 |
||||
| 2008 JASN IMPACT FACTOR 7.505 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2008 JASN IMPACT FACTOR 7.505 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Section of Genetics, Department of Reproductive and Developmental Science,
University of Trieste, Trieste, Italy
Medical Genetics Service, IRCCS Burlo Garofolo, Trieste, Italy
Department of Biology, University of Trieste, Trieste, Italy
Transplant Immunology Service, Ospedale S. Giovanni Battista di Torino,
Torino, Italy
||
Division of Nephrology and Dialysis, Azienda Ospedaliera Triestina,
Trieste, Italy
¶
Renal Stones Center, Ospedale Mauriziano Umberto I, Torino,
Italy
Correspondence to Dr. Antonio Amoroso, Servizio di Genetica—IRCCS Burlo Garofolo, Via dell'Istria 65/1 - 34137 Trieste - Italy. Phone: +39 040 3785275; Fax: +39 040 3785210; E-mail: amoroso{at}burlo.trieste.it
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The pathophysiology of hyperoxaluria is a result of the low degree of solubility of the calcium oxalate (CaOx) that produces urolithiasis and/or nephrocalcinosis, often leading to renal failure. The loss of the renal function generally increases the oxalate plasma levels, and it induces calcium oxalate oversaturation in the body fluids (4). In many tissues, this causes a progressive storage of CaOx crystals, causing a syndrome referred to as systemic oxalosis (5).
The clinical setting of the disease is highly heterogeneous with respect to age at onset, type of presentation, severity of hyperoxaluria, residual enzymatic activity, and progression to renal insufficiency (6). Most patients suffered from recurrent episodes of nephrolithiasis in childhood or adolescence; the infantile form of oxalosis is diagnosed only in few cases, a factor that often leads to death for renal failure during the first months of life. An increasing number of patients are diagnosed only in adulthood, usually after a long-standing history of recurrent nephrolithiasis and sometimes after starting dialysis treatment or after a kidney transplant (6).
The AGT enzyme is encoded by a single copy gene (AGXT), consisting of 11 exons, ranging from 65 bp to 407 bp, and spanning over a 10 Kb DNA segment in the 2q37.3 human region (7). AGT is a 392-amino acid protein with a molecular weight of 43 kD (8). From the cytosol, where it has a homodimeric structure, it is then imported into the peroxisomes, where it detoxifies the glyoxylate by using pyridoxal-5-phosphate as a cofactor (1).
Although the enzyme is normally located in the peroxisomes, a small AGT amount (5%) can also be found in the mitochondria (9), where the enzyme does not function (6).
So far, seven polymorphisms and 35 mutations have been identified in the AGXT gene by using several technical approaches (10,11,12,13,14,15,16,17,18,19,20,21,22).
The disease is caused by homozygous point mutations or by compound heterozygous in two different point mutations. Polymorphic sequences have also been proven to combine with two haplotypes that were identified in the normal white population. The major (80% frequency) and the minor (20% frequency) haplotype present a combination of three polymorphisms: 74 bp duplication within the first intron (12,18) and C154T and A1142G point mutations, which specify Pro11Leu and Ile340Met amino acid substitutions, respectively (9). The normal minor haplotype is responsible for a 5% mistargeting of the AGT to the mitochondria; the mistargeting then rises to 90% when the minor haplotype is associated to G630A (Gly170Arg amino acid substitution) (19,23).
In this article, we report the clinical findings and the AGXT mutations of 23 unrelated Italian PH1 patients. To establish genotype-phenotype correlations, we used a molecular diagnosis associated to clinical, biochemical, and enzymological data.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Based on the age at onset, 1 patient had an infantile oxalosis, 7 had an adult form, and the disease was diagnosed during adolescence in 15 patients. According to the clinical data, 4 patients had renal failure associated to nephrocalcinosis, whereas 19 had recurrent nephrolithiasis. When analyzing the renal function among our 23 patients, we saw that 8 patients were diagnosed with PH1 after they had started dialysis and that 2 were diagnosed after a kidney transplantation. For eight patients, those with maintained renal function, the classification of PH1 in terms of clinical data and diagnosis was made by assaying the plasma and the urine for oxalate, glycolate, and L-glycerate in at least two separate sample collections. Plasma levels and dialysis removal of the same chemistries were measured in the other patients on renal replacement therapy.
