Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DOI, S. Q.
Right arrow Articles by STRIKER, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DOI, S. Q.
Right arrow Articles by STRIKER, L. J.
J Am Soc Nephrol 11:1419-1425, 2000
© 2000 American Society of Nephrology

Growth Hormone Increases Inducible Nitric Oxide Synthase Expression in Mesangial Cells

SONIA Q. DOI*, TERRY A. JACOT{dagger}, DONALD F. SELLITTI*, PRZEMYSLAW HIRSZEL*, MARIO H. HIRATA{ddagger}, GARY E. STRIKER§ and LILIANE J. STRIKER§

* Department of Medicine, Division of Nephrology, Uniformed Services University of the Health Sciences, Bethesda, Maryland
{dagger} Renal Cell Biology Section, Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland
{ddagger} School of Pharmaceutical Sciences, University of São Paulo, São Paulo, Brazil
§ Department of Medicine, University of Miami School of Medicine, Miami, Florida

Correspondence to Dr. Sonia Q. Doi, Department of Medicine, Uniformed Services University of the Health Sciences (USUHS), 4301 Jones Bridge Road, A-3068, Bethesda, MD 20814-4799. Phone: 301-295-3610; Fax: 305-295-3557; E-mail:sdoi{at}usuhs.mil


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abstract. Mice transgenic for bovine growth hormone (GH) develop progressive glomerulosclerosis. However, the proximal signaling events that lead to increased matrix deposition in this pathologic condition are still unclear. Components of the L-arginine metabolic pathway, especially inducible nitric oxide (NO) synthase (iNOS), ornithine aminotransferase (OAT), and ornithine decarboxylase (ODC), have been associated with glomerular scarring. In this study, mesangial cells were treated with GH, and the expression of iNOS, ODC, and OAT was determined using reverse transcription-PCR. In addition, nitrite accumulation in the conditioned media of mesangial cell cultures was measured in the presence or absence of GH. The findings revealed that GH increased iNOS transcript levels in a dose-dependent manner, with the highest levels being attained at GH concentrations of 20 to 50 ng/ml. The GH-induced increase in iNOS transcript levels was accompanied by a significant increase in nitrite concentrations in conditioned media, which was blocked by the addition of L-NG-monomethylarginine. The effect of GH (50 ng/ml) in eliciting nitrite production was as potent as that of bacterial lipopolysaccharide (10 µg/ml). The expression of OAT and ODC, in contrast, was not altered at any of the GH concentrations tested. GH receptor mRNA was also expressed by mesangial cells, independently of the GH concentration present in the cell culture medium. These data indicate that GH may interact with its receptor to regulate the L-arginine/NO pathway in mesangial cells, by directly modulating iNOS expression and NO production, without altering the arginase/OAT/ODC pathway.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Progressive extracellular matrix accumulation, resulting in sclerosis of the mesangium, is a common pathway in several glomerular disorders that lead to end-stage renal disease (1,2) Several lines of evidence have implicated growth hormone (GH) in the glomerular scarring process (3,4,5,6,7,8,9,10,11,12,13,14,15). Mice transgenic for bovine GH, in addition to having increased body mass, develop progressive glomerular lesions, which markedly resemble those that occur in human diabetic nephropathy (3,4,5). In human subjects with insulin-dependent diabetes mellitus, circulating levels of GH are elevated (6,7), and these elevated levels are associated with complications of diabetes, such as retinopathy (8) and vascular disease (9). Renal alterations, as indicated by increases in albuminuria and in the urinary excretion of glycosaminoglycans, accompanying abnormally elevated serum GH levels have been reported for patients with acromegaly (10).

Whereas elevated levels of GH are associated with glomerular disease under both clinical and experimental conditions, lack of GH seems to have a protective effect against kidney damage. After 12 wk of untreated streptozotocin-induced diabetes, dwarf mice transgenic for a GH antagonist (11), in contrast to nontransgenic diabetic mice, failed to develop signs of diabetic nephropathy (12,13,14). Similarly, although partial nephrectomy is followed by sclerosis of the remnant kidney in normal rats, glomerulosclerosis has been demonstrated to be significantly attenuated in GH-deficient rats (15). Despite the considerable clinical and experimental evidence linking GH with glomerulosclerosis, the precise mechanisms underlying this association remain unclear.

The GH receptor (GHR) belongs to the hematopoietin/cytokine receptor family, which is coupled with the Janus kinase-signal transducers and activators of transcription (JAK-STAT) internal signaling pathway (16). It was recently suggested that, in addition to the nuclear factor {kappa}B pathway, cytokines can use the JAK-STAT signaling pathway to regulate the expression of inducible nitric oxide (NO) synthase (iNOS) (17), which metabolizes L-arginine to NO. Although the GHR has not yet been definitively demonstrated in mesangial cells, its presence in these cells has been strongly suggested in several investigations (3,4,5,12,13,14,15); therefore, it seems possible that GH could directly regulate the expression of iNOS.

