 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
,
,
*
Renal Cell Biology Laboratory, Division of Nephrology, University of Miami
School of Medicine, Miami, Florida.
Division of Endocrinology, Diabetes and Metabolism, University of Miami
School of Medicine, Miami, Florida.
Vascular Biology Institute, University of Miami School of Medicine, Miami,
Florida.
Correspondence to Dr. Michael Karl, University of Miami School of Medicine, P.O. Box 016960 (R126), Miami, FL 33101. Phone: 305-243-2811; Fax: 305-243-2810; E-mail: mkarl{at}med.miami.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
ERß. Both ER subtypes were expressed in human and mouse MC. Using an
estrogen-responsive reporter construct in transfection assays, it also was
demonstrated that the nuclear ER were transcriptionally active. In the
presence of 17ß-estradiol (E2; 10-10 to
10-8 M), there was a progressive increase in the mRNA levels of
both ER (approximately 1.8-fold and approximately 2.7-fold after 24 and
72 h, respectively) and ERß (approximately 1.3-fold and approximately
2.2-fold after 24 and 72 h, respectively). ER protein levels increased
approximately 2.5-fold after 24 h (10-10 M, E2) and up
to approximately 5.4-fold after 72 h (10-9 M, E2).
ERß protein levels increased approximately 2.1-fold in the presence of
E2 (10-9 M) after 24 h. Thus, estrogens positively
regulate the expression of the ER subtypes, thereby maintaining or increasing
MC responsiveness to estrogens. Because diabetic glomerulosclerosis may be due
partly to a decrease in ECM degradation, the effects of estrogens on matrix
metalloproteinases (MMP) were studied. It was found that E2
(10-10 to 10-8 M) increased both MMP-9 mRNA and MMP-9
activity in MC. This may be an important mechanism by which estrogens
influence ECM turnover and protect against progression of diabetic
glomerulosclerosis. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The United States Renal Data System data reveal that women in the premenopausal age range have a lower incidence of end-stage renal disease (ESRD) caused by diabetic nephropathy than do men (4). After menopause, there is a sharp increase in the incidence of ESRD caused by diabetic nephropathy, especially in women from ethnic minority groups (4). For instance, the women:men ESRD incident ratio nearly doubles in African Americans (0.8 in the 35- to 39-yr age group compared with 1.5 in the 65- to 69-yr cohort). However, the female preponderance in ESRD caused by diabetic nephropathy after menopause cannot be explained by an increased incidence of diabetes in postmenopausal women compared with age-matched men. A large prospective study that examined the risk to develop type 2 diabetes mellitus in African American and Caucasian adults aged 45 to 64 yr over a 9-yr period showed a nearly equal incidence per 1000 person-years of 25.1 in African American women versus 23.4 in African American men (female:male ratio, 1.07) (5). In Caucasian study participants, there was even a male predominance in developing type 2 diabetes mellitus with a 0.67 female:male incident ratio. Thus, although other mechanisms may be invoked, estrogen status may play an important role in the protection or potentiation of progressive glomerulosclerosis. In fact, estrogens have been shown to inhibit transforming growth factor-ß—mediated type IV collagen and to suppress type I collagen expression via activation of activator protein-1 (AP-1) in MC (6,7). Thus, estrogens could decrease the synthesis of ECM components, resulting in decreased accumulation of ECM in the glomerulus. Estrogens could also decrease ECM accumulation by increasing degradation of ECM by MMP. However, this has not been studied in MC.
There are two estrogen receptor (ER) subtypes, ER and ERß, that
belong to the superfamily of nuclear receptors
(8,9,10,11),
which mediate the effects of estrogens. Interestingly, both ER subtypes
and ß, as well as ER splice variants, have been previously
identified in vascular smooth muscle cells including those from the aorta and
coronary vessels
(12,13,14,15,16,17,18),
where the direct actions of estrogens contribute substantially to their
cardiovascular protective effects
(19). ER subtypes and their
regulation and biologic effects have not been reported in MC. Thus, in this
study, we investigated ER expression and regulation. We also studied the
effect of estrogens on MMP expression and activity in MC. MC expressed both ER
subtypes ER and ERß, and estrogens regulated their expression.
