarrytown, New York.
Correspondence to Dr. Hai Tao Yuan, Nephrourology Unit, Institute of Child Health, University College London, 30 Guilford Street, London WC1N 1EH, United Kingdom. Phone: +44 020 7242 9789; Fax: +44 020 7916 0011; E-mail h.yuan{at}ich.ucl.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
-smooth muscle actin. The mesangium of immature
glomeruli also expressed LacZ. In the first 3 postnatal weeks, a new pattern
became evident, with intense X-gal staining in the inner stripe of the outer
medulla, where a subset of thin descending limbs of loops of Henle expressed
the transgene. This dynamic and developmentally regulated pattern indicates
that Ang-2 is an early marker of the renal pericyte and vascular smooth muscle
lineage and is also an epithelial-derived growth factor. Because Tie-2 is
widely expressed by differentiating renal endothelia, this study is consistent
with the hypothesis that Ang-2 has roles in kidney vascular maturation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
Less is known about the Tie genes (tyrosine kinase containing immunoglobulin-like loops and epidermal growth factor similar domains), which constitute another class of endothelial RTK. As endothelia differentiate, the onset of Tie expression postdates VEGFR-2 but precedes maturity (5,6). Tie-1 null embryos die with impaired vessel integrity (12), and mutant cells in chimeras fail to contribute to renal vasculature, suggesting a nephrogenic role for this gene (13). Tie-1 is expressed in mouse metanephroi from E11.0 (9), with levels peaking in the first few weeks after birth (14). When avascular E11.0 Tie-1/LacZ metanephroi were implanted into wild-type neonatal kidneys (9), transgene-expressing glomerular and stromal capillaries developed in transplants, demonstrating in situ differentiation from Tie-1-positive precursors (9). Furthermore, Tie-1-expressing metanephric capillaries were upregulated in hypoxic organ culture (15). No ligand has been reported for Tie-1.
Tie-2 is a Tie-1 homologue and its ligands are encoded by angiopoietin (Ang) genes. Ang-1 binds Tie-2 eliciting tyrosine phosphorylation (16) and, although it does not stimulate endothelial proliferation (16), it prevents apoptosis (17) and causes sprouting in synergy with VEGF (18). Ang-1 (19) and Tie-2 (12,20) null mutant mouse embryos have abnormal vascular network formation with growth-retarded pericytes and vascular smooth muscle precursors. Folkman and D'Amore (21) postulated that Tie-2 signaling caused endothelial stabilization with reciprocal, maturational effects on pericytes elicited by endothelial-derived factors such as platelet-derived growth factor-B. Recent experiments show that Ang-1 is also a hematopoietic factor (22). Additional angiopoietins have been cloned (6,23,24). Ang-2 binds Tie-2 in cultured endothelia but does not cause tyrosine phosphorylation in these cells (23). Instead, it antagonizes Ang-1-induced Tie-2 phosphorylation, while Ang-2 overexpression in vivo causes defects resembling Tie-2 and Ang-1 null mutants (23).
Expression studies in nonrenal tissues are consistent with the hypothesis that Ang-1 and Ang-2 are expressed by smooth muscle cells, pericytes, and their precursors, and exert paracrine effects on Tie-2-expressing endothelia (16,23,25,26). However, certain endothelia can express Ang-2 in vitro (26,27), raising the additional possibility of an autocrine action. Ang-2 has also been implicated in hepatocellular carcinomas and glioblastoma growth (28,29), where it may facilitate sprouting by destabilizing existing capillaries, and in cycling ovarian follicles (23). The final effects of Ang-2 probably depend not only on the local expression of Ang-1 and Tie-2, but also on the activity of yet other factors such as VEGF (6,23).
In this study, we documented the nephrogenic pattern of Ang-2 in a mouse strain that expresses the LacZ reporter gene driven by the Ang-2 promoter. LacZ codes for bacterial ß-galactosidase, which is easily localized in tissues by the X-gal reaction (9,15). We demonstrate that Ang-2 is expressed at critical stages of renal vascular maturation, first by mesenchymal-derived endothelial support cells including pericytes, smooth muscle cells, and mesangial cells, and second by tubular epithelia near the maturing vasa rectae.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
Ang-2/LacZ Mice
A promoterless LacZ gene and Ang-2 gene fragments were used to construct a
targeting vector, which was introduced into embryonic stem cells to disrupt
the Ang-2 gene (see Table 1 in
reference (6) (C. Suri, J.
