 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
INSERM U423, Université
René Descartes,
Hôpital Necker-Enfants Malades, Paris,
France
Renal Unit, Paphos General Hospital, Paphos, Cyprus.
Correspondence to Dr. Corinne Antignac, INSERM U423-Tour Lavoisier 6eme étage, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France. Phone: 33 1 44 49 50 98; Fax: 33 1 44 49 02 90; E-mail: antignac{at}necker.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3 and 4 chains of type IV
collagen, are responsible for the autosomal-recessive form of Alport syndrome,
a progressive hematuric nephropathy characterized by glomerular basement
membrane abnormalities. Reported here are the complete COL4A3
exon-intron structure and a comprehensive screen for mutations of the 52
COL4A3 exons in 41 unrelated patients diagnosed as having autosomal
Alport syndrome. This resulted in the identification of 21 mutations that are
expected to be causative. Furthermore, it is shown that heterozygous
COL4A3 missense mutations, when symptomatic, can be associated with a
broad range of phenotypes, from familial benign hematuria to the complete
features of Alport syndrome nephropathy. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chains that share a very similar primary structure:
(1) an approximately 25-residue "7S" domain at the amino
terminus; (2) a long, collagenous domain of approximately 1400
Gly-X-Y repeats, which is interrupted by short, noncollagenous regions, and
forms the triple helix together with two other chains; and
(3) an approximately 230-residue noncollagenous (NC1) domain at the
carboxyl terminus, which is folded into a globular structure. The 7S and NC1
domains are cross-linking domains. Six chains of type IV collagen have
been identified (1), various
combinations of which allow the production of several molecular isoforms
(1,2,3,4)
that interact in different supramolecular networks
(3,4,5,6).
This complexity probably accounts for the structural and functional diversity
of BM. The 3, 4, and 5 chains are strongly expressed in
the highly specialized glomerular BM (GBM) in the kidney
(6,7,8,9,10,11),
where they form a distinct network characterized by loops and supercoiled
triple helices that are stabilized by disulfide bonds
(6). The six (IV) chains
are encoded by six genes (COL4A1 through COL4A6) that
present a unique arrangement in that they are located pairwise in a
head-to-head fashion on three separate chromosomes
(12,13,14,15,16,17,18).
Type IV collagens are directly involved in the pathogenesis of three human
diseases: (1) Goodpasture syndrome, an auto-immune disorder
characterized by pulmonary hemorrhage and/or rapidly progressive
glomerulonephritis, is caused by anti-3(IV) antibodies that bind to
alveolar and GBM (19);
(2) Alport syndrome (AS), a progressive inherited nephropathy, is
characterized by irregular thinning, thickening, and splitting of the GBM
often associated with hearing loss and ocular symptoms
(20). AS has been shown to be
caused by COL4A5 mutation in its X-linked form
(21,22,23)
and to COL4A3 or COL4A4 mutations in its autosomal-recessive
form (24); furthermore, the
autosomal-dominant form of the disease has been shown to be genetically linked
to the COL4A3-COL4A4 locus
(25). (3) Mutations
in COL4A4 have been reported in benign familial hematuria (FBH)
(26,27),
a dominantly inherited nephropathy characterized by a thin GBM, that, contrary
to AS, never leads to renal failure. These data illustrate the broad spectrum
of phenotypes associated with COL4A3-COL4A4 mutations and raise the
question of whether there is any relationship between the mutations and their
effects on the type IV collagen network in GBM and the disease phenotypes
observed.