NO and especially iNOS have been associated with experimental glomerulonephritis (18,19,20). Levels of iNOS, which are usually very low in normal glomeruli and mesangial cells, increase dramatically with cytokine or lipopolysaccharide (LPS) treatment (21,22). Activation of iNOS generates NO in amounts approximately 1000-fold greater than those produced by constitutive NOS, for longer periods of time (reviewed in references 23 and 24). Increased NO production has been associated with cytotoxicity via formation of iron-nitrosyl complexes and inactivation of iron-containing enzymes (25) and via reaction with superoxide to generate toxic hydroxyl radicals (26).

Although GH regulation of iNOS expression has not yet been reported, ornithine aminotransferase (OAT) and ornithine decarboxylase (ODC) activities seem to be modulated by this hormone (27,28). OAT and ODC are enzymes of the alternative metabolic pathway for L-arginine and generate proline and polyamines, respectively. It has been demonstrated that L-arginine metabolism through the arginase pathway is also increased in experimental acute nephritis (19,29) and may play a role in matrix accumulation (29). The metabolites of arginine produced through activation of ODC and OAT (polyamines and proline, respectively) are associated with cell proliferation and tissue repair (30,31). In addition, proline is a precursor of collagen, which is one of the major extracellular matrix proteins present in the mesangium of sclerotic glomeruli (1). The aim of this study was to determine whether GH interacts with the L-arginine/NO metabolic pathway, to regulate expression of iNOS, ODC, and OAT in mesangial cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture
Mesangial cells derived from glomeruli microdissected from normal mice (SJL x C57BL/6) were grown to 80% confluence in fibronectin-coated dishes with a 3:1 mixture of Dulbecco's modified Eagle's medium and F-12 medium, containing 6 mM glucose, 1 mM glutamine, 0.075% NaHCO3, penicillin (100 U/ml)/streptomycin (100 µg/ml), and 20% fetal bovine serum (FBS) (Life Technologies, Rockville, MD), in a humidified incubator at 37°C with 5% CO2. The cells used have been characterized previously in detail (32).

All studies were performed with cells that had been plated evenly into either 24-well tissue culture plates or flasks (25 or 75 cm2) and exposed to medium containing 5% FBS and porcine GH (a gift of Dr. John Kopchick, Ohio University, Athens, OH). Control cells were cultured in medium without added GH. Mesangial cells were also treated with the iNOS inducer bacterial LPS (Escherichia coli serotype 0127:B8; Sigma Chemical Co., St. Louis, MO) and with the competitive iNOS inhibitor L-NG-monomethylarginine (L-NMA) (Biomol Research Laboratories, Plymouth Meeting, PA).

Nitrite Assay
Determinations of nitrite concentrations in the conditioned media were performed using two assay methods, with different sensitivities to nitrite contents. For measurement of nitrite production in a 24-h period, the more sensitive chemiluminescence assay was used (33,34). In this procedure, levels of nitrite in the conditioned media were determined with a Sievers 270B analyzer (Sievers, Boulder, CO) by comparison with a standard curve (0 to 8 µM) established with a solution of sodium nitrite (Sigma). To eliminate serum-derived nitrite from our measurements, the nitrite value determined in an equivalent volume of 5% FBS-containing medium was subtracted from each sample value. Cells corresponding to each collected sample of conditioned medium were lysed and assayed for total protein content using the Bio-Rad reagent (Bio-Rad Laboratories, Richmond, CA).

Nitrite concentrations in phenol red-free conditioned media collected over 48 h were measured using a colorimetric assay with the Griess reagent (35). A standard curve was established with sodium nitrite solutions with concentrations varying from 0 to 40 µM. The reaction was established in a 96-well microtiter plate, into which 100-µl aliquots of standards or samples were pipetted in triplicate, followed by the addition of 50 µl of 1% sulfanilamide (Sigma) in 2.5% H3PO4 and 50 µl of 0.1% N-(1-naphthyl)ethylenediamine dihydrochloride (Sigma) in 2.5% H3PO4. Absorbance at 550 nm was measured in a microtiter plate reader (Titertek Instruments, Huntsville, AL).

Reverse Transcription
In situ reverse transcription (RT) was performed as described previously (36). Briefly, after trypsinization, 25,000 cells were collected, washed in a solution containing 5.5 mM glucose, 135 mM NaCl, 1.2 mM Na2SO4, 1 mM Na2HPO4, 5 mM Hepes, 1.2 mM Mg2SO4, 2 mM CaCl2, and 5 mM KCl in RNase-free water, and centrifuged. Cells were then lysed in 9 µl of a 2% Triton X-100 solution containing 4 U/µl RNase inhibitor (Boehringer Mannheim, Indianapolis, IN) and 0.01 M dithiothreitol and were subjected to three cycles of quick freezing and thawing. The RT reaction followed the addition of RT reagents, i.e., avian myeloblastosis virus RT, RNase inhibitor, MgCl2, and random hexamer primer (Boehringer Mannheim), in a total volume of 20 µl, according to the protocol provided by the manufacturer. RT was performed in a Perkin Elmer 2400 thermocycler (Perkin Elmer, Foster City, CA) at 42°C for 60 min and then at 99°C for 5 min, and the reaction mixture was cooled to 4°C. After the reaction, 80 µl of diethylpyrocarbonate-treated water was added, bringing the total volume to 100 µl.

