 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Department of Medicine, Division of Nephrology, Uniformed Services
University of the Health Sciences, Bethesda, Maryland
Renal Cell Biology Section, Metabolic Diseases Branch, National Institute
of Diabetes and Digestive and Kidney Diseases, National Institutes of Health,
Bethesda, Maryland
School of Pharmaceutical Sciences, University of
São Paulo, São
Paulo, Brazil
§
Department of Medicine, University of Miami School of Medicine, Miami,
Florida
Correspondence to Dr. Sonia Q. Doi, Department of Medicine, Uniformed Services University of the Health Sciences (USUHS), 4301 Jones Bridge Road, A-3068, Bethesda, MD 20814-4799. Phone: 301-295-3610; Fax: 305-295-3557; E-mail:sdoi{at}usuhs.mil
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Whereas elevated levels of GH are associated with glomerular disease under both clinical and experimental conditions, lack of GH seems to have a protective effect against kidney damage. After 12 wk of untreated streptozotocin-induced diabetes, dwarf mice transgenic for a GH antagonist (11), in contrast to nontransgenic diabetic mice, failed to develop signs of diabetic nephropathy (12,13,14). Similarly, although partial nephrectomy is followed by sclerosis of the remnant kidney in normal rats, glomerulosclerosis has been demonstrated to be significantly attenuated in GH-deficient rats (15). Despite the considerable clinical and experimental evidence linking GH with glomerulosclerosis, the precise mechanisms underlying this association remain unclear.
The GH receptor (GHR) belongs to the hematopoietin/cytokine receptor
family, which is coupled with the Janus kinase-signal transducers and
activators of transcription (JAK-STAT) internal signaling pathway
(16). It was recently
suggested that, in addition to the nuclear factor 
B pathway, cytokines
can use the JAK-STAT signaling pathway to regulate the expression of inducible
nitric oxide (NO) synthase (iNOS)
(17), which metabolizes
L-arginine to NO. Although the GHR has not yet been definitively demonstrated
in mesangial cells, its presence in these cells has been strongly suggested in
several investigations
(3,4,5,12,13,14,15);
therefore, it seems possible that GH could directly regulate the expression of
iNOS.
NO and especially iNOS have been associated with experimental glomerulonephritis (18,19,20). Levels of iNOS, which are usually very low in normal glomeruli and mesangial cells, increase dramatically with cytokine or lipopolysaccharide (LPS) treatment (21,22). Activation of iNOS generates NO in amounts approximately 1000-fold greater than those produced by constitutive NOS, for longer periods of time (reviewed in references 23 and 24). Increased NO production has been associated with cytotoxicity via formation of iron-nitrosyl complexes and inactivation of iron-containing enzymes (25) and via reaction with superoxide to generate toxic hydroxyl radicals (26).
Although GH regulation of iNOS expression has not yet been reported, ornithine aminotransferase (OAT) and ornithine decarboxylase (ODC) activities seem to be modulated by this hormone (27,28). OAT and ODC are enzymes of the alternative metabolic pathway for L-arginine and generate proline and polyamines, respectively. It has been demonstrated that L-arginine metabolism through the arginase pathway is also increased in experimental acute nephritis (19,29) and may play a role in matrix accumulation (29). The metabolites of arginine produced through activation of ODC and OAT (polyamines and proline, respectively) are associated with cell proliferation and tissue repair (30,31). In addition, proline is a precursor of collagen, which is one of the major extracellular matrix proteins present in the mesangium of sclerotic glomeruli (1). The aim of this study was to determine whether GH interacts with the L-arginine/NO metabolic pathway, to regulate expression of iNOS, ODC, and OAT in mesangial cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All studies were performed with cells that had been plated evenly into either 24-well tissue culture plates or flasks (25 or 75 cm2) and exposed to medium containing 5% FBS and porcine GH (a gift of Dr. John Kopchick, Ohio University, Athens, OH). Control cells were cultured in medium without added GH. Mesangial cells were also treated with the iNOS inducer bacterial LPS (Escherichia coli serotype 0127:B8; Sigma Chemical Co., St. Louis, MO) and with the competitive iNOS inhibitor L-NG-monomethylarginine (L-NMA) (Biomol Research Laboratories, Plymouth Meeting, PA).
Nitrite Assay
Determinations of nitrite concentrations in the conditioned media were
performed using two assay methods, with different sensitivities to nitrite
contents. For measurement of nitrite production in a 24-h period, the more
sensitive chemiluminescence assay was used
(33,34).