Estrogens and anti-estrogens also regulated the expression of the MMP-9 in MC.
These findings may have important pathophysiologic implications for sclerosing
glomerular diseases, such as diabetic nephropathy.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-smooth muscle actin, and
ß-galactosidase substrate were purchased from Sigma (St. Louis, MO). ICI
182,780 (ICI) was obtained from Tocris (Ballwin, MO). First Strand cDNA
Synthesis Kit for reverse transcription-PCR (RT-PCR) (AMV) and Taq
polymerase were purchased from Boehringer Mannheim (Indianapolis, IN). For
Western analysis, protein concentrations were measured by using the Pierce BCA
Assay from Bio-Rad Laboratories (Hercules, CA). Prestained molecular weight
markers were purchased from Bio-Rad Laboratories. ER antibodies and their
respective blocking peptides were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). The ER antibody MC-20 is a rabbit polyclonal antibody
raised against a peptide mapping at the carboxy terminus of the ER of
mouse origin. The ER antibody H-184 is a rabbit polyclonal antibody
raised against a recombinant protein corresponding to amino acid 2 to 185
mapping at the amino terminus of ER of human origin. The two ER
antibodies recognize both mouse and human ER protein. N-19, the
antibody against human ER, is a goat polyclonal antibody raised against
a peptide mapping at the amino terminus of the ERß of human origin. Y-19,
the antibody against mouse ERß, is a goat polyclonal antibody raised
against a peptide mapping at the amino terminus of the ERß of mouse
origin. Protein A-Agarose and chemiluminescence detection system were
purchased from Santa Cruz Biotechnology. ER and ERß human
recombinant peptide were purchased from Panvera (Madison, WI). Nitrocellulose
membranes (Hybond ECL) and films (Hyperfilm ECL) for chemiluminescence
detection were purchased from Amersham Pharmacia Biotech (Buckinghamshire,
England). For the transfection studies, TransFast and lysis buffer were
purchased from Promega (Madison, WI). Zymography gels were purchased from
NOVEX (San Diego, CA).
Cell Culture
Human MC were obtained from microdissected glomeruli of kidneys not
suitable for transplantation. Mesangial-like glomerular outgrowths were
patch-cloned, propagated, and grown in Waymouth's medium supplemented with 20%
FBS, 1 mM L-glutamine, 100 µg/ml penicillin/streptomycin, and 0.075%
Na2HCO3. Human MC were characterized by their stellate
morphology and staining pattern, including positivity for -smooth
muscle actin (20). Experiments
were performed using cells between passages 3 and 6.
MC from C57BL/6J female mice used for these experiments have been previously described (21). Cells were used between passages 19 and 26. Previous experiments have shown that the cells retain their phenotype at the passages studied. Murine MC were routinely cultured in Dulbecco's modified Eagle's medium/F12 (3/1 vol/vol), supplemented with 20% FBS.
Cell Culture Conditions
To characterize initially the presence of ER in MC, we performed
experiments on human and murine MC maintained in culture medium supplemented
with 20% FBS. For the purpose of examining ER regulation, cells were
transferred into phenol-red free medium supplemented with charcoal-stripped
FBS, because a lipophilic impurity contained in the phenol red has been
described as a weak estrogen agonist
(22).
Cells were cultured in phenol red-free medium supplemented with 20% charcoal-stripped FBS in the presence of increasing concentrations of E2 (10-10 M to 10-8 M) for 5 d. Cell number was evaluated every 2 d with a Coulter cell counter (Hialeah, FL) and was not affected by the presence of E2 (data not shown).
To examine the regulation of ER mRNA and protein in the absence of estrogens and growth factors, we plated cells in six-well plates and maintained them in phenol red-free medium supplemented with 20% charcoal-stripped FBS. When cells were plated, cell number was adjusted according to the different conditions to obtain a similar high cell density at collection (day 1 and day 3).
To assess the functionality of endogenous ER, we performed transfection experiments. For this purpose, cells were plated, as described previously, and medium was replaced by phenol red-free medium supplemented with 0.1% charcoal-stripped FBS.