PCR
Two microliters (equivalent to approximately 500 cells) of the reverse-transcribed cDNA was used in each PCR, in a total reaction volume of 50 µl, with specific primers for the target molecules (iNOS, ODC, OAT, GHR, ß-actin, and glucose-3-phosphate dehydrogenase [G3PDH]). Amplification of ß-actin and G3PDH was used to indicate the initial amount of RNA in each sample. Reaction products were analyzed by electrophoresis on ethidium bromide-stained, 4% agarose gels and were observed with ultraviolet transillumination. Negative images of the gels were analyzed by densitometry using NIH Image software (version 1.6; National Institutes of Health, Bethesda, MD).

Primers used for PCR amplification were as follows: 5' to 3': mouse macrophage iNOS (GenBank accession no. M87039), TGCATGGACCAGTATAAGGCAAGC (sense, positions 1948 to 1971) and GCTTCTGGTCGATGTCATGAGCAA (antisense, positions 2147 to 2170); murine ODC (GenBank accession no. M10624), ACGGATTGCCACTGATGATTCC (sense, positions 1196 to 1217) and TAATACTTCTCGTCTGGCTTGG (antisense, positions 1768 to 1789); murine OAT (GenBank accession no. X64837), TGAATACAGGAGTGGAGGCTGG (sense, positions 530 to 551) and TGGTCAGCATTATCTCATCG (antisense, positions 1035 to 1054); mouse GHR (GenBank accession no. M33324), CGCCCTGATTATGTCTCTGCTGGAAAA (sense, positions 423 to 449) and TAAGAACCATGGAAACTGGAT (antisense, positions 912 to 932); mouse cytoplasmic ß-actin (GenBank accession no. M12481), GCATTGTGATGGACTCCG (sense, positions 371 to 388) and ATCCTGTCAGCAATGCCTGG (antisense, positions 841 to 860); G3PDH (Clontech Laboratories, Palo Alto, CA), ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense). The PCR cycling parameters for iNOS were as follows: initial denaturation at 94°C for 5 min (one cycle), annealing at 94°C for 30 s, 65°C for 30 s, and 72°C for 30 s (38 cycles), and final extension at 72°C for 7 min (one cycle). For amplification of the other molecules, these parameters were kept constant except for the annealing temperature and the cycle number, which were optimized for each pair of primers. The specific annealing temperatures and cycle numbers were as follows: for ODC, 60°C, 38 cycles; for OAT, 60°C, 30 cycles; for GHR, 60°C, 38 cycles; for ß-actin, 60°C, 28 cycles; for G3PDH, 60°C, 25 cycles.

DNA Sequencing
The iNOS and GHR fragments amplified from mesangial cells by PCR were purified from the agarose gel using a GlasPac/GS QuicKit (National Scientific Supply Co., San Rafael, CA). The resultant DNA was subjected to a cycle sequencing reaction using the ABI Prism dye-labeled terminator reagent (Perkin Elmer), according to the protocol provided by the manufacturer. The reaction product was analyzed with an ABI 377 automated sequencer (Perkin Elmer).

Total RNA and Protein Extraction
To confirm increased iNOS protein levels in mesangial cells that exhibited elevated iNOS mRNA levels, RNA and protein were extracted from the same cultures, for use in PCR and Western blotting assays, respectively. These cells were plated into 75-cm2 culture flasks and exposed for 11 d to medium with or without GH (50 ng/ml). Conditioned medium was collected from the final 48 h of the experimental period for further nitrite determination, and the cells were scraped into 2 ml of Trizol reagent (Life Technologies). The cell homogenate was subjected to total RNA extraction, followed by protein isolation, according to the protocol provided by the manufacturer. RNA concentrations in the samples were determined by measuring absorbance at 260 nm, and 1 µg of total RNA was used for RT with a first-strand synthesis kit (Boehringer Mannheim). Protein concentrations were determined using the Bio-Rad reagent (Bio-Rad). A standard curve for protein concentrations was established using bovine {gamma}-globulin in 0.1N NaOH.

Western Blotting
A total of 100 µg of protein extracted from each sample (control and GH-treated cells) was fractionated by electrophoresis on a precast 4 to 20% gradient polyacrylamide/Tris-glycine gel (Novex, San Diego, CA), under reducing conditions. Protein extracted from mouse macrophages stimulated with interferon-{gamma} and LPS (Transduction Laboratories, San Diego, CA) was subjected to electrophoresis simultaneously with the mesangial cell samples and served as a positive control. Molecular weights were determined by comparison with a standard purchased from Novex. The proteins were then transferred to a polyvinylidene difluoride membrane (Novex) by electrophoresis in a Tris-glycine/methanol transfer buffer (Novex) at 25 V for 8 h. The membrane was placed in blocking buffer (5% nonfat dry milk, 10 mM Tris, pH 7.5, 100 mM NaCl, 0.1% Tween 20) overnight at 4°C. The blot was then incubated overnight at 4°C with a polyclonal antibody against iNOS (Transduction Laboratories), and diluted 1:5000 in blocking solution. After a 30-min wash in a buffer containing 10 mM Tris, pH 7.5, 100 mM NaCl, and 0.1% Tween 20, the blot was incubated for 1 h at room temperature with a goat anti-rabbit IgG, peroxidase-conjugated antibody (Pierce, Rockford, IL), diluted 1:10,000 in blocking solution. After a final 30-min wash, the membrane was incubated for 5 min at room temperature with SuperSignal West Pico chemiluminescence substrate (Pierce) and was exposed to Hyperfilm ECL (Amersham Life Science, Arlington Heights, IL).