In this procedure, levels of nitrite in the conditioned media were determined
with a Sievers 270B analyzer (Sievers, Boulder, CO) by comparison with a
standard curve (0 to 8 µM) established with a solution of sodium nitrite
(Sigma). To eliminate serum-derived nitrite from our measurements, the nitrite
value determined in an equivalent volume of 5% FBS-containing medium was
subtracted from each sample value. Cells corresponding to each collected
sample of conditioned medium were lysed and assayed for total protein content
using the Bio-Rad reagent (Bio-Rad Laboratories, Richmond, CA).
Nitrite concentrations in phenol red-free conditioned media collected over 48 h were measured using a colorimetric assay with the Griess reagent (35). A standard curve was established with sodium nitrite solutions with concentrations varying from 0 to 40 µM. The reaction was established in a 96-well microtiter plate, into which 100-µl aliquots of standards or samples were pipetted in triplicate, followed by the addition of 50 µl of 1% sulfanilamide (Sigma) in 2.5% H3PO4 and 50 µl of 0.1% N-(1-naphthyl)ethylenediamine dihydrochloride (Sigma) in 2.5% H3PO4. Absorbance at 550 nm was measured in a microtiter plate reader (Titertek Instruments, Huntsville, AL).
Reverse Transcription
In situ reverse transcription (RT) was performed as described
previously (36). Briefly,
after trypsinization, 25,000 cells were collected, washed in a solution
containing 5.5 mM glucose, 135 mM NaCl, 1.2 mM Na2SO4, 1
mM Na2HPO4, 5 mM Hepes, 1.2 mM
Mg2SO4, 2 mM CaCl2, and 5 mM KCl in
RNase-free water, and centrifuged. Cells were then lysed in 9 µl of a 2%
Triton X-100 solution containing 4 U/µl RNase inhibitor (Boehringer
Mannheim, Indianapolis, IN) and 0.01 M dithiothreitol and were subjected to
three cycles of quick freezing and thawing. The RT reaction followed the
addition of RT reagents, i.e., avian myeloblastosis virus RT, RNase
inhibitor, MgCl2, and random hexamer primer (Boehringer Mannheim),
in a total volume of 20 µl, according to the protocol provided by the
manufacturer. RT was performed in a Perkin Elmer 2400 thermocycler (Perkin
Elmer, Foster City, CA) at 42°C for 60 min and then at 99°C for 5 min,
and the reaction mixture was cooled to 4°C. After the reaction, 80 µl
of diethylpyrocarbonate-treated water was added, bringing the total volume to
100 µl.
PCR
Two microliters (equivalent to approximately 500 cells) of the
reverse-transcribed cDNA was used in each PCR, in a total reaction volume of
50 µl, with specific primers for the target molecules (iNOS, ODC, OAT, GHR,
ß-actin, and glucose-3-phosphate dehydrogenase [G3PDH]). Amplification of
ß-actin and G3PDH was used to indicate the initial amount of RNA in each
sample. Reaction products were analyzed by electrophoresis on ethidium
bromide-stained, 4% agarose gels and were observed with ultraviolet
transillumination. Negative images of the gels were analyzed by densitometry
using NIH Image software (version 1.6; National Institutes of Health,
Bethesda, MD).
Primers used for PCR amplification were as follows: 5' to 3': mouse macrophage iNOS (GenBank accession no. M87039), TGCATGGACCAGTATAAGGCAAGC (sense, positions 1948 to 1971) and GCTTCTGGTCGATGTCATGAGCAA (antisense, positions 2147 to 2170); murine ODC (GenBank accession no. M10624), ACGGATTGCCACTGATGATTCC (sense, positions 1196 to 1217) and TAATACTTCTCGTCTGGCTTGG (antisense, positions 1768 to 1789); murine OAT (GenBank accession no. X64837), TGAATACAGGAGTGGAGGCTGG (sense, positions 530 to 551) and TGGTCAGCATTATCTCATCG (antisense, positions 1035 to 1054); mouse GHR (GenBank accession no. M33324), CGCCCTGATTATGTCTCTGCTGGAAAA (sense, positions 423 to 449) and TAAGAACCATGGAAACTGGAT (antisense, positions 912 to 932); mouse cytoplasmic ß-actin (GenBank accession no. M12481), GCATTGTGATGGACTCCG (sense, positions 371 to 388) and ATCCTGTCAGCAATGCCTGG (antisense, positions 841 to 860); G3PDH (Clontech Laboratories, Palo Alto, CA), ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense). The PCR cycling parameters for iNOS were as follows: initial denaturation at 94°C for 5 min (one cycle), annealing at 94°C for 30 s, 65°C for 30 s, and 72°C for 30 s (38 cycles), and final extension at 72°C for 7 min (one cycle). For amplification of the other molecules, these parameters were kept constant except for the annealing temperature and the cycle number, which were optimized for each pair of primers. The specific annealing temperatures and cycle numbers were as follows: for ODC, 60°C, 38 cycles; for OAT, 60°C, 30 cycles; for GHR, 60°C, 38 cycles; for ß-actin, 60°C, 28 cycles; for G3PDH, 60°C, 25 cycles.