To assess the regulation of ER mRNA and protein expression, as well as the regulation of MMP-9 expression and activity by E2, we grew mouse MC initially for 3 d in phenol red-free medium supplemented with 20% charcoal-stripped FBS in six-well plates. The medium was replaced with phenol red-free medium supplemented with 0.1% charcoal-stripped FBS and increasing concentrations of E2 (10-10 M to 10-8 M) for 24 and 72 h. Confluent cells were harvested for RNA and/or protein collection while the supernatants were used to measure MMP-9 activity. All experiments were performed in triplicate.
Isolation of mRNA and RT-PCR
Total RNA was extracted from confluent cell cultures using the guanidium
thiocyanate-phenol-chloroform method (Tri-Reagent)
(23). RT was performed on 2
µg of total RNA in a total volume of 20 µl. After the total volume was
adjusted to 100 µl with diethyl pyrocarbonate water, 2 µl of the cDNA
solution was used as a template for the PCR. PCR amplifications were performed
in a total volume of 50 µl with 1.5 U of Taq polymerase. The
specificity of each reaction was monitored in control reactions, where
amplifications were carried out on samples after omission of RT.
Amplifications of human ER subtypes and ß in human MC were
performed using specific primer pairs previously described by Enmark et
al. (10), which resulted
in amplicons of 344 bp and 392 bp length, respectively.
To investigate whether murine MC express ER variants, we used a
series of primers to amplify several overlapping segments spanning the entire
coding regions of the murine wild-type ER cDNA, as described previously
(24). The forward primers were
located in exons 1, 2, 4, and 6, whereas the reverse primers were located in
exons 5, 7, and 8.
To assess ER mRNA expression, we amplified a 408-bp cDNA fragment of
the mouse ER using forward primer TCCTAACTTGCTCCTGGACAGG located at
nucleotides 1417 to 1438 and reverse primer CAGGAGCAGGTCATAGAGGGG at
nucleotides 1825 to 1805 (nucleotides are numbered according to the sequence
published by White et al.
(9)). Restriction enzyme
analysis was used to confirm the correct sequence of the amplicons (data not
shown). To amplify a specific 409-bp amplicon of mouse ERß, we used to
primers located at nucleotide positions 142 to 163 and 551 to 529. Nested PCR
was used to confirm the correct sequence
(25,26).
MMP-9 and glyceraldehyde phosphate dehydrogenase (GAPDH) primer pairs were
used as described previously
(3), which resulted in PCR
products of 414 bp and 561 bp length, respectively. PCR products were
separated on 2% agarose gels containing 0.05% ethidium bromide gels and were
photographed using an Alpha Innotech Digital Imaging System (San Leandro, CA).
Analysis was performed using computer-aided densitometry (NIH image, NCBI,
NIH, Bethesda, MD). To determine the PCR assay range, we plotted the number of
PCR cycles against the integrated density obtained from the densitometry
analysis. GAPDH was used as an internal standard and housekeeping gene. PCR
data obtained for ER, ERß, and MMP-9 were normalized to GAPDH
signals as described previously
(3). The samples from at least
three different experiments were run in duplicate.
Western Blots
Confluent cell layers were washed once in phosphate-buffered saline (PBS)
and collected in the presence of lysis buffer. Cell homogenates were
centrifuged 30 min at 15,000 x g at 4°C. Supernatants were
collected and protein concentrations were measured. For ERß protein
analysis, samples were immunoprecipitated using the human or mouse ERß
antisera, respectively. Briefly, 150 µg of protein was incubated overnight
with the antiserum and protein A-agarose. The immunoprecipitates were washed
four times in PBS and resuspended in 40 µl of PBS. To analyze ER
protein, we processed protein homogenates without previous
immunoprecipitation. All samples were then diluted in Laemmli buffer and
boiled. Equal amounts of protein or immunoprecipitates from each experimental
condition were run on a 10% polyacrylamide gel. Prestained markers were
electrophoresed in parallel to estimate molecular weight. Electrotransfer of
proteins from the gel to the nitrocellulose was performed by electroelution
(27). Immunoblotting was
performed with either human or mouse ER and ERß antisera, and
immunoreactive bands were determined by exposing the nitrocellulose blots to a
chemiluminescence solution followed by exposure to a Hyperfilm ECL film.
Control experiments were performed in the presence of ER and ERß
human recombinant peptides as positive controls, whereas specificity of the
signal was demonstrated by incubating blots with an excess of the
corresponding specific immunizing peptide.