Statistical Analyses
Nitrite contents were compared between treatment groups using InStat software (GraphPad Software, Inc., San Diego, CA) to perform t tests and ANOVA, followed by multiple comparison tests (alternate Welch t test) to determine significant differences.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of GHR in mesangial cells was demonstrated by a PCR product of the expected size (511 bp), which was sequenced and found to be identical to the published cDNA sequence of mouse GHR (37). There was no significant difference in GHR mRNA expression in mesangial cells exposed to medium with or without GH (Figure 1A).



View larger version (36K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. (A) Expression of growth hormone (GH) receptor (GHR), inducible nitric oxide synthase (iNOS), and ß-actin, determined by reverse transcription (RT)-PCR, in mesangial cells treated with or without GH for 24 h, as observed after electrophoresis through ethidium bromide-stained agarose gels. Results shown are representative of at least three experiments for each transcript. (B) Nitrite concentrations, determined with a chemiluminescence assay, in conditioned medium from mesangial cells exposed to GH (50 ng/ml) for 24 h, compared with control cells (no GH). Results shown are mean ± SD. *P < 0.02 versus control.

 

RT-PCR amplification of iNOS from mesangial cells produced a cDNA of the expected size (223 bp), which was barely visible in control cells but was markedly increased (to values approximately 10 times greater than control values in this experiment) in GH-treated cells (Figure 1A). Sequencing of iNOS cDNA amplified from a sample of the GH-treated cells indicated 100% homology with the published sequence of murine macrophage iNOS mRNA (38). The nitrite contents in conditioned media from control and GH-treated cells are illustrated in Figure 1B. Consonant with the increased expression of iNOS transcripts, the nitrite contents in conditioned media from GH-treated cells were significantly elevated (P < 0.02), i.e., elevated ninefold compared with control cells (6.22 ± 0.45 versus 0.71 ± 0.99 nmol/mg cell protein, mean ± SD).

In contrast to iNOS, expression of ODC and OAT did not change after exposure to 50 ng/ml GH. The results of three experiments comparing the relative levels of iNOS, ODC, and OAT expression in control and GH-treated cells are illustrated in Figure 2. Ratio between densitometric readings of GH-treated and control cells for iNOS, ODC, and OAT were 10.3 ± 2.0, 1.1 ± 0.3, and 0.8 ± 0.2, respectively (mean ± SD).



View larger version (14K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Relative expression of iNOS, ornithine decarboxylase (ODC), and ornithine aminotransferase (OAT). Values represent the ratio of densitometric measurements of each transcript in GH-treated cells (GH-50) and control cells (GH-0). Values are mean ± SD from three experiments.

 

Figure 3 shows the effect of increasing GH concentrations on the expression of enzymes of the L-arginine/NO metabolic pathway in mesangial cells. The data indicate a dose dependency in the iNOS response to GH, with maximal iNOS stimulation occurring at GH concentrations between 20 and 50 ng/ml. In contrast, OAT and ODC expression could be detected in the absence of GH and remained unchanged with addition of the hormone.



View larger version (63K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Expression of iNOS, OAT, and ODC, relative to ß-actin, as measured by RT-PCR, in mesangial cells treated with increasing concentrations of GH (0, 5, 10, 20, and 50 ng/ml) for 24 h. PCR products of iNOS, OAT, and ODC amplification were resolved by ethidium bromide-stained agarose gel electrophoresis. Results are representative of three experiments.

 

Figure 4 indicates that GH (50 ng/ml) was as effective as LPS (10 µg/ml) in increasing nitrite production in cultured mesangial cells. Nitrite concentrations were 0.58 ± 0.02 nmol/ml in control cells, 2.87 ± 0.17 nmol/ml in GH-treated cells, and 2.44 ± 0.08 nmol/ml in LPS-treated cells (mean ± SEM of triplicate experiments).



View larger version (66K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Concentrations of nitrite in the media of cells exposed to either GH (50 ng/ml) or lipopolysaccharide (LPS) (10 µg/ml) for 48 h, compared with control cells (C) (medium without GH or LPS), as determined using a colorimetric method (Griess reagent). Values are mean ± SEM of three experiments. *P < 0.01 versus control.