Mutation screening of COL4A3 in GBM diseases has been hampered by the lack of information regarding the structure of this gene, which has been characterized at its 3' end only (28) where five mutations have been described, all in patients affected by autosomal-recessive AS (24,29,30,31). In this study, we report the entire structure of the COL4A3 gene and the characterization of novel mutations associated with autosomal-recessive AS. Furthermore, we show that individuals who carry a heterozygous COL4A3 mutation, can present with hematuric nephropathies of very variable severity when they have symptoms. Some patients present with isolated microscopic hematuria; at the other end of the spectrum, some develop complete features of AS nephropathy.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3, 4, and 5(IV)
chains was observed; in one case (family 39), the expression of 3(IV),
4, and 5(IV) was reduced in GBM, whereas in two cases (families
21 and 32), expression of type IV collagen chains was normal. Thirty-nine patients were previously screened for COL4A4 mutations. In 35 patients, we did not detect any band shift by single-strand conformation polymorphism (SSCP) analysis of the 48 COL4A4 exons. Four patients (37 to 40) were previously shown to carry a pathogenic heterozygous COL4A4 mutation, and two (14 and 18) were found to carry a COL4A4 mutation of unknown significance (non-glycine substitution in the collagenous domain) (27). These six patients were included in this study to determine whether they could harbor a COL4A4 mutation on one allele and a COL4A3 mutation on the other allele. Two patients (families 31 and 32) have not yet been screened for COL4A4 mutations. Informed consent was obtained from all individuals or their parents.
Long-Range and Ligation-Mediated PCR
Long-range and ligation-mediated PCR were performed as described previously
(27) using 21 primer pairs
located along the COL4A3 cDNA sequence to amplify COL4A3
genomic DNA from a yeast artificial chromosome (YAC clone 929_G_1) from the
CEPH (Center d'Etude du Polymorphisme Humain, France) library. This clone has
been shown previously to contain the 3' end of both COL4A3 and
COL4A4 genes (27).
PCR products were subsequently sequenced, and exon/intron boundaries were
determined by comparing the genomic and cDNA sequences. Intronic sequences
flanking exons all were confirmed by sequencing human genomic DNA.
Reverse Transcription-PCR Analysis
Isolation of total RNA from lymphocytes, COL4A3 cDNA synthesis,
and nested PCR were performed as in Knebelmann et al.
(22). PCR products were
sequenced by direct automated sequencing (Applied Biosystem, Courtaboeuf,
France). Primers used were based on the published COL4A3 cDNA
sequence (34) and were as
follows (5' to 3'). External primers: 4A3-38F, AAAGGAGAAATGGGGCAA
in exon 38; 4A3-46R, GTTCTCCAGGTGTGCCAGGT in exon 46. Nested primers: 4A3 39F,
GTCCCATGTCTCCTGCAGTT in exon 39; 4A343R, GTCCCATGTCTCCTGCAGTT in exon 43. Both
PCR were performed with a 58°C annealing temperature.
Mutation Detection by SSCP Analysis and Direct Sequencing
All COL4A3 coding exons were amplified by PCR using flanking
intronic primers selected with the OLIGO 5.0 program (National Biosciences,
Inc., Plymouth, MN). The 3' ends of PCR primers were located between 5
and 92 bp from the exon boundary. PCR products were screened by SSCP analysis
as in Saunier et al.
(35) using Genephor
electrophoresis unit and silver staining (Amersham Pharmacia Biotech, Orsay,
France). Sequence variation giving rise to a mobility shift was determined by
direct automated sequencing (Applied Biosystem).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
cDNA Sequence Discrepancies
We found several differences between our YAC-derived sequence and the
published cDNA sequence (Table
2); some of these sequence discrepancies have already been
corrected (40). Although
possibly reflecting rare variants, this is unlikely as all of our sequences
were consistently the same in several independent genomic DNA controls. The
change that we find in exon 22 (see Table
2) suggests that a valine is included in the eighth collagenous
interruption, generating a VFRK interruption to the Gly-X-Y repeat instead of
the single amino acid K interruption as originally published
(34).
|
Characterization of Mutations
The PCR primers designed for SSCP analysis are described in
Table 3. A total of 32 sequence
variants were identified (Table
4). Twenty-one of these are expected to be pathogenic. Nine result
in premature termination codons or frameshifts and are potentially null
mutations, four are splicing mutations that affect the consensus splice sites
of four different introns, and eight are amino acid substitutions. Among the
eight amino acid substitutions thought to be pathogenic, one is a cysteine for
arginine substitution in the NC1 domain, R1661C, which was found in four
unrelated patients. This change was not found in 36 control DNA, involves an
arginine that is conserved in all six (IV) chains, and introduces a new
cysteine residue in the NC1 domain. This is likely to alter the conformation
of the NC1 domain where cysteines form intramolecular disulfide bonds. The
seven other potentially pathogenic substitutions are glycine substitutions in
the collagenous domain that were not found in control DNA (except for the
patient from South America, the controls were matched with the geographic
origin of the patients).