The results belonging to patients who were suspected of having PH1 (in any of the above groups) were compared with reference values belonging to normal individuals or patients undergoing dialysis for oxalosis-unrelated nephropathies. PH1 was, therefore, diagnosed when both the levels of oxalate and of glycolate were higher than the highest reference range (Table 1).
|
We then analyzed the response of 20 patients to pyridoxine by repeating the same assays after a 10 to 30 mg/kg per d pyridoxine treatment that lasted 1 month. We arbitrarily defined the positive response as a normalization or a 50% decrease in both oxalate and glycolate levels in plasma and urine.
Liver biopsies were performed to test the AGT and gamma-glutamyl transferase (GGT) activity. At the time of biopsy, the patients had been off the pyridoxine treatment for an entire month. Clinical and biochemical details are summarized in Table 2.
|
Biochemical Procedures
The levels of oxalate and glycolate in plasma, urine, and dialysis fluids
were determined by HPLC procedures, as specified elsewhere
(24). Specimens from hepatic
biopsies were analyzed for AGT and GGT by means of a HPLC-based microassay
(25). The GFR measurements,
relating to patients with maintained renal function, were carried out
contemporaneously with the plasma and urine assaying for oxalate, glycolate,
and L-glycerate during the last visit to our center. As outlined previously,
the reference ranges derive from the values of normal individuals or patients
undergoing dialysis for oxalosis-unrelated nephropathies; these findings were
published elsewhere and are summarized in
Table 1
(26,27).
Molecular Approach
The DNA extraction and the in vitro amplification were performed
as described previously (28).
Initially, the PCR products were analyzed by using the technique of the
single-strand conformation polymorphism (SSCP) under standard conditions
(29). The samples showing an
abnormal electrophoretic pattern were analyzed by direct sequencing of both
strands using the BigDye Terminator Cycle Sequencing Kit (PE Biosystems,
Foster City, CA) on an automated ABI PRISM 310 Sequencer (PE Biosystems)
(10). For the unrecognized
mutation, we performed a mutation analysis using direct sequencing together
with SSCP. For patient 20 and patient 23, we performed direct sequencing of
all 11 AGXT exons. The co-inheritance of the mutations with the major
or minor haplotype was checked by amplification and restriction analysis for
C154T and A1142G polymorphisms and by amplification and agarose gel
electrophoresis for the 74bp duplication in intron 1, as previously reported
(12,23).
Twenty-two PH1 patients and 25 unrelated controls were analyzed for the AGXT flanking markers D2S2285 and D2S125, which are 2.5 cM distant, and for D2S140, which is located far away from the former two (5.5 and 3.0 cM, respectively). Microsatellites D2S2285 (using 5'6fam-AGGACCACCTCGTTGC and 5'ATGGCTGTGAATGCCTG primers) and D2S140 (using 5'6fam-GCTACAATGATTTCCAAAGTC and 5'GTTGTCCCATACTGATCTTACC) were amplified in a 50-µl final volume by using 50 ng of DNA, 5 pmol of each primer, and 1 U of AmpliTaq GOLD DNA polymerase (PE Biosystems) in the GeneAmp PCR System 2400 (PE Biosystems). D2S125 was amplified by using Linkage mapping set version 2 (PE Biosystem) in a 7.5-µl final volume. We ran the amplified products on an automated sequencer (ABI PRISM 310, PE Biosystems) and analyzed them by using Genescan 2.0.2 software and Genescan-400 Rox as size standard (PE Biosystems).
Statistical Analyses
Results were analyzed by the 
2 test, Fisher's exact test,
t test for unpaired data, and simple regression analysis where
appropriate.
Gene frequencies were calculated by direct gene counting, and differences
in frequencies were analyzed by the 2 test or Fisher's exact
test using 2 x 2 contingency tables.
Frequency of haplotypes and linkage disequilibria from population were calculated using the Arlequin 2.0 software. This software allowed us to calculate haplotype frequencies when gametic phases were unknown, using the expectation maximization algorithm (30).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
By resorting to this latter classification, 20 out of 23 patients were grouped as follows: group A, 8 patients presenting the most severe form with early onset (before the age of 10 yr) and progression to end-stage renal failure (ESRF) before the age of 20 yr; group B, 7 patients presenting milder course with onset after 10 yr of age and progression to ESRF after the age of 20 yr; and group C, 5 patients aged over 20 yr with maintained renal function (Table 2). The three patients excluded from this classification were young individuals (one with an actual age < 10 yr and two aged <20 yr) whose onset of PH1 occurred before the age of 10 yr but whose renal function was preserved. These patients cannot be included in the previous groups because of the shorter follow-up. These three patients were analyzed only for genetic studies and were not included in genotype-phenotype correlation.