 

To test whether the GH-induced increase in nitrite levels in mesangial cells was directly related to an increase in NOS activity, nitrite was measured in the presence or absence of L-NMA (300 µM). Figure 5 demonstrates that nitrite production was effectively inhibited by L-NMA. Nitrite concentrations increased from 0.16 ± 0.04 nmol/ml in control cells to 3.46 ± 0.25 nmol/ml in GH-treated cells. However, in the presence of L-NMA, the effect of GH on nitrite production was significantly suppressed to 1.49 ± 0.003 nmol/ml (P < 0.005 versus GH alone). The nitrite level in the conditioned medium from cells exposed to L-NMA alone was not significantly different from control levels (0.08 ± 0.05 nmol/ml). Values represent mean ± SEM of three experiments.



View larger version (44K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Inhibition of GH-induced nitrite production in GH-treated (50 ng/ml) mesangial cell cultures to which L-NG-monomethylarginine (L-NMA) (300 µM) was added for 48 h, compared with cultures with GH or L-NMA alone, as determined using a colorimetric method (Griess reagent). Control cells were maintained in medium without GH or L-NMA for 48 h. Values are mean ± SEM of three experiments. *P < 0.005 versus GH

 

Figure 6A demonstrates that the increase in iNOS mRNA expression was sustained after continuous stimulation of mesangial cells with GH for 11 d. Furthermore, using a Western blotting technique, we demonstrated that immunoreactive iNOS protein, with a predicted molecular mass of 130 kD, was detected only in GH-treated cells (Figure 6B). As in the shortterm studies described above, we demonstrated that changes in iNOS transcript and protein levels were reflected in significantly higher (P < 0.0001) nitrite contents in GH-treated cells, compared with control cells (6.41 ± 0.10 versus 1.65 ± 0.07 nmol/ml, respectively).



View larger version (53K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. (A) mRNA expression of iNOS in mesangial cells exposed to GH (50 ng/ml) for 11 d, compared with control cells (C), relative to the expression of glucose-3-phosphate dehydrogenase (G3PDH). (B) Immunoreactive iNOS protein (130 kD) detected in GH-treated cells (GH) and in the positive control, macrophage protein ({Phi}), but not in control mesangial cells (C), as demonstrated by Western blotting with a polyclonal anti-iNOS antibody (as described in Materials and Methods).

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study is the first, to our knowledge, to demonstrate an effect of GH on iNOS expression. Specifically, these findings indicate a 10-fold increase in iNOS expression in mesangial cells treated with GH, compared with control cells, as detected by semiquantitative PCR. A parallel increase in nitrite production in GH-treated cells, which was suppressed by the NOS inhibitor L-NMA, further suggested that the GH-induced iNOS mRNA is translated into functional iNOS enzyme. As indicated in the work of Xie et al. (38), iNOS expression is transcriptionally regulated, and an increase in iNOS mRNA levels reflects a parallel increase in iNOS protein levels. This supports our results showing that increased iNOS mRNA expression was accompanied by the detection of immunoreactive iNOS protein and elevated nitrite levels in GH-treated cells.

In contrast, our data demonstrated that the expression of ODC and OAT (enzymes of the alternative L-arginine/arginase metabolic pathway) was not altered by the presence of GH. It was suggested by others that both ODC and OAT activities are regulated by GH (27,28). We surmise that the differences between our findings and those reported previously may be ascribed to the possibility that GH affects ODC and OAT at a posttranscriptional level. Earlier studies identified a role for the L-arginine/arginase pathway, through OAT and ODC activities, in glomerular diseases (29,30). However, although inhibition of ODC prevented kidney hypertrophy in the first weeks of experimental diabetes (39), it did not change the course of the diabetic nephropathy (40), suggesting that this pathway may not play a primary role in chronic glomerular diseases.

On the other hand, the association of increased glomerular levels of NO and iNOS with glomerular extracellular matrix accumulation has been documented by several investigators (18,41,42). Narita et al. (18) demonstrated marked decreases in extracellular matrix accumulation after L-NMA treatment of rats with anti-thymocyte serum-induced nephritis. Using a nephrotoxic nephritis model, Bremer et al. (41) reported significant attenuation of glomerular damage in rats treated with aminoguanidine, which is a NOS inhibitor that is relatively selective for iNOS. In addition to these experimental findings, clinical studies demonstrated a positive correlation between the renal expression of iNOS and the degree of glomerular injury in biopsy specimens from patients with IgA nephropathy or lupus nephritis (42). Although iNOS-derived NO in nephritic models was largely attributed to glomerulus-infiltrating macrophages (18,19,41), more recently Furusu et al. (42) were able to detect immunoreactive iNOS in mesangial cells from renal biopsies of patients with glomerulonephritis. These studies suggest that the association of iNOS with glomerular injury may not be strictly dependent on the cell type (i.e., macrophage versus mesangial cell) expressing the enzyme.