McClain, M. V. Simmons, T. Sato, and G. D. Yancopoulos. manuscript in
preparation), as described for Ang-1 null mutants
(19). Positive clones were
used to create chimeric mice by standard protocols
(30). This resulted in mice in
which the LacZ gene was driven by the Ang-2 promoter, i.e.,
Ang-2/LacZ mice. For the current experiments, Ang-2/LacZ heterozygous mice and
wild-type littermates were generated by mating heterozygous males and females.
Mice were genotyped by PCR using DNA extracted from embryo heads or postnatal
tail snips (31). Primers were
designed to amplify one mutated band (280 bp) or a wild-type band (380 bp),
which were visualized after electrophoresis through ethidium bromide-stained
agarose gels. The primers used were: 5'GDT: CTGGGATCTTGTCTTGGCC;
mL2-intron1US1: CTTCTCTCTGTGACTGCTTTGC; and neo3'ds85:
GAGATCAGCAGCCTCTGTTCC.
|
PCR was performed for 30 cycles: 1 min denaturing at 95°C, 30 s annealing at 63°C, and 30 s extension at 72°C.
Mouse gestation lasts 21 d and the vaginal plug day was designated E0.0. Ages examined were E10.5, E12.0, E14.0, E19.0, the day of birth (neonatal), and 1, 3, and 8 wk postnatal (P1, P3, and P8). At least six animals (three wild-type and three heterozygous mice) were examined at each stage from at least two litters, and consistent results were reported. To count nephrons in neonatal and P3 mice (32), we incubated whole kidneys in hydrochloric acid for 10 to 50 min at 37°C, then rinsed them in tap water and stored them overnight at 4°C. Glomeruli were counted after mechanical dissociation.
X-Gal Staining
Metanephric and postnatal kidneys were fixed in 4% paraformaldehyde, 2 mM
MgCl2, and 5 mM ethyleneglycol bis(ß-aminoethyl
ether)-N,N'-tetra-acetic acid in phosphate-buffered saline
(PBS) for 60 min at 4°C and washed 3 times in 1 x PBS. Staining was
performed by incubation with 5 mM K3Fe(CN)6, 5 mM
K4Fe(CN)6 · 3H2O, 2 mM
MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, and 1 mg/ml
4-chloro-5-bromo-3-indolyl-ß-D-galactopyranoside to allow optimal
detection of cytoplasmic reporter gene product while abolishing background
staining from endogenous galactosidase
(9,15).
Tissues were examined as whole mounts or were paraffin-embedded and sectioned
at 10 µm. Sections were counterstained with hematoxylin, and some were
subjected to immunohistochemistry, described below. Other tissues were
processed for electron microscopy to visualize intracellular crystals produced
by the X-gal reaction (33).
Kidneys were fixed in 3% glutaraldehyde in pH 7.4 0.1 M sodium cacodylate and
5 mM NaCl. Ultrathin sections were cut on an RTC MT6000 ultramicrotome using a
Diatome diamond knife (Agar Scientific Ltd., Stansted, United Kingdom).
Sections were stained with 25% uranyl acetate in 50% methyl alcohol and
Reynold's lead citrate, each for 20 min, and grids were examined with a JEOL
1200EX electron microscope (Tokyo, Japan). Other sections were examined
without uranyl acetate because preliminary experiments revealed that X-gal
reaction product crystals were visualized more easily in this manner, albeit
with some loss of tissue definition.
Immunohistochemistry
Paraffin sections were treated with trypsin (1 mg/ml) for 10 min at
37°C. Endogenous peroxidase was quenched with 3%
H2O2 in methanol for 30 min at room temperature, and
sections were blocked in 10% goat serum with 0.1% Tween 20. They were reacted
with an alkaline phosphatase-conjugated antibody to -smooth muscle
actin (-SMA) (1:100; Sigma; A-5691) or a horseradish
peroxidase-conjugated antibody to anti--SMA (1:100; DAKO; U7033), a
vascular wall marker (34); an
antibody to aquaporin-1 (a gift from Mark A. Knepper, National Institutes of
Health, Bethesda, MD), a marker of a subset of thin descending limbs of loops
of Henle and descending vasa recta
(35); and an antibody to
Tamm-Horsfall glycoprotein (1:50; Europa Bioproducts Ltd., Cambridge, United
Kingdom), a marker of thick ascending limbs of loops of Henle
(36). Bound aquaporin-1 and
Tamm-Horsfall glycoprotein antibodies were detected with the
streptavidin-biotin peroxidase ABC kit (DAKO, High Wycombe, United Kingdom),
producing a brown product. For -SMA, we used either Fast Red for the
Sigma antibody or diaminobenzidine for the DAKO antibody. Both gave
essentially similar results apart from the vasa recta area, where only the
peroxidase technique was sensitive enough to detect -SMA
immunoreactivity in the pericytes of the descending vasa recta.