|
|
We found 11 other substitutions (Table 4). Three involve nonglycine residues in the collagenous domain, which are not conserved in other type IV collagen chains, but were not found in control individuals. One of these was found homozygous in a consanguineous family (family 2). The potential role of these variants remain to be established. The remaining eight substitutions clearly are polymorphisms as they are also found in control DNA: six involve nonglycine residues in the collagenous domain, one is a leucine-to-proline substitution in the NC1 domain, which has already been reported (30), and, surprising, numerous control individuals harbor an arginine for glycine substitution at the beginning of the collagenous domain (G43R).
Analysis of the Consequence of the Splicing Mutation in Family 28:
Identification of a COL4A3 Alternative Transcript
Lymphocytes were available for RNA extraction from one patient (family 28)
who carried a mutation at the 5' splice site of intron 41 (delG at 3565
+ 1), and we performed reverse transcription-PCR analysis to determine the
consequences of the mutation on the splicing process. Surprising is that in
addition to the transcript containing exons 40, 41, and 42, a messenger RNA
containing a 40-bp insertion between exons 41 and 42 was amplified in both
control and patient. This 40-bp sequence, located 1512 bp downstream of exon
41 within intron 41 (see Figure
2), is bound by sequences that fit the consensus required for
splicing and introduces a stop codon immediately after exon 41. Lymphocytes
from the patient in family 28 showed these two transcripts plus two additional
RNA containing 36-bp and 76-bp insertions, respectively. The patient-specific
insertions correspond to the 36 bp and 76 bp immediately following exon 41
joined to the 40-bp insertion found in the control
(Figure 2). This introduces an
insertion of nine amino acids after exon 41 followed by a stop codon.
|
Distribution of the Mutations in the Families and Mutation
Segregation Analysis
Eight pathogenic mutations were homozygous and found in consanguineous
families. One other was found homozygous in a consanguineous family and
heterozygous in another unrelated kindred. Of 13 patients affected with
heterozygous mutations, only 3 (families 16, 17, and 34) were shown to carry
one different pathogenic mutation on each allele and 1 (family 28) was
carrying a nonglycine substitution (I330T) that we could not assign to a
particular allele. In the nine others, only one mutation was detected.
DNA from proband relatives were available in 15 families, enabling us to study the segregation of the mutation (Figure 3). Six were consanguineous families, and, as expected, both parents were shown to carry the same heterozygous mutation. In the nine others, one of the parents or at least one sibling was shown to be heterozygous for the mutation. Thus, all of these mutations were inherited.
|
Phenotypes in Individuals Carrying a Heterozygous COL4A3
Mutation
Clinical data were not always available for all family members in this
study. In several cases, however, parents or siblings who proved to carry an
heterozygous mutation were having no urinary symptoms (see
Figure 3, A and B, for
example). Four individuals in three families that carry a COL4A3
heterozygous mutation presented with isolated microhematuria. They were
carrying a missense glycine mutation in two cases (family 23) and a splice
(family 9) and a frameshift (family 27) mutation in the two others. In family
23 (Figure 3C), both parents
presented with isolated chronic hematuria but no other symptoms suggestive for
Alport syndrome. Both had a normal renal function at last examination, when
they were 44 and 45 yr old, respectively. Even in the absence of renal biopsy,
these are typical clinical features of FBH. As expected, segregation of the
mutation in this family showed that the proband's parents were carrying
heterozygous G1270E mutation.
In family 34, pedigree analysis initially suggested a father-to-son transmission, but the course of the nephropathy was more severe in the affected children (the proband and his sister underwent dialysis between 20 and 25 yr) than in their father (who reached ESRF when he was 40 yr old). We were able to demonstrate that the proband is carrying a different COL4A3 mutation (G297E and G407R) on each allele (not shown) and that one mutation (G407R) was inherited from his mother. Although DNA from the father was not available, it is very likely that he was carrying the G297E heterozygous mutation.