Expression of iNOS is generally low in the glomerulus and mesangial cells under normal conditions. However, it can be upregulated in vitro by LPS and cytokines, including tumor necrosis factor-{alpha} and interleukin-1ß (21,22). Moreover, both interleukin-1ß and tumor necrosis factor-{alpha} have been shown to be activated in macrophages and mesangial cells from renal tissue of animals with experimental nephritis (43,44). Although in this study we have not explored the specific intracellular signaling pathway involved in the GH induction of iNOS, our present findings that mesangial cells bear GHR and that GH is at least as effective as LPS in inducing iNOS suggest that GH may act in a cytokine-like manner to stimulate iNOS. This finding is consistent with a previous report that, in addition to the nuclear factor {kappa}B pathway, cytokines can use the JAK-STAT intracellular signaling system to regulate iNOS expression (17).

Coupled with a substantial body of evidence linking elevated levels of GH with glomerular diseases (3,4,5,6,7,8,9,10,11,12,13,14,15), and with reports linking iNOS with experimental and clinical glomerulopathies (18,19,20,41,42), the results presented here suggest that the GH/iNOS/NO pathway may play a role in glomerular scarring. This is supported by our recent finding that the expression of iNOS was significantly elevated in the renal cortex of bovine GH-transgenic mice (which expressed a severe degree of glomerulosclerosis) compared with nontransgenic control mice (45). Definitive identification of iNOS involvement in glomerulosclerosis awaits further studies to define the role of iNOS-derived NO in vivo.


    Acknowledgments
 
The authors thank Dr. Saiid Bina (Department of Anesthesiology, Uniformed Services University of the Health Sciences) for assistance with the chemiluminescence nitrite assay, Chancellor Donald, Hileia Seeger, Shashi Shrivastav, and Ginny H. Kim for technical support, and Mary Chase for secretarial assistance.

S.Q. Doi received support from CNPq (National Council for Technological and Scientific Development), Brazil (#147468/1999-0).