Transfection and Luciferase Assays
Before transfection, mouse MC were transferred into 24-well plates and
cultured 4 d in phenol-red free medium supplemented with 20% charcoal-stripped
FBS. Subsequently, MC were transfected with the reporter construct,
pVitA2-ERE-TKLuc (0.25 µg/well) using Trans-Fast, according to the
manufacturer's recommendations. VitA2-ERE-TKLuc contains one copy of the
Xenopus vitellogenin estrogen responsive element (ERE) proximal to the
thymidine kinase promoter, which drives the expression of the luciferase
reporter gene in an estrogen-dependent manner. The vector pTKLuc, which does
not contain an ERE, served as a control. To adjust for transfection
efficiency, MC were cotransfected with pRSV-ßgal (0.25 µg/well), a
vector that constitutively expresses the ß-galactosidase gene. The
constructs were a generous gift from Drs. G. Tremblay and V. Giguere
(11). One h later, phenol
red-free medium supplemented with 10% charcoal-stripped FBS was added to the
transfected cells. Cells were incubated for an additional 24 h in the presence
of 10-8 M E2 or vehicle (ethanol). The final ethanol
concentration was 0.001% in both conditions. For luciferase and galactosidase
assays, cells were lysed in 100 µl of Reporter Lysis buffer at room
temperature. Light emission was detected using a luminometer (AutoLumat,
Wallac, Gaithersburg, MD) after addition of luciferin to 40 µl of cell
lysate. Values were expressed as arbitrary light units normalized to the
ß-galactosidase activity of each sample.
MMP-9 Activity
The cell supernatants were collected 24 and 72 h after treatment. At the
time of medium collection, the cells were counted for the purpose of adjusting
the volume of the medium to the cell number. MMP-9 activity was assessed using
10% zymogram gels as described previously
(28). Briefly, the medium was
diluted to normalize for cell number (approximately 25,000 cells/ml), before
the addition of 5X Laemmli buffer under nonreducing conditions. After
electrophoresis, gels were washed for 1 h in 2.5% Triton X-100 and incubated
40 h in 50 mM Tris buffer. The gels were stained with Coomassie Blue and
air-dried. Densitometry, using NIH image 1.6, was used to analyze relative
MMP-9 activity.
Statistical Analyses
All experiments were performed at least in triplicate. Data are expressed
as percentage of control. Shown are means ± SEM of three or four
independent experiments. One-way ANOVA and Dunnett's multiple comparison
post hoc test were performed. For transfection experiments, values
are expressed as arbitrary light units, normalized to the ß-galactosidase
activity of each sample.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß in Human MC and ERß transcripts (shown are
representative 344-bp and 392-bp amplicons of human ER and ERß
mRNA; Figure 1A). The
expression of ER and ERß protein was studied by Western blot
analysis. Using ER and ERß antisera, we detected signals at
approximately 66 and approximately 53 kD, respectively
(Figure 1B). The estimated
molecular weight of these bands corresponds to the size predicted for the
wild-type human ER and ERß
(8,10).
Recombinant human ER and ERß peptides served as positive controls
(lanes 1 and 4). Preincubation of the ER antisera with their respective
immunizing peptides completely abrogated these signals, confirming that the
detected bands were ER and ERß, respectively (data not shown).
Thus, human MC express both ER subtypes ER and ERß.
|
Expression of ER and ERß in Mouse MC
The expression of ER was examined by RT-PCR and Western blot analysis in MC
isolated from the glomeruli of C57BL/6J female mice. Representative amplicons
of 408 bp and 409 bp length corresponding to mouse ER and ERß
transcripts
(9,11),
respectively, are shown (Figure
2A). To exclude the presence of ER variants, which
originate from alternatively spliced ER transcripts, we amplified the entire
coding region of ER using specific primer pairs. Because all of the PCR
products were of the predicted sizes, we concluded that there was no evidence
of the expression of alternatively spliced mouse ER mRNA transcripts
(data not shown). The expression of mouse ER (approximately 67 kD) and
ERß (approximately 55 kD) protein was confirmed by Western blot analysis
(Figure 2B). The corresponding
signals were abrogated by preincubation with the respective immunizing peptide
(data not shown). Human recombinant ER (66 kD) and ERß (53 kD)
peptides served as positive controls. In summary, human and mouse MC expressed
both ER subtypes at the mRNA and protein level.
|
Transcriptional Activity of the ER in Mouse MC
To test the ability of endogenous ER to modulate the transcriptional
activity of an ERE-containing promoter, we transfected mouse MC with the
reporter construct pVitA2-ERE-TKLuc (a generous gift from Drs. Tremblay and
Giguere, Montreal, Canada)
(11). In the transfected MC,
E2 (10-8 M) induced approximately a twofold increase in
luciferase activity (Figure 3).
This demonstrates that the endogenous ER maintain their function as
ligand-regulated transcription factors in MC.
|
Regulation of ER and ERß mRNA Expression by Culture
Conditions in Mouse MC
Estrogens previously have been shown to regulate the levels of both ER
subtype mRNA in reproductive tissues
(29,30,31);
however, little is known about the regulation of ER in vascular smooth muscle
cells. We investigated whether E2 modulates ER and ERß
mRNA in MC. Mouse MC were transferred into phenol red-free medium supplemented
with 20% charcoalstripped FBS to minimize the concentrations of compounds that
may activate ER (32). After 1
or 3 d in this medium, levels of ER and ERß mRNA changed but not
in a coordinate manner (ER mRNA were normalized to GAPDH mRNA levels)
(Figure 4A). Namely, there was
a decrease in ER mRNA levels, whereas ERß mRNA levels increased.
However, the changes were not of the same magnitude. ER mRNA decreased
to a level of 46.9 ± 8.1% (P < 0.01) after 1 d, and this
decrease persisted until day 3. The ERß mRNA levels were increased at day
1 and continued to increase to reach a maximum at day 3 (268.1 ± 41.3%;
P < 0.01; Figure
4B).
|
In summary, these studies demonstrate that when MC were transferred from
regular medium into phenol red-free medium supplemented with charcoal-stripped
FBS, ER and ERß mRNA levels changed in opposite directions.
Regulation of ER and ERß Protein Expression by Culture
Conditions in Mouse MC
Estrogens have been shown to accelerate ER protein turnover in a pituitary
lactotrope cell line by a proteasome-mediated process, which in turn affects
ER protein levels (33). There
was approximately a 1.6-fold increase in ER protein
(Figure 5A) and approximately a
3.5-fold increase in ERß protein levels
(Figure 5B) in MC after 3 d of
culture in phenol red-free medium supplemented with 20% charcoal-stripped FBS.
Thus, the levels of ER protein and the levels of ER mRNA are
discordant in MC under these culture conditions. Namely, ER mRNA
decreased and ER protein increased, whereas both ERß mRNA and
ERß protein increased.
|
Regulation of ER and ERß mRNA Expression by Estrogens in
Mouse MC
After 3 d in culture, E2 (10-10 to 10-8 M)
was added. There was a progressive increase in both ER and ERß
mRNA levels. ER mRNA levels were approximately 1.8-fold higher (183.8
± 27.0%) compared with baseline conditions after 24 h and increased to
approximately 2.7-fold (276.4 ± 43.0%; P < 0.01) after 72 h
in the presence of 10-9 M E2
(Figure 6A).
|
The increase in ERß mRNA levels peaked at 10-9 M E2. The ERß mRNA levels were approximately 1.3-fold higher (127.4 ± 14.5%) at 24 h, and there was approximately a 2.1-fold (211.8 ± 50.0%; P < 0.05) increase at 72 h (Figure 6B).
In summary, in the presence of physiologic concentrations of E2, the mRNA levels of both ER subtypes increased in MC cultured in phenol red-free medium supplemented with charcoal-stripped serum.
Regulation of ER and ERß Protein Expression by Estrogens
in Mouse MC
E2 (10-10 to 10-8 M) was added to MC after
3 d of culture in phenol red-free medium supplemented with 20%
charcoalstripped FBS. There was an increase in the protein level of both ER
subtypes. The maximal increase in ER protein level (approximately
5.4-fold) was seen at 10-9 M E2 (P < 0.05)
at 72 h (Figure 7A). ERß
protein levels increased approximately 2.1-fold in the presence of
10-9 M of E2 (P < 0.05) after 24 h
(Figure 7B). It is interesting
to note that the ERß protein levels after 72 h were 2.3-fold higher than
in the cells at 24 h.
|
In summary, this demonstrates that estrogens affect the ER protein levels in MC and may maintain or even increase estrogen responsiveness in this cell type.
MMP-9 mRNA Expression and MMP-9 Activity by Estrogens and
Antiestrogens in Mouse MC
The levels of MMP-9 mRNA increased after 24 h in the presence of
E2 (10-10 to 10-8 M) in cells that had been
cultured 3 d in phenol red-free medium supplemented with 20% charcoal-stripped
FBS. The maximal MMP-9 mRNA increase was approximately 1.7-fold (175.4
± 25.0% of control; P < 0.01) in the presence of
10-8 M E2 after 24 h (MMP-9 mRNA was normalized to GAPDH
mRNA). No changes in MMP-9 mRNA levels were observed after 72 h
(Figure 8A). MMP-9 activity
also changed markedly after treatment with E2. There was
approximately a 3.3-fold increase (328.4 ± 73.4% of control; P
< 0.05) in MMP-9 activity after 24 h of treatment with 10-8 M
E2 (Figure 8B).
After 72 h, there was approximately a 2.4-fold increase (238.3 ± 37.5%
of control; P < 0.05) in MMP-9 activity in the presence of
10-8 M E2 (data not shown). These changes were abolished
in the presence of the selective estrogen receptor modulator tamoxifen or the
ER antagonist ICI 182,780 (Figure
9). Tamoxifen (10-6 M) and ICI (10-6 M)
blocked the E2-induced increase in MMP-9 activity in the mouse MC
(60.1 ± 15.4% and 59.9 ± 10.4% of control, respectively) during
a 24-h incubation period. Neither of these inhibitors significantly affected
baseline MMP-9 activity (126.7 ± 27.45% and 75.7 ± 26.7%,
respectively). These studies demonstrate that E2 upregulates MMP-9
expression in mouse MC.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we identified the two known nuclear ER subtypes, ER
and ERß, in both human and mouse MC
(8,9,10,11).
We detected the expression of the two ER subtypes at the mRNA level by RT-PCR
and confirmed translation into their respective proteins by Western blot
analysis. Using an estrogen-responsive reporter construct, we demonstrated
further that the nuclear ER were transcriptionally active in MC. Thus, MC
expressed functional ER and were able to respond to stimulation by estrogens.
This also suggested that MC represent another nonreproductive target cell for
estrogens. Furthermore, MC, similar to the findings in arterial vascular
smooth muscle cells, expressed both ER subtypes ER and ERß
(12,13,14,15,16,17,18).
It is interesting to note that in experiments with ER or ERß
knockout mice, the expression of one of the ER subtypes provided protection in
a model of arterial vascular injury
(34,35).
This suggested some degree of redundancy in ER and ERß function in
arterial vascular smooth muscle cells.
Nonetheless, this functional redundancy may be restricted to specific vascular sites and may not apply to MC.
The modulation of ER by estrogens has been studied extensively in reproductive organs and breast cancer cells. Estrogens either up- or downregulated ER expression, depending on the cell type or cell line (29,31,36). There have been no reports on the regulation of ER subtype expression in MC, and little is known about ER regulation in vascular smooth muscle cells from other vascular beds.
We found that cell culture conditions have a substantial impact on ER
levels. The culture conditions that we chose consisted of phenol red-free
medium supplemented with charcoal-stripped FBS, a condition generally accepted
for studying steroid hormone effects. Phenol red-free medium was selected
because phenol red supplements may contain lipophilic impurities, which have
weak estrogen agonist activity
(22). Charcoal treatment
removes steroid hormones and numerous other substances, including growth
factors
(32,37).
After transfer of MC into phenol red-free medium supplemented with
charcoal-stripped FBS, there were changes in the ER subtype mRNA levels.
ER mRNA levels decreased after 1 d, and this decrease persisted until
day 3, whereas ERß mRNA increased and reached a maximum after 72 h. Thus,
charcoal treatment had discordant effects on the regulation of ER subtype
transcription. This observation also suggested that the regulatory regions of
the genes for the two ER subtypes may differ in their organization, given that
the transcription of the ER subtypes was either decreased (ER) or
increased (ERß) when phenol red was removed from the basal medium in the
presence of charcoal-stripped serum. After incubation in
E2-containing medium for 24 or 72 h, we observed an increase in
mRNA and protein levels of both ER subtypes at physiologic estrogen
concentrations. Thus, the increase in ER protein synthesis seems to be only
partially offset by accelerated ER protein turnover, a proteolytic process
that occurs rapidly in the presence of E2
(33). These findings provide
evidence that the levels of ER protein are sustained or increased in MC in the
presence of estrogens. Thus, lack of estrogen for an extended time period, as
in menopause, may decrease the capacity to mount an estrogen response. It
should be noted that the MC used in these experiments were isolated from
young, thus "premenopausal," female C57BL/6J mice
(21).
The increased incidence of ESRD caused by diabetic nephropathy in
postmenopausal women from ethnic minority groups suggests that the
accumulation of ECM is accelerated in estrogen deficiency states
(4). Because MMP play an
important role in ECM turnover, they may be an important mesangial target gene
for estrogens (3). Increased
MMP levels contribute to ECM degradation, which could have a protective role
in progressive glomerulosclerosis. MMP-2 and MMP-9 belong to a subgroup of
matrix-degrading enzymes that exhibit high activity against gelatin and native
type IV collagen
(3,38).
In the present study, we focused on MMP-9. We found that E2 induced
MMP-9 mRNA expression and activity in a dose-dependent manner. Tamoxifen, a
selective estrogen receptor modulator, and the anti-estrogen ICI 182,780
blocked estrogen-induced MMP-9 activity, suggesting that these effects were ER
mediated. The molecular mechanisms by which estrogens regulate MMP-9
transcription in MC are unknown. The MMP-9 promoter does not have a consensus
ERE but contains several other important regulatory elements, including three
GC boxes, four AP-1 like binding sites, an AP-2 site, and three PEA3 consensus
sequences, as well as a nuclear factor-
B (NF-B) binding site
(39). Several of these
transcription factors, including the AP-1 complex or NF-B, have been
shown to interact with ER
(40). Importantly, at AP-1
binding sites, the two ER subtypes ER and ERß signal in opposite
directions upon ligation with E2 in vitro
(41). Whereas E2
stimulation of ER increases the transcriptional process, activation of
ERß by its natural ligand downregulates gene transcription at an AP-1
site. The expression of both ER subtypes and the potential of ER and
ERß to form heterodimers, combined with the presence of four AP-1 binding
sites in the 5'-flanking region, add several layers of complexity to the
regulation of MMP-9 expression
(39,42).
In addition, ER have also been shown to interact with NF-B, a
transcription factor that is important in inflammatory processes
(43). The complexity of the
MMP promoter region may allow precise regulation of MMP-9 expression.
The present data suggest that one mechanism, by which estrogens contribute to the protection from ESRD caused by diabetic nephropathy in premenopausal women, is increased MMP-9 expression in MC. In addition, the data may inject a note of caution in the use of tamoxifen in postmenopausal women with diabetic glomerulosclerosis, because tamoxifen blocked upregulation of MMP-9 expression by estrogens.
In summary, we found that both ER subtypes were expressed in MC and that estrogens positively regulated their transcription and translation. Thus, estrogens maintain or increase the estrogen responsiveness in MC. We found that estrogens upregulated MMP-9 expression and activity in MC. This may be an important mechanism by which estrogens influence ECM turnover and exert their protective effect on the progression of diabetic glomerulosclerosis.
|
Acknowledgments |
|---|
This work was supported by a grant from the National Institutes of Health (NIH/NIA R01, AG17170-01 to L.J.S.).
M.K. is a recipient of a Career Development Award of the American Diabetes Association (ADA). M.P. is a recipient of a Postdoctoral Fellowship of the American Heart Association (AHA).
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 type IV collagen gene transcription is mediated by TGF-ß and
inhibited by estradiol. Am J Physiol274
: F252-F258,1998 mRNA variants in murine and human tissues.