The patients with stable renal function had a mean GFR of 72.6 ± 18.3 ml/min per 1.73 m2 body surface area (range, 40 to 100) over 11.3 ± 6.0 yr of follow-up (range, 4 to 21 yr).
The patients with severe form (group A) had poor or no residual AGT activity (six out of eight were tested with pyridoxine, and none were responsive). Among patients with less severe form of PH1 (group B), five had a significant residual AGT activity (>10%) and gave a positive response to pyridoxine; two had <10% AGT activity (one responded to pyridoxine, and the test was not performed for the other). In patients with conserved renal function (group C), the behavior varied according to cases: one had residual AGT activity and an excellent response to pyridoxine, two had a very low AGT (one with and the other without a response to pyridoxine), and one had an intermediate AGT activity with a partial response to pyridoxine.
In groups A, B, and C, the mean values (±SD) of normalized AGT activity were 3.6 ± 4.5, 21.6 ± 17.6, and 14.6 ± 17.1, respectively. The median values (range) were 1 (0-10), 12 (4-50), and 7.5 (4-40), respectively.
The mean AGT value was significantly lower in group A than in the other groups (P < 0.05). All patients in group B, three of group C, and none of group A responded to the pyridoxine test. The response was associated to some residual AGT activity (except for patient 17). The mean values (±SD) of normalized AGT activity were significantly higher in patients who were responsive to pyridoxine than in the nonresponsive ones (23.1 ± 19.1 versus 3.7 ± 4.0; P = 0.005).
Mutation Typing of Italian PH1 Patients
PH1 was investigated at a molecular level by means of in vitro
amplification, SSCP analysis, and DNA sequencing. The mutations found in the
unrelated Italian PH1 patients are summarized in
Table 3. We successfully
characterized both mutant alleles in 21 patients, and only one mutation was
identified in two patients. During this study, we identified 13 different
mutations in exons 1, 2, 4, and 10, which had been partially described in a
previous report (10).
|
The most frequent mutation carried by our patients was the G630A with a gene frequency equal to 0.239. The second most frequent mutation was C156 ins (gene frequency, 0.13). The mutations G1098del, T444C, and G588A showed an 11% gene frequency. Finally, the mutations G468A and C252T were present twice in a heterozygous condition. All the others were found only in one patient in homozygous (G243A and C155del) or heterozygous condition (T576A, G640A, G244T, GaG408ins). Family studies were carried out to confirm that the parents were heterozygous for the mutations present in their offspring.
Twenty-two patients were also typed for minor and major haplotypes as well as for DS2285, D2S125, and D2S140 microsatellites, as reported in Table 3.
The G630A and T444C mutations were always inherited with the minor haplotype, which was also co-inherited with the mutations T576A in patient 1. Both patient 20 and patient 23, heterozygotes for the unknown mutations, were also heterozygous for the minus haplotypes. The overall frequency of the minor haplotype was 43.4%.
No preferential gametic association was found between AGXT mutations and polymorphisms at D2S2285, D2S125, and D2S140 loci. No significant differences were found among patients and controls for allelic and haplotype frequencies. Frequency of the allele 252 at locus D2S2285 was slightly higher in patients than in controls (0.548 versus 30.9; P = 0.047), but the opposite was true for the allele 94 at D2S125 (0.132 versus 0.357; P = 0.0386). These differences, however, were no longer statistically significant after the correction of the P values for the number of comparisons made.
Genotype-Phenotype Correlation
In group A, 75% of patients (six out of eight) were double heterozygous for
two different mutations that were carried in the majority of them (five out of
six) by two different exons. Homozygous genotypes were found only in two
patients: in patients 5 (carrying mutation G588A) and in patient 18
(homozygous for the T444C mutation). It is worth noticing that another patient
(patient 9) presented the same genotype as patient 5, but with a milder
course. Five out of six heterozygous patients carried mutation in different
exons.
In group B, 86% (six out of seven) of the patients were homozygous for AGXT mutations. Only patient 2 was double heterozygous for mutations G244T and C252T that were interestingly located in the same exon. The frequency of homozygous mutations was significantly lower (P Fisher = 0.0406) in group A than in group B. The genotype carrying both AGXT mutations affecting a single exon was significantly more frequent in group B than in group A patients (100% versus 37.5%; P Fisher = 0.0256). The age at onset of PH1 was significantly lower in nine heterozygous patients (5.8 ± 5.4 yr) than in the 14 homozygous ones (16.4 ± 14.8 yr; P = 0.025).
Microsatellite analysis showed that patients and controls were not significantly different for the homozygosity rate occurring at loci D2S2285 (52% and 38%, respectively), D2S125 (47% and 23%, respectively), and D2S140 (50% and 28%, respectively). Almost half (47.6%) of the patients and almost one third (28.6%) of the controls were homozygotes for at least two of these loci. However, when patients were subdivided according to AGXT genotype, 83% (10 of 12) of the AGXT homozygous patients and none of the AGXT heterozygous patients were also homozygous for at least two of the three linked microsatellites (P Fisher = 0.0002).
Mutations T576A, G640A, G468A, and GAG408ins were typical only in patients with the most severe form, whereas G243A, G244T, and C252T were exclusive of the mild form.
Mutations G630A, C156ins, G1098del, T444C, and G588A were distributed throughout the different groups. The allele frequencies of the AGXT mutations in groups A, B, and C are reported in Table 4. The gene frequency of T444C mutation was significantly higher in group A patients (25%) than in the group B (4.2%; P = 0.05). Instead, the G630A was significantly more frequent in groups B and C than in group A (P < 0.05). Comparing the normalized AGT activity and the AGXT mutations, a residual AGT activity >30% was found only in the five patients homozygous for the G630A mutation and never in patients with the other genotypes (P Fisher = 0.00001).
|
Worthy of notice is that mutation C155del, which belonged exclusively to patient 7 in homozygous form, dramatically changed the gene function by shifting the open reading frame and creating a stop codon after amino acid 166. What is remarkable is that this patient had a GFR of 80 ml/min at 13 yr of age and after a 9-yr follow-up.
Identical genotypes occurred in two pairs of patients: two were homozygous for the C156ins (patient 15 and patient 21) and two for the G588A (patient 5 and patient 9); despite sharing very similar residual AGT activities, response to pyridoxine and clinical course were quite different.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
With a gene frequency of 23.9%, the G630A mutation was confirmed as the most frequent in Italian patients, as previously reported in other populations (5,31). This may also explain the high frequency found in the Italian patients of the minor haplotype because of its well-known linkage disequilibrium with the G630A mutation. The C156ins ranked second, with an allele frequency of 13% (Table 4). The G630A and G1098del mutations were the only ones common to groups A, B, and C.
Although only the parents of patient 7 were consanguineous (i.e. first cousins), we observed a very high frequency of homozygous mutations. Sixty-one percent of the patients were homozygous. The microsatellite analysis confirmed that these patients were frequently homozygous for the enlarged genomic region encompassing D2S2285 and D2S140 loci.
One explanation of this phenomenon could be the small number of the analyzed sample and/or a high inbreeding rate in the populations to which these families belong. Most of these patients had been re-rooted to us from different Italian centers, and the information on their origin seems to exclude their belonging to close genetic isolates. Haplotype analysis failed to show a founder effect for Italian PH1 patients, in fact no preferential microsatellite haplotypes were found for the AGXT mutations.
The most frequent mutation (G630A) had a reported 10% homozygous rate (32), which became 22% in our study. Nevertheless, rare mutations have already been described in the literature only in homozygous form (15,33). Therefore, to assess the validity of our results, excluding a recently reported rare deletion (22), we checked the patients' parents and relatives in 10 families. This analysis confirmed that they were heterozygous for the mutation carried by patients.
The great molecular heterogeneity of PH1 may be the reason why it is so difficult to correlate phenotype, biochemistry, and residual AGT activity to clinical severity. There are also other factors, not of genetic origin, that might influence the clinical course of the disease, including diet, infections, and climate. Moreover, there are other genetic factors that might control the catalytic activity and the subcellular targeting of glyoxylate metabolism (D-amino acid oxidase, glycolate oxidase, GGT, GR, LDH) (33,34,35).
Early recognition with a thorough diagnostic work-up, close medical follow-up, and effective prevention of stone events can influence the outcome of PH1 (36). Patients with adult form (group B) had unfortunately been found to be affected late in the course of the disease. All those who could be tested for pyridoxine exhibited a clear-cut response to this drug, and it seems particularly reasonable to hypothesize that if PH1 is managed early enough and adequately, it would avoid progression to end-stage renal disease for many.
Within the same mutation, the progression itself can manifest quite differently, as, for example, happened in patient 5 of group A and patient 9 of group C, who had quite different progressions despite the same genotype (G588A/G588A) and quite similar amounts of residual AGT. It is tempting to suggest that this occurred in patient 5, who progressed rapidly to ESRF, because he was diagnosed late after the onset of renal insufficiency and had virtually no medical follow-up. Instead, in patient 9, in whom renal function was preserved until the age of 22, the disease had been recognized at an early stage and had been treated with medications, including long-term follow-ups, pyridoxine supplementation, potassium citrate, and high fluid intake.
This contention actually applies to some of the patients in group C (patient 4 and patient 22) who, despite having neither residual AGT nor response to pyridoxine, were doing fairly well, and their renal function was preserved over a >15-yr follow-up.
It will also be of interest to compare the long-term outcomes under medical management of the three patients aged <20 yr, presenting different genotypes, residual AGT, and response to pyridoxine. For instance, will patient 15 progress to ESRF in a way that is similar to patient 21 because they had the same genotype?
The highest values of catalytic activity were found in patients with the G630A mutation, which causes a Gly 170Arg substitution that, if combined with the C154T polymorphism (Pro1 1Leu substitution), is responsible for the mistargeting of the AGT enzyme from the peroxisomes to the mitochondria, where the enzyme cannot work properly (9).
The preservation of residual activity with less severe clinical
manifestations, in the patients with very early protein truncation, may depend
on the mechanism of skipping constitutive exons. Nonsense mutations are
supposed to either reduce the amount of mutant allele transcripts (because of
the process of nonsense-mediated mRNA decay) or to generate a peptide
truncation at the carboxyl end. A mature mRNA deleted in the entire exon
carrying the mutation but in frame was observed in several mutant genes (such
as fibrillin gene, ornithine 
-aminotransferase, coagulation factor VIII
gene, ß-globin gene, and distrophin gene)
(37,38,39).
The RNA messenger lacking exon(s) containing the nonsense codon normally
terminate the translation and are more stable than the properly spliced mRNA
with the nonsense codon.
Our studies suggest that this phenomenon may occur in the case of frame-shift mutations that cause a termination codon, such as the C155del, C156ins, and G1098del. The homozygous condition for these mutations could be responsible for a smaller but functional protein, which leads to milder clinical manifestations. We could hypothesize that the clinical symptoms appear to be more severe when a mutated subunit protein dimerizes with a subunit that bears a different mutation, especially when codified by a different exon. However, other studies, such as mRNA length experiments, should be conducted to support such a statement.
Several molecular aspects of PH1 are still unresolved, including the high degree of homozygous mutations and the mechanisms responsible for reduced catalytic activity of the enzyme. This study allowed us to identify the AGXT mutations that appeared in the majority of analyzed patients, thereby providing a targeted prenatal diagnosis using DNA analysis in chorionic biopsies or amniotic fluid. This approach eliminates the need for linkage analysis with polymorphic markers, both intragenic or located near the gene (40,41). A better understanding of the molecular basis of PH1 and its impact on phenotypic presentation could be achieved by the creation of a European Registry designed to collect data from several centers. It is reasonable to foresee that this will improve the clinical management of PH1 patients, the diagnostic tools, and medical intervention.
|
Acknowledgments |
|---|
We are indebted to the following Italian Nephrology Centers that referred PH1 patients: Ospedale Regionale, Aosta; Regina Margherita and San Giovanni Battista, Torino; Gaslini, Genova; University Hospital, Padova; Provinciale, Trento; Pediatric Division, Bambin Gesù, Roma; Ospedale Acquaviva delle Fonti; Ospedale dei Bambini G. di Cristina, Palermo; Regina Margherita, Messina.
The authors are greatly indebted to Nicole Bolzicco for her collaboration in the preparation of this manuscript and for the linguistic reviews.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  C. G. Monico, S. Rossetti, H. A. Schwanz, J. B. Olson, P. A. Lundquist, D. B. Dawson, P. C. Harris, and D. S. Milliner Comprehensive Mutation Screening in 55 Probands with Type 1 Primary Hyperoxaluria Shows Feasibility of a Gene-Based Diagnosis J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1905 - 1914. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Biolo, A. Amoroso, S. Savoldi, A. Bosutti, M. Martone, D. Pirulli, F. Bianco, S. Ulivi, S. Bertok, M. Artero, et al. Association of interferon-{gamma} +874A polymorphism with reduced long-term inflammatory response in haemodialysis patients Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1317 - 1322. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