    Footnotes
 
The authors were employees of the United States federal government when this work was conducted and prepared for publication; therefore, it is not protected by the Copyright Act, and there is no copyright of which the ownership can be transferred.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Striker LMM, Killen PD, Chi E, Striker GE: The composition of glomerulosclerosis. I. Studies in focal sclerosis, crescentic glomerulonephritis, and membranoproliferative glomerulonephritis. Lab Invest 51:181 -192, 1984[Medline]
  2. Striker LJ, Doi T, Elliot S, Striker GE: The contribution of glomerular mesangial cells to progressive glomerulosclerosis. Semin Nephrol 9:318 -328, 1989[Medline]
  3. Doi T, Striker LJ, Quaife C, Conti FG, Palmiter R, Behringer R, Brinster R, Striker GE: Progressive glomerulosclerosis develops in transgenic mice chronically expressing growth hormone and growth hormone releasing factor but not in those expressing insulin-like growth factor-1. Am J Pathol 131:398 -403, 1988[Abstract]
  4. Doi T, Striker LJ, Kimata K, Peten EP, Yamada Y, Striker GE: Glomerulosclerosis in mice transgenic for growth hormone: Increased mesangial extracellular matrix is correlated with kidney mRNA levels. J Exp Med 173:1287 -1290, 1991[Abstract/Free Full Text]
  5. Yang C-W, Striker LJ, Kopchick JJ, Chen WY, Pesce CM, Peten EP, Striker GE: Glomerulosclerosis in mice transgenic for native or mutated bovine growth hormone gene. Kidney Int43 : S90-S94,1993
  6. Hayford JT, Danney MM, Hendrix JA, Thompson RG: Integrated concentration of growth hormone in juvenile-onset diabetes. Diabetes 29:391 -398, 1980[Abstract]
  7. Horner JM, Kemp SF, Hintz RL: Growth hormone and somatomedin in insulin-dependent diabetes mellitus. J Clin Endocrinol Metab 53:1148 -1153, 1981[Abstract]
  8. Alzaid AA, Melton LJ III, Dinneen SF, Rizza RA: The role of growth hormone in the development of diabetic retinopathy. Diabetes Care 17: 531-534,1994[Abstract]
  9. Merimee TJ: A follow-up study of vascular disease in growth-hormone-deficient dwarfs with diabetes. N Engl J Med 298:1217 -1222, 1978[Abstract]
  10. Sindelka G, Skrha J, Hilgertová J, Justová V: Early diagnosis of impaired glomerular and renal tubule function in patients with acromegaly. Cas Lek Cesk 135:657 -659, 1996[Medline]
  11. Chen WY, Wight DC, Wagner TE, Kopchick JJ: Expression of a mutated bovine growth hormone gene suppresses growth of transgenic mice. Proc Natl Acad Sci USA 87:5061 -5065, 1990[Abstract/Free Full Text]
  12. Chen N-Y, Chen WY, Bellush L, Yang C-W, Striker LJ, Striker GE, Kopchick JJ: Effects of streptozotocin treatment in growth hormone (GH) and GH antagonist transgenic mice. Endocrinology136 : 660-667,1995[Abstract]
  13. Liu Z-H, Striker LJ, Phillips C, Chen N-Y, Chen WY, Kopchick JJ, Striker GE: Growth hormone expression is required for the development of diabetic glomerulosclerosis in mice. Kidney Int48 : S37-S38,1995
  14. Esposito C, Liu Z-H, Striker GE, Phillips C, Chen N-Y, Chen WY, Kopchick JJ, Striker LJ: Inhibition of diabetic nephropathy by a GH antagonist: A molecular analysis. Kidney Int50 : 506-514,1996[Medline]
  15. El Nahas AM, Bassett AH, Cope GH, Le Carpentier JE: Role of growth hormone in the development of experimental renal scarring. Kidney Int 40: 29-34,1991[Medline]
  16. Hackett RH, Wang Y-D, Larner AC: Mapping of the cytoplasmic domain of the human growth hormone receptor required for the activation of JAK2 and STAT proteins. J Biol Chem 270:21326 -21330, 1995[Abstract/Free Full Text]
  17. Nakashima O, Terada Y, Yamada T, Inoshita S, Sasaki S, Marumo F: iNOS can be induced in the absence of active NF-{kappa}B in rat mesangial cells: Involvement of JAK-STAT signaling [Abstract]. J Am Soc Nephrol 8: 335A,1997
  18. Narita I, Border WA, Ketteler M, Noble NA: Nitric oxide mediates immunologic injury to kidney mesangium in experimental glomerulonephritis. Lab Invest 72:17 -24, 1995[Medline]
  19. Cook HT, Jansen A, Lewis S, Largen P, O'Donnell M, Reaveley D, Cattell V: Arginine metabolism in experimental glomerulonephritis: Interaction between nitric oxide synthase and arginase. Am J Physiol 267:F646 -F653, 1994[Abstract/Free Full Text]
  20. Cook HT, Ebrahim H, Jansen AS, Foster GR, Largen P, Cattell V: Expression of the gene for inducible nitric oxide synthase in experimental glomerulonephritis in the rat. Clin Exp Immunol97 : 315-320,1994[Medline]
  21. Mohaupt MG, Elzie JL, Ahn KY, Clapp WL, Wilcox CS, Kone BC: Differential expression and induction of mRNAs encoding two inducible nitric oxide synthases in rat kidney. Kidney Int46 : 653-665,1994[Medline]
  22. Shultz PJ, Archer SL, Rosenberg ME: Inducible nitric oxide synthase mRNA and activity in glomerular mesangial cells. Kidney Int 46: 683-689,1994[Medline]
  23. Ketteler M, Border WA, Noble NA: Cytokines and L-arginine in renal injury and repair. Am J Physiol267 : F197-F207,1994[Abstract/Free Full Text]
  24. Klahr S, Morrissey J: Renal disease: The two faces of nitric oxide. Lab Invest 72:1 -3, 1995[Medline]
  25. Lancaster JR Jr, Hibbs JB Jr: EPR demonstration of iron-nitrosyl complex formation by cytotoxic activated macrophages. Proc Natl Acad Sci USA 87:1223 -1227, 1990[Abstract/Free Full Text]
  26. Beckman JS, Beckman TW, Chen J, Marshall PA, Freeman BA: Apparent hydroxyl radical production by peroxynitrite: Implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci USA 87:1620 -1624, 1990[Abstract/Free Full Text]
  27. Nicholson WE, Levine JH, Orth DN: Hormonal regulation of renal ornithine decarboxylase activity in the rat. Endocrinology 98:123 -128, 1976[Abstract]
  28. Burcham JM, Giometti CS, Tollaksen SL, Peraino C: Comparison of rat and mouse ornithine aminotransferase with respect to molecular properties and regulation of synthesis. Arch Biochem Biophys262 : 501-507,1988[Medline]
  29. Jansen A, Lewis S, Cattell V, Cook HT: Arginase is a major pathway of L-arginine metabolism in nephritic glomeruli. Kidney Int 42:1107 -1112, 1992[Medline]
  30. Schulze-Lohoff E, Brand K, Fees H, Netzker R, Sterzel RB: Role of ornithine decarboxylase for proliferation of mesangial cells in culture. Kidney Int 40:684 -690, 1991[Medline]
  31. Smith RJ, Phang JM: Proline metabolism in cartilage: The importance of proline biosynthesis. Metabolism27 : 685-694,1978[Medline]
  32. MacKay K, Striker LJ, Elliot S, Pinkert CA, Brinster RL, Striker GE: Glomerular epithelial, mesangial, and endothelial cell lines from transgenic mice. Kidney Int 33:677 -684, 1988[Medline]
  33. Cox RD: Determination of nitrate and nitrite at the parts per billion level by chemiluminescence. Anal Chem5 : 332-335,1980
  34. Sen NP, Baddoo PA, Seaman SW: Rapid and sensitive determination of nitrite in foods and biological materials by flow injection or high-performance liquid chromatography with chemiluminescence detection. J Chromatogr A 673:77 -84, 1994[Medline]
  35. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR: Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem126 : 131-138,1982[Medline]
  36. Jacot TA, Striker GE, Stetler-Stevenson M, Striker LJ: Mesangial cells from transgenic mice with progressive glomerulosclerosis exhibit stable, phenotypic changes including undetectable MMP-9 and increased type IV collagen. Lab Invest 75:791 -799, 1996[Medline]
  37. Smith WC, Kuniyoshi J, Talamantes F: Mouse serum growth hormone (GH) binding protein has GH receptor extracellular and substituted transmembrane domains. Mol Endocrinol3 : 984-990,1989[Abstract]
  38. Xie Q-W, Cho HJ, Calaycay J, Mumford RA, Swiderek KM, Lee TD, Ding A, Troso T, Nathan C: Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science256 : 225-228,1992[Abstract/Free Full Text]
  39. Pedersen SB, Flyvbjerg A, Richelsen B: Inhibition of renal ornithine decarboxylase activity prevents kidney hypertrophy in experimental diabetes. Am J Physiol 264:C453 -C456, 1993[Abstract/Free Full Text]
  40. Pedersen SB, Bjørn SF, Richelsen B, Flyvbjerg A: Inhibition of renal ornithine decarboxylase activity fails to reduce kidney size and urinary albumin excretion in diabetic rats with manifest kidney hypertrophy. Mol Cell Endocrinol 107:123 -128, 1995[Medline]
  41. Bremer V, Tojo A, Kimura K, Hirata Y, Goto A, Nagamatsu T, Suzuki Y, Omata M: Role of nitric oxide in rat nephrotoxic nephritis: Comparison between inducible and constitutive nitric oxide synthase. J Am Soc Nephrol 8:1712 -1721, 1997[Abstract]
  42. Furusu A, Miyazaki M, Abe K, Tsukasaki S, Shioshita K, Sasaki O, Miyazaki K, Ozono Y, Koji T, Harada T, Sakai H, Kohno S: Expression of endothelial and inducible nitric oxide synthase in human glomerulonephritis. Kidney Int 53:1760 -1768, 1998[Medline]
  43. Tam FW, Smith J, Cashman SJ, Wang Y, Thompson EM, Rees AJ: Glomerular expression of interleukin-1 receptor antagonist and interleukin-1ß genes in antibody-mediated glomerulonephritis. Am J Pathol 141:126 -136, 1994
  44. Mulligan MS, Johnson KJ, Todd RF III, Issekutz TB, Miyasaka M, Tamatani T, Smith CW, Anderson DC, Ward PA: Requirements for leukocyte adhesion molecules in nephrotoxic nephritis. J Clin Invest 91:577 -587, 1993
  45. Doi SQ, Rasaiah S, Gazoni L, Kopchick JJ, Striker LJ, Hirszel P: L-Arginine pathway in a transgenic mouse model of progressive glomerulosclerosis [Abstract]. J Am Soc Nephrol9 : 607A,1998
Received for publication April 1, 1998. Accepted for publication December 22, 1999.