Mol Cell Endocrinol 158:153
-161, 1999[Medline]
(ER)- and ERß-expressing GT1-7 GnRH neurons.
Endocrinology 140:5045
-5053, 1999 and ß messenger ribonucleic acids in adult gonadotropin-releasing
hormone neurons. Endocrinology140
: 5195-5201,1999-deficient mice. Nat
Med 3: 545-548,1997[Medline]
B and AP-1 activity in a
cell- specific manner. J Steroid Biochem Mol Biol67
: 79-88,1998[Medline]
and
ERß at AP1 sites. Science277
: 1508-1510,1997. Mol Endocrinol11
: 1486-1496,1997 B and steroid
receptor-signaling pathways. Endocr Rev20
: 435-459,1999This article has been cited by other articles:
 |
|
 |
|
  M. K. Glassberg, S. J. Elliot, J. Fritz, P. Catanuto, M. Potier, R. Donahue, W. Stetler-Stevenson, and M. Karl Activation of the Estrogen Receptor Contributes to the Progression of Pulmonary Lymphangioleiomyomatosis via Matrix Metalloproteinase-Induced Cell Invasiveness J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1625 - 1633. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. Yanes, J. C. Sartori-Valinotti, and J. F. Reckelhoff Sex Steroids and Renal Disease: Lessons From Animal Studies Hypertension, April 1, 2008; 51(4): 976 - 981. [Full Text] [PDF]
|
|
|
|
 |
|
 A. Dixon and C. Maric 17beta-Estradiol attenuates diabetic kidney disease by regulating extracellular matrix and transforming growth factor-beta protein expression and signaling Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1678 - F1690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Mankhey, C. C. Wells, F. Bhatti, and C. Maric 17beta-Estradiol supplementation reduces tubulointerstitial fibrosis by increasing MMP activity in the diabetic kidney Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R769 - R777. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Karl, M. Berho, J. Pignac-Kobinger, G. E. Striker, and S. J. Elliot Differential Effects of Continuous and Intermittent 17{beta}-Estradiol Replacement and Tamoxifen Therapy on the Prevention of Glomerulosclerosis: Modulation of the Mesangial Cell Phenotype in Vivo Am. J. Pathol., August 1, 2006; 169(2): 351 - 361. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Elliot, P. Catanuto, W. Stetler-Stevenson, and S. W. Cousins Retinal Pigment Epithelium Protection from Oxidant-Mediated Loss of MMP-2 Activation Requires Both MMP-14 and TIMP-2. Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1696 - 1702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney Hypertension, October 1, 2005; 46(4): 787 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chin, M. Isono, K. Isshiki, S.-i. Araki, T. Sugimoto, B. Guo, H. Sato, M. Haneda, A. Kashiwagi, and D. Koya Estrogen and Raloxifene, a Selective Estrogen Receptor Modulator, Ameliorate Renal Damage in db/db Mice Am. J. Pathol., June 1, 2005; 166(6): 1629 - 1636. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Karl, M. Potier, I. H. Schulman, A. Rivera, H. Werner, A. Fornoni, and S. J. Elliot Autocrine Activation of the Local Insulin-Like Growth Factor I System Is Up-Regulated by Estrogen Receptor (ER)-Independent Estrogen Actions and Accounts for Decreased ER Expression in Type 2 Diabetic Mesangial Cells Endocrinology, February 1, 2005; 146(2): 889 - 900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Mankhey, F. Bhatti, and C. Maric 17{beta}-Estradiol replacement improves renal function and pathology associated with diabetic nephropathy Am J Physiol Renal Physiol, February 1, 2005; 288(2): F399 - F405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.-J. Shim, L. L. Kis, M. Warner, and J.-A. Gustafsson Autoimmune glomerulonephritis with spontaneous formation of splenic germinal centers in mice lacking the estrogen receptor alpha gene PNAS, February 10, 2004; 101(6): 1720 - 1724. [Abstract] [Full Text] [PDF]
|
|
|
|
) and 72 h (
). Data are expressed as
percentage of control (V, vehicle = 0.001% EtOH) at 24 h, and shown are means
± SEM of three independent experiments. Statistical significance is
indicated by ** (P < 0.01) and * (P
< 0.05) for comparison with 24-h baseline (V, 