In family#41, the female proband reached ESRF at the age of 23. Her mother, who is carrying the G1167R substitution, is presenting a microscopic hematuria and developed proteinuria at the age of 44. Her renal function is still normal at age 52. It is interesting that ultrastructural examination of her kidney biopsy showed areas of thinning alternating with areas of splitting of the GBM.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3 chain of type IV collagen, which forms with
4(IV) and 5(IV) a distinct network in GBM in the kidney
(6), have been shown to be
responsible for the autosomal-recessive form of AS
(24). Only five mutations have
been reported in COL4A3
(24,29,30,31),
all located in the previously characterized 3' end of the gene. In the
present study, we determined the entire exon-intron structure of the human
COL4A3 gene using long-range and ligation-mediated PCR to amplify and
sequence a YAC clone previously shown to cover the gene
(27). We can estimate
COL4A3 to be greater than 85 kb; however, the size of intron 1 could
not be precisely determined but is likely to be greater than 12 kb, beyond the
range of PCR. Furthermore, we report an alternatively spliced COL4A3
transcript found in control in lymphocytes and kidney
(Figure 2), introducing a stop
codon within the collagenous domain. Alternatively spliced COL4A3
mRNA leading to frameshift and putative truncated proteins missing the
carboxyl terminus of the NC1 domain of the protein have been described in
kidney and other tissues
(41,42).
If translated, all of these RNA are expected not to function in triple helix
formation, and their significance remains to be clarified. Having determined the entire COL4A3 gene structure, we performed mutation screening by SSCP on all COL4A3 coding exons of 41 patients with autosomal AS and detected in 22 families 21 mutations that are likely to be pathogenic. One substitution (R1661C) was found in four unrelated patients. This mutation occurs in a CpG pair, suggesting that its recurrence is due to methylation-mediated deamination, although we cannot rule out a founder effect as all of these patients are from France. We also detected three variants of unknown significance and eight exonic polymorphisms. Surprising is that an arginine for glycine substitution in the collagenous domain was found in several control individuals, frequently (18%) in the homozygous state. The small size of the glycine residue is critical for the formation of a stable collagen triple helix. The frequency of the G43R variant allele in controls (42%) excluded the possibility that it is responsible for a phenotype. This observation is reminiscent of the G545A variant reported in a large number of control individuals in COL4A4 (27). However, the glycine at position 43 in COL4A3 is the first codon of the collagenous domain. Its substitution by an arginine, which is rather large and basic, probably should be considered as a polymorphism in the length of the amino terminal noncollagenous domain of the protein. Whether these polymorphisms, modifying the primary structure of the main component of the GBM, can play a role in the progression of other glomerular nephropathies remains to be determined.
Autosomal-recessive inheritance accounts for approximately 15% of the cases of AS (30) and is due to mutations in the COL4A3-COL4A4 genes. We recently reported the complete structure of COL4A4 (27). The characterization of the exon-intron structure of COL4A3 determined in the current study will allow a comprehensive screening of the genes involved in recessive AS. We have now tested by SSCP all COL4A4 and COL4A3 coding exons in a group of 45 unrelated patients with autosomal-recessive AS (39 of the 41 we report here and 6 other patients carrying a COL4A4 mutation on both alleles), and, overall, we detected a pathogenic mutation in 53% of the tested alleles. This mutation detection rate is far lower than the rate of mutation detected in our laboratory for other noncollagenous genes using SSCP (C. Antignac, personal communication, 2000). It is possible that some mutations have been missed because of the presence of several polymorphisms that are making additional band shifts very difficult to detect. In addition, large deletions (which are responsible for up to 16% of the mutations in X-linked AS (32)) or other rearrangements such as large duplications or inversions, if occurring in non-consanguineous family, would not be detected by SSCP. Another possibility is that some recessive AS patients carry one mutation on COL4A3 on one allele and one mutation on COL4A4 on the other allele. However, screening all COL4A3 coding exons in the four patients whom we previously reported as carrying a single COL4A4 mutation showed no COL4A3 mutations. Conversely, in the eight families that we report here carrying a single COL4A3 variant, we found no COL4A4 mutations in the six families screened to date. One further consideration is that there may be (an)other gene(s) responsible for the disease. However, the relatively low mutation detection rate in COL4A3-COL4A4 that we found here in recessive AS is very similar to what has been reported by several groups using SSCP to screen the COL4A5 gene involved in X-linked Alport syndrome. It has been shown recently that direct sequencing of all COL4A5 exons in X-linked AS greatly increases the mutation detection rate (43). In addition, it is likely that mutations in introns or regulatory elements of type IV collagen genes are being overlooked.
Finally, our study, and our recent report of a COL4A3 mutation in a family of typical dominant AS (44) also demonstrates the broad spectrum of phenotypes associated with COL4A3 heterozygous mutations, which can be completely asymptomatic or lead to hematuric nephropathies of variable severity. In family 23, both parents, carrying a heterozygous glycine substitution (G1207E), presented with typical feature of FBH, a disease previously shown to be due to heterozygous mutations in COL4A4 (26,27). In family 34, the father, who is probably carrying a heterozygous glycine substitution as well (G297E), presented with an adult form of AS and underwent dialysis when he was 40. In family 41, the mother, carrying a glycine substitution (G1167R), presented with an intermediate form of the nephropathy with hematuria and proteinuria without renal failure occurring late in adulthood. The characterization of the gene that we report here will allow a comprehensive screen of COL4A3 for mutations and contribute to a better understanding of genotype-phenotype correlations in type IV collagen disorders.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Dr. Clifford Kashtan served as guest editor and supervised the review and final disposition of this manuscript.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3(IV) and 4(IV) chains of type IV collagen to
chromosome 2 bands q35-37. Genomics13
: 809-813,1992[Medline]
4 chain of basement membrane
collagen type IV and assignment of the gene to the distal long arm of human
chromosome 2. J Biol Chem 267:23753
-23758, 19923(IV) and 4(IV) collagen
genes in autosomal recessive Alport syndrome. Nat
Genet 8: 77-82,1994[Medline]
3 and 4 genes (COL4A3 and COL4A4). Nephrol
Dial Transplant 12:1595
-1599, 19973 (COL4A3) gene in autosomal recessive Alport
syndrome. Hum Mol Genet 3:1269
-1273, 19943(IV) and
4(IV) collagen chains, are arranged head-to-head on chromosome 2q36.
FEBS Lett 424:11
-16, 1998[Medline]
1 chain of human type IV.
J Biol Chem 264:13565
-13571, 19893(IV) chain of collagen IV and
localization of epitopes exclusively to the noncollagenous domain.
Kidney Int 55:926
-935, 1999[Medline]
This article has been cited by other articles:
 |
|
 |
|
  K. Voskarides, L. Damianou, V. Neocleous, I. Zouvani, S. Christodoulidou, V. Hadjiconstantinou, K. Ioannou, Y. Athanasiou, C. Patsias, E. Alexopoulos, et al. COL4A3/COL4A4 Mutations Producing Focal Segmental Glomerulosclerosis and Renal Failure in Thin Basement Membrane Nephropathy J. Am. Soc. Nephrol., November 1, 2007; 18(11): 3004 - 3016. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Kashtan Alport syndrome and the X chromosome: implications of a diagnosis of Alport syndrome in females Nephrol. Dial. Transplant., June 1, 2007; 22(6): 1499 - 1505. [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Harvey, J. Perry, K. Zheng, D. Chen, Y. Sado, B. Jefferson, Y. Ninomiya, R. Jacobs, B. G. Hudson, and P. S. Thorner Sequential Expression of Type IV Collagen Networks: Testis as a Model and Relevance to Spermatogenesis Am. J. Pathol., May 1, 2006; 168(5): 1587 - 1597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Kashtan Autotopes and Allotopes J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3455 - 3457. [Full Text] [PDF]
|
|
|
|
 |
|
 D. J.R. Steele and P. J. Michaels Case 40-2004 - A 42-Year-Old Woman with Long-Standing Hematuria N. Engl. J. Med., December 30, 2004; 351(27): 2851 - 2859. [Full Text] [PDF]
|
|
|
|
|
|
B. G. Hudson The Molecular Basis of Goodpasture and Alport Syndromes: Beacons for the Discovery of the Collagen IV Family J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2514 - 2527. [Full Text] [PDF]
|
|
|
|
|
|
J. P. Jais, B. Knebelmann, I. Giatras, M. De Marchi, G. Rizzoni, A. Renieri, M. Weber, O. Gross, K.-O. Netzer, F. Flinter, et al. X-Linked Alport Syndrome: Natural History and Genotype-Phenotype Correlations in Girls and Women Belonging to 195 Families: A "European Community Alport Syndrome Concerted Action" Study J. Am. Soc. Nephrol., October 1, 2003; 14(10): 2603 - 2610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Heidet, D.-B. Borza, M. Jouin, M. Sich, M.-G. Mattei, Y. Sado, B. G. Hudson, N. Hastie, C. Antignac, and M.-C. Gubler A Human-Mouse Chimera of the {alpha}3{alpha}4{alpha}5(IV) Collagen Protomer Rescues the Renal Phenotype in Col4a3-/- Alport Mice Am. J. Pathol., October 1, 2003; 163(4): 1633 - 1644. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Prakash, K. W. Chung, S. Sinha, M. Barmada, D. Ellis, R. E. Ferrell, D. N. Finegold, P. S. Randhawa, A. Dinda, and A. Vats Autosomal Dominant Progressive Nephropathy with Deafness: Linkage to a New Locus on Chromosome 11q24 J. Am. Soc. Nephrol., July 1, 2003; 14(7): 1794 - 1803. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Heidet, E. M. H. F. Bongers, M. Sich, S.-Y. Zhang, C. Loirat, A. Meyrier, M. Broyer, G. Landthaler, B. Faller, Y. Sado, et al. In Vivo Expression of Putative LMX1B Targets in Nail-Patella Syndrome Kidneys Am. J. Pathol., July 1, 2003; 163(1): 145 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Gross, K.-O. Netzer, R. Lambrecht, S. Seibold, and M. Weber Novel COL4A4 splice defect and in-frame deletion in a large consanguine family as a genetic link between benign familial haematuria and autosomal Alport syndrome Nephrol. Dial. Transplant., June 1, 2003; 18(6): 1122 - 1127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Chen, B. Jefferson, S. J. Harvey, K. Zheng, C. J. Gartley, R. M. Jacobs, and P. S. Thorner Cyclosporine A Slows the Progressive Renal Disease of Alport Syndrome (X-Linked Hereditary Nephritis): Results from a Canine Model J. Am. Soc. Nephrol., March 1, 2003; 14(3): 690 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Harvey, K. Zheng, B. Jefferson, P. Moak, Y. Sado, I. Naito, Y. Ninomiya, R. Jacobs, and P. S. Thorner Transfer of the {alpha}5(IV) Collagen Chain Gene to Smooth Muscle Restores in Vivo Expression of the {alpha}6(IV) Collagen Chain in a Canine Model of Alport Syndrome Am. J. Pathol., March 1, 2003; 162(3): 873 - 885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Kashtan Animal models of Alport syndrome Nephrol. Dial. Transplant., August 1, 2002; 17(8): 1359 - 1362. [Full Text] [PDF]
|
|
|
|
|
|
C. Badenas, M. Praga, B. Tazon, L. Heidet, C. Arrondel, A. Armengol, A. Andres, E. Morales, J. A. Camacho, X. Lens, et al. Mutations in theCOL4A4 and COL4A3 Genes Cause Familial Benign Hematuria J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1248 - 1254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ciccarese, D. Casu, F. K. Wong, R. Faedda, S. Arvidsson, G. Tonolo, H. Luthman, and A. Satta Identification of a new mutation in the {alpha}4(IV) collagen gene in a family with autosomal dominant Alport syndrome and hypercholesterolaemia Nephrol. Dial. Transplant., October 1, 2001; 16(10): 2008 - 2012. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Harvey, R. Mount, Y. Sado, I. Naito, Y. Ninomiya, R. Harrison, B. Jefferson, R. Jacobs, and P. S. Thorner The Inner Ear of Dogs with X-Linked Nephritis Provides Clues to the Pathogenesis of Hearing Loss in X-Linked Alport Syndrome Am. J. Pathol., September 1, 2001; 159(3): 1097 - 1104. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