This article has been cited by other articles:


Home page
EndocrinologyHome page
P. Kamenicky, S. Viengchareun, A. Blanchard, G. Meduri, P. Zizzari, M. Imbert-Teboul, A. Doucet, P. Chanson, and M. Lombes
Epithelial Sodium Channel Is a Key Mediator of Growth Hormone-Induced Sodium Retention in Acromegaly
Endocrinology, July 1, 2008; 149(7): 3294 - 3305.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
C. Grasemann, F. Ratjen, D. Schnabel, E. Reutershahn, U. Vester, and H. Grasemann
Effect of growth hormone therapy on nitric oxide formation in cystic fibrosis patients
Eur. Respir. J., April 1, 2008; 31(4): 815 - 821.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. R. Reddy, M. J. Pushpanathan, R. F. Ransom, L. B. Holzman, F. C. Brosius III, M. Diakonova, P. Mathieson, M. A. Saleem, E. O. List, J. J. Kopchick, et al.
Identification of the Glomerular Podocyte as a Target for Growth Hormone Action
Endocrinology, May 1, 2007; 148(5): 2045 - 2055.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. M. Mason and N. A. Wahab
Extracellular Matrix Metabolism in Diabetic Nephropathy
J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1358 - 1373.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
Z. Liu, Y. Yu, Y. Jiang, and J. Li
Growth Hormone Increases Lung NF-{kappa}B Activation and Lung Microvascular Injury Induced by Lipopolysaccharide in Rats
Ann. Clin. Lab. Sci., April 1, 2002; 32(2): 164 - 170.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
R. Liu, A. M. Gutierrez, A. Ring, and A. E. G. Persson
Nitric Oxide Induces Resensitization of P2Y Nucleotide Receptors in Cultured Rat Mesangial Cells
J. Am. Soc. Nephrol., February 1, 2002; 13(2): 313 - 321.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. Pagel, T. Langenickel, K. Hohnel, S. Philipp, A. K. Nussler, W. F. Blum, M. L. Aubert, R. Dietz, and R. Willenbrock
Cardiac and Renal Effects of Growth Hormone in Volume Overload-Induced Heart Failure: Role of NO
Hypertension, January 1, 2002; 39(1): 57 - 62.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DOI, S. Q.
Right arrow Articles by STRIKER, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DOI, S. Q.
Right arrow Articles by STRIKER, L. J.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP