 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Division of Nephrology and Hypertension, Department of Clinical Research,
Berne, Switzerland.
Institute of Pathology, University of Berne, Berne,
Switzerland.
Correspondence to Dr. Alex Odermatt, Division of Nephrology and Hypertension, Department of Clinical Research, University of Berne, Freiburgstrasse 15, 3010 Berne, Switzerland. Phone: 41 31 632 9438; Fax: 41 31 632 9444; E-mail: alex.odermatt{at}dkf2.unibe.ch
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Phage-display peptide libraries have been applied successfully to identify peptide-binding domains on purified proteins (4) or of peptide ligands with binding preference for selected tissues in vivo (5,6) or cells in vitro (7,8,9). For instance, in vivo screening of phage-display peptide libraries demonstrated the molecular heterogeneity of endothelial cells in different organs (6), suggesting that the vasculature of each organ could be targeted by specific ligands. Two peptide ligands preferentially homing to kidney endothelium in the glomerulus and mediating up to sevenfold increased binding compared with control were selected by this approach (5).
Knowledge about specific basolateral tubular epithelial markers is limited. The basolateral surface of cells grown on culture dishes is not directly accessible for analysis, and evidence exists for the loss of tissue-specific traits of isolated cells upon culture (10,11). To identify ligands that bind selectively to receptors with a differential expression on the basolateral cell surface of defined nephron segments, we incubated phage-display peptide libraries with microdissected intact cortical collecting ducts (CCD) or proximal convoluted tubules (PCT). By using the approach presented in this study, the identification of ligands specific for the basolateral membrane of kidney epithelium should increase knowledge about interactions between the membrane domain and extracellular matrix. It might also contribute to the future development of kidney cell-specific vectors for drug delivery or gene transfer, making a possibility the treatment for diseases including tubulointerstitial fibrosis, polycystic kidney disease, and genetic disorders of salt balance causing hypertension.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Microdissection of Rat Kidney Tubules
Rat CCD and PCT were microdissected as described earlier with some
modifications
(13,14).
Briefly, male Sprague-Dawley rats were anesthetized with Nembutal
(pentobarbitone, 50 mg/kg body wt, intraperitoneally). The left kidney was
perfused in situ via the abdominal aorta with 10 ml of Hank's
balanced salt solution (HANKS; pH 7.4), followed by 5 ml of HANKS containing
collagenase (2.6 mg/ml, 0.9 U/mg, clostridium histolyticum, Serva, Heidelberg,
Germany). At the end of the perfusion, small pieces of cortex were removed and
incubated in HANKS containing 0.65 mg/ml collagenase for approximately 30 min
at 32°C. Nephron segments were dissected under a stereomicroscope in cold
microdissection buffer (HANKS containing 1 mg/ml bovine serum albumin). The
recovered nephron segments were measured individually with an ocular
micrometer, and isolated segments (50 mm) were immediately subjected to
incubation with phage as described below. Endothelial cells and basement
membrane were removed by the collagenase treatment, allowing the direct access
of phage to the basolateral tubular cell surface. Counting of cells revealed
360 cells/mm of isolated CCD and 300 cells/mm for isolated PCT
(15).
Affinity Purification of Binding Phage
Isolated rat kidney tubules (50 mm) were preincubated in 200 µl of phage
incubation buffer (HANKS [pH 7.4] containing 1% low-fat milk and 100 µM
chloroquine) for 15 min at 37°C to adapt the cell metabolism and to reduce
hypothermic effects on the cytoskeletal network and on membrane protein
trafficking (16). Phage
libraries (1010 transducing units (TU) of LL9 or CL10) were added,
followed by further incubation for 40 min at 37°C, allowing
internalization of ligand activated receptors. Reactions were stopped with
ice-cold phage incubation buffer, tubules centrifuged at 700 x
g for 3 min, washed twice with 25 ml of phage incubation buffer, once
with 25 ml HANKS, and transferred with a 75-µl Micro/pettor (SMI, Berkeley,
CA) to 1.5-ml tubes. After incubation of tubules with 400 µl of 0.1 M
glycine-HCl (pH 2.2) for 5 min, the acid-eluted fraction, containing phage
that were attached to the cell surface with low affinity, was removed by
centrifugation. The pH of the pelleted tubules (cell-associated fraction) was
neutralized by adding 200 µl of HANKS, supplemented by 10 mM Tris (pH 7.4).
Trypan blue staining (4 mg/ml) revealed that more than 98% of tubular cells
remained intact during the acidic elution. Tubules were lysed with 0.5% Tween
20, and phage titer was determined. Phage were amplified using
"starved" K91 Escherichia coli cells and purified as
described (17). An aliquot of
1010 TU of purified phage was reapplied in a subsequent round of
biopanning. After the third or fourth round of panning, individual phage
clones were isolated, single-strand DNA were prepared, and the unique
nucleotide region of the pIII protein encoding the random peptides was
sequenced using the oligonucleotide primer 5' GTTTTGTCGTCTTTCCAGACG
3'.