Statistical Analyses
Results are given as mean ± SD. Group means were compared using the
t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
Early Nephrogenesis
During E10.5 to 14.0, no X-gal staining was observed in wild-type embryos
(not shown). Furthermore, the timing and anatomy of early nephrogenesis
appeared similar in wild-type and heterozygous littermates, although this was
not quantified. Figure 1A is a
whole mount of an E10.5 Ang-2/LacZ heterozygous embryo with transgene
expression in cardiac outflow tract, liver primordium, dorsal aorta, and
allantoic region. Histology confirmed that liver cells were positive
(Figure 1B). At E10.5, the
mesonephros contained capillaries and tubules but did not express the
transgene (Figure 1C), nor did
the avascular metanephric primordium (not shown). The E12.0 metanephros
contained patent capillaries around ureteric bud branches but no Ang-2/LacZ
expression was detected in heterozygous organs
(Figure 1D). At E14.0,
metanephric Ang-2/LacZ expression was detected in whole mounts
(Figure 1E); dorsal aorta and
adrenal glands were also positive. Histology
(Figure 1F) demonstrated
transgene expression around aorta, renal artery, and its first-order
metanephric branches. A high-power view of the dorsal aorta
(Figure 1G) demonstrated
multiple layers of Ang-2/LacZ-expressing cells around the lumen. Transgene
expression tended to be more extensive than for -SMA, which was
confined to cells near the endothelium
(Figure 1, compare H and G).
There was a compact arrangement of X-gal-positive cells around the renal
artery and its intrarenal branches (Figure
1I). Endothelial cells in the dorsal aorta expressed Ang-2/LacZ
(Figure 1, G and H), whereas
those in renal artery branches were negative
(Figure 1H). The first
metanephric glomeruli formed by E14.0 and were X-gal-negative
(Figure 1J).
|
Late Nephrogenesis
At E19.0 and in neonatal kidneys, a similar and complex pattern of
Ang-2/LacZ transgene expression was found. Wild-type control kidneys showed no
X-gal staining and were of similar size to heterozygous littermates
(Figure 2A). Neither kidney
weights nor numbers of glomeruli showed any significant difference between the
two groups on the first day after birth
(Table 2). In whole mounts of
heterozygous kidneys, the transgene was expressed in renal artery branches,
extending to third- and fourth-order vessels
(Figure 2, A through C).
Sectioning whole mounts allowed visualization of Ang-2/LacZ expression in
arcuate vessels at the junction of cortex and medulla
(Figure 2, D and E).
Figure 3, A through C, shows
micrographs of heterozygous neonatal kidneys reacted with X-gal and
immunostained for -SMA. Glomeruli expressed the transgene in the hilum
and the mesangium (Figure 3, A and
G). Weak Ang-2/LacZ expression was also noted in a few cells in
the terminal portions of proximal tubules and descending thin limbs of loops
of Henle (Figure 3B), and
thinner, parallel medullary structures considered to be small vessels
(Figure 3C). These organs
expressed -SMA in small cortical arteries
(Figure 3A), afferent
glomerular arterioles (not shown), and in a ladder arrangement of stromal
cells between medullary structures (Figure
3, B and C). Figure 3, D
through F, shows comparable areas of wild-type littermate kidneys
demonstrating absent X-gal staining in diverse structures that were
morphologically similar to those in heterozygous organs; patterns of
-SMA were also similar. Heterozygous arcuate vessels
(Figure 3G) expressed
Ang-2/LacZ in multiple layers of wall cells enveloping endothelia. However,
not all cells in a vessel were positive, even though situated at a similar
radial distance from the endothelium
(Figure 3G). Transgene
expression in small cortical and arcuate
(Figure 3H) arteries extended
further outward than -SMA immunostaining, even when the more sensitive
peroxidase technique was used for immunodetection.
|
|
|
One week after birth, heterozygous kidneys exhibited prominent medullary Ang-2/LacZ expression in thin structures aligned radially in the medulla (Figure 2F). Histology revealed two types of X-gal-positive elements (Figure 3I): thin structures, presumed to be vessels, and thicker epithelial structures that may be loops of Henle. Clusters of transgene-expressing "dots" were noted in the deep cortex (Figure 2, F and G), and histology demonstrated that these were juxtamedullary glomeruli and smaller vessels (not shown).
Postnatal Maturity
By 3 wk after birth, the kidney had matured, glomerulogenesis having ended
between P1 and P2 and the vasa recta bundles having reached their adult
conformation. Organs of wild-type P3 kidneys were of similar weight and
contained similar numbers of glomeruli as heterozygous littermates
(Table 2). Wild-type organs
were negative after X-gal staining (Figure
4A). In whole mounts of heterozygous P3 organs, intense Ang-2/LacZ
expression was noted in bundles of structures in the inner part of the outer
medulla (Figure 4B). These
organs also expressed the transgene in large branches of the renal artery (not
shown) and in arcuate, smaller cortical and afferent vessels supplying deep
glomeruli (Figure 4C). In P8
whole mounts (Figure 4D), there
was downregulated transgene expression in cortex and inner medulla, whereas
Ang-2/LacZ expression near vasa rectae remained prominent.
|
Figure 5 shows histology at
P3. In heterozygous kidneys, Ang-2/LacZ expression was downregulated in
glomeruli versus neonates and P1, with no expression in outer
cortical glomeruli (Figure 5A),
and low expression in juxtamedullary glomeruli (not shown). In contrast, there
was intense Ang-2/LacZ expression in the inner stripe of the outer medulla
(Figure 5, A, C, E, and G).
Figure 5, B, D, F, and H are
complementary views of wild-type littermates: They were X-gal-negative and
structurally similar to heterozygous kidneys. Histology with counterstaining
for -SMA, aquaporin-1, and Tamm-Horsfall glycoprotein clarified that
the most prominent transgene-expressing structures were located near vasa
recta bundles and were discrete from: (1) -SMA-positive
pericytes in descending vasa rectae (Figure
5C); (2) aquaporin-1-positive thin descending limbs
(Figure 5E); and (3)
Tamm-Horsfall glycoprotein-positive thick ascending limbs of loops of Henle
(Figure 5G). Two points should
be noted here. First, in murine species, a subset of thin descending limbs of
loops of Henle, derived from short-looped nephrons, are intimately associated
with vasa recta bundles (37).
Second, thin descending limbs are heterogeneous with respect to aquaporin-1
expression, with short nephrons expressing little or no aquaporin-1
(35). Hence, our data were
consistent with Ang-2/LacZ expression in this subset of thin descending
limbs.
|
Electron microscopy of wild-type (not shown) and heterozygous mice showed four profiles in this location (Figure 6A) (37): tubules with a thin layer of light cytoplasm and sparse microvilli, which were thin descending limbs of loops of Henle; tubules with a thick layer of mitochondria-rich cytoplasm, which were thick ascending limbs; fenestrated endothelia with wide lumens, which were ascending vasa rectae; and nonfenestrated endothelia, which were descending vasa rectae. X-gal staining of heterozygous organs revealed cytoplasmic precipitation of reaction product crystals in thin descending limbs of loops of Henle: These crystals were more easily seen in sections in which uranyl acetate staining had been omitted, as shown in Figure 6B.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
Yuan et al. (14) also localized Ang-2 mRNA to maturing outer medulla with a maximal signal at P3 in vasa rectae in the inner stripe. However, the resolution of the in situ hybridization technique was not optimal for the definitive assignment of Ang-2-expressing cells because of tissue distortion caused by the rigorous preparation required by this method. Furthermore, the relatively low sensitivity of the nonradioactive in situ technique probably only detected cells with the highest levels of Ang-2 transcripts. We therefore used heterozygous Ang-2/LacZ mice to further define Ang-2 expression during kidney development.
The results of our current study are consistent with several previous observations (14), including: (1) upregulation of metanephric Ang-2 expression prenatally; (2) intense expression of Ang-2 in postnatal outer medulla; and (3) an overall decreased expression between P3 and P8. It is important to note that heterozygous Ang-2/LacZ kidneys underwent normal development, as assessed by the acquisition of glomeruli and complex structures such as vasa rectae. Our new data further define the nature of Ang-2-expressing cells in the outer medulla and also demonstrate Ang-2 promoter activity in renal vasculature and glomeruli. These aspects are now discussed.
Ang-2 in Developing Renal Vessels
Hungerford and Little (38)
have reviewed the ontogeny of vascular smooth muscle, which differentiates as
"fibroblast-like" cells, lacking myofilaments and basement
membranes and appearing as aggregates near embryonic endothelium. In avian
embryos, where lineage studies have been performed, aortic arch vascular
smooth muscle cells derive from neural crest (i.e., ectoderm),
whereas vascular smooth muscle in the rest of the embryo may originate from
mesoderm. An alternative view was proposed by DeRuiter et al.
(39), who showed that
embryonic avian endothelia from dorsal aorta could transdifferentiate into
mesenchymal cells, which expressed myofilaments. Once recruited into the
lineage, vessel wall precursors express marker proteins for smooth muscle
maturation, with the highest levels near the endothelial layer. One such
protein is heavy caldesmon
(40), although this has not
been examined in nephrogenesis. Another structural protein expressed in this
lineage is -SMA, which constitutes up 40% of total protein in mature
cells, and Carey et al.
(34) reported that it was
widely expressed in the developing rat renal vasculature.
Simple capillaries in the E12.0 metanephros did not express Ang-2/LacZ but,
at E14.0, the transgene was expressed in multiple layers of cells surrounding
endothelia of the renal artery and its branches. As nephrogenesis proceeded,
expression was maintained in the arterial tree, extending to the arcuate and
small cortical vessels. Based on this dynamic and developmentally regulated
pattern, we propose that Ang-2 is a marker for the renal vascular smooth
muscle lineage. Not all cells in a single locus in an arterial wall expressed
Ang-2/LacZ, even though situated at a similar distance from the endothelium.
This heterogeneity might be explained by the presence of smooth muscle cells
of varied maturity, as discussed by Ehler et al.
(41). Using double labeling
for -SMA and Ang-2/LacZ, we found that myofilament immunolocalized to
cells adjacent to arterial endothelia, whereas Ang-2 expression tended to
extend to loosely arranged peripheral cells. However, we cannot rule out weak
expression of -SMA in peripheral cells, which might only be detectable
by a more sensitive method.
Hence, if vascular smooth muscle cells are recruited from surrounding mesenchyme, Ang-2 may be a very early lineage marker. However, from our descriptive study alone, it is impossible to know whether all such Ang-2-positive cells will be incorporated into vessel walls, and it is also possible that some will die or become interstitial cells. Although we noted weak transgene expression in small medullary vessels in the first postnatal week, it was not possible to establish whether this signal originated in endothelial or enveloping cells.
Of note, the walls of the developing kidney vasculature show widespread expression of another secreted protein, renin (42). However, although we found that Ang-2 expression was continuous through the fetal kidney arterial system to the level of small cortical arteries, albeit not in every cell in a single locus, renin-expressing cells were reported to be discontinuous, for example, localized to nascent branch points (42). Interestingly, it was recently reported that aquaporin-1 immunolocalized to the developing rat renal vasculature in a broadly similar pattern to Ang-2 (43), although it was not fully established which cells (i.e., endothelial or pericyte/smooth muscle) expressed the water pore. Collectively, these studies demonstrate a spectrum of gene expression in the renal vasculature, which is dramatically developmentally regulated.
Ang-2 Expression in Glomeruli
Our study further shows that Ang-2/LacZ was expressed in the core of
developing glomeruli, most likely in the mesangium. Mesangial cells share
biosynthetic and structural properties with vascular smooth muscle cells
(44), and Ang-2 expression is
therefore consistent with this relationship. Our unpublished data (H. T. Yuan
and A. S. Woolf, personal observations) show that conditionally immortal
mesangial cell lines isolated from young mice
(45) express Ang-2 mRNA in
culture. The origin of mesangial cells is unknown, although they appear to
derive from endogenous precursors in the metanephros
(46) and their formation is
dependent on platelet-derived growth factor-B
(47,48).
We speculate that Ang-2 from developing mesangial cells modulates the growth
of adjacent endothelia, which themselves express Tie-2
(14). In this context, it is
of interest that cultured mesangial cells express other secreted factors that
can target endothelia. These include VEGF
(49) and hepatocyte growth
factor
(45,50).
Ang-2 Expression and the Vasa Recta
We found low levels of Ang-2/LacZ expression in proximal tubules and thin
descending limbs of loops of Henle in the neonatal period, consistent with our
previous in situ hybridization data
(14). In the same study, Yuan
et al. (14) reported
a strong in situ hybridization in outer medullary vasa recta bundles
at P3, by which time these structures have acquired a mature configuration.
However, the resolution of that technique did not allow the definitive
assignment of positive cells. Our current analysis of the outer medulla in P3
heterozygous Ang-2/LacZ kidneys demonstrated prominent transgene expression in
tubular structures incorporated into the vasa recta bundle. Based on reasoning
outlined in the Results section, we suggest that these represent a subset of
thin descending limbs of loops of Henle, which are aquaporin-1-negative and
are derived from short-looped nephrons. We are aware that Park et al.
(51) reported that pericytes
envelop descending vasa rectae and, mindful of our observation that Ang-2 is
expressed by this lineage elsewhere in the kidney, we cannot exclude the
possibility that these cells also express Ang-2 below the current limit of
detection.
|
Conclusion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
-actin
expression in human glomerulogenesis. Kidney Int42
: 390-399,1992[Medline]
This article has been cited by other articles:
 |
|
 |
|
  B. Davis, A. Dei Cas, D. A. Long, K. E. White, A. Hayward, C.-H. Ku, A. S. Woolf, R. Bilous, G. Viberti, and L. Gnudi Podocyte-Specific Expression of Angiopoietin-2 Causes Proteinuria and Apoptosis of Glomerular Endothelia J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2320 - 2329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. de Caestecker Angiopoietin-2 and Glomerular Proteinuria J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2217 - 2218. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Matsui, M. Kanai-Azuma, K. Hara, S. Matoba, R. Hiramatsu, H. Kawakami, M. Kurohmaru, P. Koopman, and Y. Kanai Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice J. Cell Sci., September 1, 2006; 119(17): 3513 - 3526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Pitera, A. S. Woolf, N. W. Gale, G. D. Yancopoulos, and H. T. Yuan Dysmorphogenesis of Kidney Cortical Peritubular Capillaries in Angiopoietin-2-Deficient Mice Am. J. Pathol., December 1, 2004; 165(6): 1895 - 1906. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Rizkalla, J. M. Forbes, M. E. Cooper, and Z. Cao Increased Renal Vascular Endothelial Growth Factor and Angiopoietins by Angiotensin II Infusion Is Mediated by Both AT1 and AT2 Receptors J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3061 - 3071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. B. Freeburg, B. Robert, P. L. St. John, and D. R. Abrahamson Podocyte Expression of Hypoxia-Inducible Factor (HIF)-1 and HIF-2 during Glomerular Development J. Am. Soc. Nephrol., April 1, 2003; 14(4): 927 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Pavenstadt, W. Kriz, and M. Kretzler Cell Biology of the Glomerular Podocyte Physiol Rev, January 1, 2003; 83(1): 253 - 307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Satchell, S. J. Harper, J. E. Tooke, D. Kerjaschki, M. A. Saleem, and P. W. Mathieson Human Podocytes Express Angiopoietin 1, a Potential Regulator of Glomerular Vascular Endothelial Growth Factor J. Am. Soc. Nephrol., February 1, 2002; 13(2): 544 - 550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Takahashi, K. Takahashi, S. Gerety, H. Wang, D. J. Anderson, and T. O. Daniel Temporally Compartmentalized Expression of Ephrin-B2 during Renal Glomerular Development J. Am. Soc. Nephrol., December 1, 2001; 12(12): 2673 - 2682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Long, A. S. Woolf, T. Suda, and H. T. Yuan Increased Renal Angiopoietin-1 Expression in Folic Acid-Induced Nephrotoxicity in Mice J. Am. Soc. Nephrol., December 1, 2001; 12(12): 2721 - 2731. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME CURRENT ISSUE |