DNA Sequencing
The iNOS and GHR fragments amplified from mesangial cells by PCR were
purified from the agarose gel using a GlasPac/GS QuicKit (National Scientific
Supply Co., San Rafael, CA). The resultant DNA was subjected to a cycle
sequencing reaction using the ABI Prism dye-labeled terminator reagent (Perkin
Elmer), according to the protocol provided by the manufacturer. The reaction
product was analyzed with an ABI 377 automated sequencer (Perkin Elmer).
Total RNA and Protein Extraction
To confirm increased iNOS protein levels in mesangial cells that exhibited
elevated iNOS mRNA levels, RNA and protein were extracted from the same
cultures, for use in PCR and Western blotting assays, respectively. These
cells were plated into 75-cm2 culture flasks and exposed for 11 d
to medium with or without GH (50 ng/ml). Conditioned medium was collected from
the final 48 h of the experimental period for further nitrite determination,
and the cells were scraped into 2 ml of Trizol reagent (Life Technologies).
The cell homogenate was subjected to total RNA extraction, followed by protein
isolation, according to the protocol provided by the manufacturer. RNA
concentrations in the samples were determined by measuring absorbance at 260
nm, and 1 µg of total RNA was used for RT with a first-strand synthesis kit
(Boehringer Mannheim). Protein concentrations were determined using the
Bio-Rad reagent (Bio-Rad). A standard curve for protein concentrations was
established using bovine 
-globulin in 0.1N NaOH.
Western Blotting
A total of 100 µg of protein extracted from each sample (control and
GH-treated cells) was fractionated by electrophoresis on a precast 4 to 20%
gradient polyacrylamide/Tris-glycine gel (Novex, San Diego, CA), under
reducing conditions. Protein extracted from mouse macrophages stimulated with
interferon- and LPS (Transduction Laboratories, San Diego, CA) was
subjected to electrophoresis simultaneously with the mesangial cell samples
and served as a positive control. Molecular weights were determined by
comparison with a standard purchased from Novex. The proteins were then
transferred to a polyvinylidene difluoride membrane (Novex) by electrophoresis
in a Tris-glycine/methanol transfer buffer (Novex) at 25 V for 8 h. The
membrane was placed in blocking buffer (5% nonfat dry milk, 10 mM Tris, pH
7.5, 100 mM NaCl, 0.1% Tween 20) overnight at 4°C. The blot was then
incubated overnight at 4°C with a polyclonal antibody against iNOS
(Transduction Laboratories), and diluted 1:5000 in blocking solution. After a
30-min wash in a buffer containing 10 mM Tris, pH 7.5, 100 mM NaCl, and 0.1%
Tween 20, the blot was incubated for 1 h at room temperature with a goat
anti-rabbit IgG, peroxidase-conjugated antibody (Pierce, Rockford, IL),
diluted 1:10,000 in blocking solution. After a final 30-min wash, the membrane
was incubated for 5 min at room temperature with SuperSignal West Pico
chemiluminescence substrate (Pierce) and was exposed to Hyperfilm ECL
(Amersham Life Science, Arlington Heights, IL).
Statistical Analyses
Nitrite contents were compared between treatment groups using InStat
software (GraphPad Software, Inc., San Diego, CA) to perform t tests
and ANOVA, followed by multiple comparison tests (alternate Welch t
test) to determine significant differences.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
RT-PCR amplification of iNOS from mesangial cells produced a cDNA of the expected size (223 bp), which was barely visible in control cells but was markedly increased (to values approximately 10 times greater than control values in this experiment) in GH-treated cells (Figure 1A). Sequencing of iNOS cDNA amplified from a sample of the GH-treated cells indicated 100% homology with the published sequence of murine macrophage iNOS mRNA (38). The nitrite contents in conditioned media from control and GH-treated cells are illustrated in Figure 1B. Consonant with the increased expression of iNOS transcripts, the nitrite contents in conditioned media from GH-treated cells were significantly elevated (P < 0.02), i.e., elevated ninefold compared with control cells (6.22 ± 0.45 versus 0.71 ± 0.99 nmol/mg cell protein, mean ± SD).
In contrast to iNOS, expression of ODC and OAT did not change after exposure to 50 ng/ml GH. The results of three experiments comparing the relative levels of iNOS, ODC, and OAT expression in control and GH-treated cells are illustrated in Figure 2. Ratio between densitometric readings of GH-treated and control cells for iNOS, ODC, and OAT were 10.3 ± 2.0, 1.1 ± 0.3, and 0.8 ± 0.2, respectively (mean ± SD).
|
Figure 3 shows the effect of increasing GH concentrations on the expression of enzymes of the L-arginine/NO metabolic pathway in mesangial cells. The data indicate a dose dependency in the iNOS response to GH, with maximal iNOS stimulation occurring at GH concentrations between 20 and 50 ng/ml. In contrast, OAT and ODC expression could be detected in the absence of GH and remained unchanged with addition of the hormone.
|
Figure 4 indicates that GH (50 ng/ml) was as effective as LPS (10 µg/ml) in increasing nitrite production in cultured mesangial cells. Nitrite concentrations were 0.58 ± 0.02 nmol/ml in control cells, 2.87 ± 0.17 nmol/ml in GH-treated cells, and 2.44 ± 0.08 nmol/ml in LPS-treated cells (mean ± SEM of triplicate experiments).
|
To test whether the GH-induced increase in nitrite levels in mesangial cells was directly related to an increase in NOS activity, nitrite was measured in the presence or absence of L-NMA (300 µM). Figure 5 demonstrates that nitrite production was effectively inhibited by L-NMA. Nitrite concentrations increased from 0.16 ± 0.04 nmol/ml in control cells to 3.46 ± 0.25 nmol/ml in GH-treated cells. However, in the presence of L-NMA, the effect of GH on nitrite production was significantly suppressed to 1.49 ± 0.003 nmol/ml (P < 0.005 versus GH alone). The nitrite level in the conditioned medium from cells exposed to L-NMA alone was not significantly different from control levels (0.08 ± 0.05 nmol/ml). Values represent mean ± SEM of three experiments.
|
Figure 6A demonstrates that the increase in iNOS mRNA expression was sustained after continuous stimulation of mesangial cells with GH for 11 d. Furthermore, using a Western blotting technique, we demonstrated that immunoreactive iNOS protein, with a predicted molecular mass of 130 kD, was detected only in GH-treated cells (Figure 6B). As in the shortterm studies described above, we demonstrated that changes in iNOS transcript and protein levels were reflected in significantly higher (P < 0.0001) nitrite contents in GH-treated cells, compared with control cells (6.41 ± 0.10 versus 1.65 ± 0.07 nmol/ml, respectively).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In contrast, our data demonstrated that the expression of ODC and OAT (enzymes of the alternative L-arginine/arginase metabolic pathway) was not altered by the presence of GH. It was suggested by others that both ODC and OAT activities are regulated by GH (27,28). We surmise that the differences between our findings and those reported previously may be ascribed to the possibility that GH affects ODC and OAT at a posttranscriptional level. Earlier studies identified a role for the L-arginine/arginase pathway, through OAT and ODC activities, in glomerular diseases (29,30). However, although inhibition of ODC prevented kidney hypertrophy in the first weeks of experimental diabetes (39), it did not change the course of the diabetic nephropathy (40), suggesting that this pathway may not play a primary role in chronic glomerular diseases.
On the other hand, the association of increased glomerular levels of NO and iNOS with glomerular extracellular matrix accumulation has been documented by several investigators (18,41,42). Narita et al. (18) demonstrated marked decreases in extracellular matrix accumulation after L-NMA treatment of rats with anti-thymocyte serum-induced nephritis. Using a nephrotoxic nephritis model, Bremer et al. (41) reported significant attenuation of glomerular damage in rats treated with aminoguanidine, which is a NOS inhibitor that is relatively selective for iNOS. In addition to these experimental findings, clinical studies demonstrated a positive correlation between the renal expression of iNOS and the degree of glomerular injury in biopsy specimens from patients with IgA nephropathy or lupus nephritis (42). Although iNOS-derived NO in nephritic models was largely attributed to glomerulus-infiltrating macrophages (18,19,41), more recently Furusu et al. (42) were able to detect immunoreactive iNOS in mesangial cells from renal biopsies of patients with glomerulonephritis. These studies suggest that the association of iNOS with glomerular injury may not be strictly dependent on the cell type (i.e., macrophage versus mesangial cell) expressing the enzyme.
Expression of iNOS is generally low in the glomerulus and mesangial cells
under normal conditions. However, it can be upregulated in vitro by
LPS and cytokines, including tumor necrosis factor-
and
interleukin-1ß
(21,22).
Moreover, both interleukin-1ß and tumor necrosis factor- have been
shown to be activated in macrophages and mesangial cells from renal tissue of
animals with experimental nephritis
(43,44).
Although in this study we have not explored the specific intracellular
signaling pathway involved in the GH induction of iNOS, our present findings
that mesangial cells bear GHR and that GH is at least as effective as LPS in
inducing iNOS suggest that GH may act in a cytokine-like manner to stimulate
iNOS. This finding is consistent with a previous report that, in addition to
the nuclear factor B pathway, cytokines can use the JAK-STAT
intracellular signaling system to regulate iNOS expression
(17).
Coupled with a substantial body of evidence linking elevated levels of GH with glomerular diseases (3,4,5,6,7,8,9,10,11,12,13,14,15), and with reports linking iNOS with experimental and clinical glomerulopathies (18,19,20,41,42), the results presented here suggest that the GH/iNOS/NO pathway may play a role in glomerular scarring. This is supported by our recent finding that the expression of iNOS was significantly elevated in the renal cortex of bovine GH-transgenic mice (which expressed a severe degree of glomerulosclerosis) compared with nontransgenic control mice (45). Definitive identification of iNOS involvement in glomerulosclerosis awaits further studies to define the role of iNOS-derived NO in vivo.
|
Acknowledgments |
|---|
S.Q. Doi received support from CNPq (National Council for Technological and Scientific Development), Brazil (#147468/1999-0).
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B in rat mesangial
cells: Involvement of JAK-STAT signaling [Abstract]. J Am Soc
Nephrol 8: 335A,1997
This article has been cited by other articles:
 |
|
 |
|
  P. Kamenicky, S. Viengchareun, A. Blanchard, G. Meduri, P. Zizzari, M. Imbert-Teboul, A. Doucet, P. Chanson, and M. Lombes Epithelial Sodium Channel Is a Key Mediator of Growth Hormone-Induced Sodium Retention in Acromegaly Endocrinology, July 1, 2008; 149(7): 3294 - 3305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Grasemann, F. Ratjen, D. Schnabel, E. Reutershahn, U. Vester, and H. Grasemann Effect of growth hormone therapy on nitric oxide formation in cystic fibrosis patients Eur. Respir. J., April 1, 2008; 31(4): 815 - 821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R. Reddy, M. J. Pushpanathan, R. F. Ransom, L. B. Holzman, F. C. Brosius III, M. Diakonova, P. Mathieson, M. A. Saleem, E. O. List, J. J. Kopchick, et al. Identification of the Glomerular Podocyte as a Target for Growth Hormone Action Endocrinology, May 1, 2007; 148(5): 2045 - 2055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Mason and N. A. Wahab Extracellular Matrix Metabolism in Diabetic Nephropathy J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1358 - 1373. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Liu, Y. Yu, Y. Jiang, and J. Li Growth Hormone Increases Lung NF-{kappa}B Activation and Lung Microvascular Injury Induced by Lipopolysaccharide in Rats Ann. Clin. Lab. Sci., April 1, 2002; 32(2): 164 - 170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Liu, A. M. Gutierrez, A. Ring, and A. E. G. Persson Nitric Oxide Induces Resensitization of P2Y Nucleotide Receptors in Cultured Rat Mesangial Cells J. Am. Soc. Nephrol., February 1, 2002; 13(2): 313 - 321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Pagel, T. Langenickel, K. Hohnel, S. Philipp, A. K. Nussler, W. F. Blum, M. L. Aubert, R. Dietz, and R. Willenbrock Cardiac and Renal Effects of Growth Hormone in Volume Overload-Induced Heart Failure: Role of NO Hypertension, January 1, 2002; 39(1): 57 - 62. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
), but not in control mesangial cells (C), as
demonstrated by Western blotting with a polyclonal anti-iNOS antibody (as
described in Materials and Methods).