To gain insight into the potential specificity of biopanning experiments on intact kidney tubules ex vivo, we performed similar experiments in vitro on the well-characterized polarized cell line T84 (human colon carcinoma), which is known to express several functional binding proteins in the basolateral domain (18). Briefly, T84 cells were grown near confluence in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F12 nutrient mixture (19). Cells were detached by mild trypsinization, washed to remove residual trypsin, and suspended in 1 ml of HANKS containing 10 mM HEPES (pH 7.4) and 0.1% bovine serum albumin. Upon incubation for 1 h at 25°C in the presence of phage libraries LL9 or CL10 (1010 TU), cells were washed five times with phage buffer. Acid-eluted and cell-associated fractions were separated as described above. Phage were then amplified, purified, and subjected to the next round of biopanning.
Determination of Phage Titer by Plaque Assay
Phage were titered by infecting E. coli K91 cells in the
logarithmic growth phase with serial dilutions of eluted phage. Upon
incubation at 37°C for 15 min, melted soft-agar (55°C) was added and
the mixture was plated onto LB-agar. The number of plaques, representing areas
of reduced bacterial growth due to infection with individual phage, was
determined. Typically, between 200 and 1000 plaques were counted, and the
number of phage corresponding to 1 cm of tubule length was calculated.
Quantitation of Phage-Binding and Competition Assay
To quantify binding of a selected phage, we incubated tubules (25 mm) at
37°C for 40 min according to the selection procedure described above,
except that the phage library equivalent was replaced by 1010 TU of
an amplified individual phage clone. In competition experiments, the selected
phage and its corresponding synthetic peptide or irrelevant control peptides
(MHNRHPMIKH or PSRHIPPQL) were added simultaneously, with peptide
concentrations ranging from 100 nM to 100 µM. To analyze the effect of the
peptide on phage binding, we preincubated tubules and synthetic peptide for 15
min before adding phage. Alternatively, the peptide was added 15 min after
exposure of the tubules with the phage. Phage were then recovered and
quantitated from the cell-associated fraction by plaque assay. The binding
specificity of the CCD motif was further assessed by incubation of
104 T84 cells (or other cell lines) with 1010 TU of a
purified, individual phage clone in the presence or absence of the competing
peptide or a control peptide at 37°C for 40 min. Because suitable rat cell
lines were not available, epithelial cell lines from other species were used.
The number of bound or internalized phage was determined from the
cell-associated fraction, and the results expressed as a ratio to the binding
of an irrelevant phage.
Detection of Phage Binding by Fluorescence Microscopy
Microdissected tubules (25 mm) were incubated in phage incubation buffer in
the presence of 1010 TU of a purified, individual phage clone for 2
or 40 min at 37°C in the presence or absence of 10 µM synthetic
peptide. Tubules were extensively washed, and phage attached to the cell
surface were eluted by acidic buffer as described above. The pelleted tubules
were taken up in 100 µl of HANKS (pH 7.4), subjected to cytospin
centrifugation for 10 min at 600 x g onto glass cover slides,
and fixed with 4% paraformaldehyde for 10 min at 25°C. When T84 cells were
used, approximately 104 cells were subjected to cytospin
centrifugation for 2 min at 600 x g, followed by
paraformaldehyde fixation. Tubules or cells were washed three times with
sodium/phosphate/sucrose/triton buffer (NAPST) (100 mM disodium phosphate, pH
7.4, 120 mM sucrose, 0.5% Triton X-100 to permeabilize cells) and blocked for
30 min with buffer NAPSTM (NAPST buffer containing 1% low-fat milk). Upon
incubation with mouse monoclonal anti-M13 phage IgG (Pharmacia, Duebendorf,
Switzerland) for 1 h at 25°C, samples were washed three times with buffer
NAPSTM, followed by incubation for 30 min with fluorescein-conjugated goat
anti-mouse IgG (Molecular Probes, Leiden, The Netherlands). After extensive
washing, cells were mounted on glass cover slips using a Slow-Fade-Antifade
kit (Molecular Probes). Samples were analyzed by confocal microscopy (Zeiss
LSM 410, Zeiss, Goettingen, Germany) using a laser for excitation of
fluorescein at 488 nm. The emission signal for fluorescein was captured with a
band pass at 510 to 525 nm.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Binding Studies with Purified Phage
To assess the specificity of the selected phage, we incubated isolated
intact CCD or PCT with purified phage expressing the peptides ELRGDMAAL or
ELRGDRAHW, selected from CCD, the peptide KMGGTNHPE, selected from PCT, or a
random linear nonapeptide (Figure
1). Analysis of the cell-associated fractions revealed 39-fold
increased binding of either ELRGDMAAL- or ELRGDRAHW-displaying phage to CCD
compared with control phage. Furthermore, phage that displayed peptides with
the consensus sequence ELRGD(R/M)AX(W/L) bound at 16-fold higher levels to CCD
than to PCT, indicating their clear preference for CCD. The
KMGGTNHPE-displaying phage was less specific for a defined tubule type. Its
binding to PCT was twofold higher than to CCD, but binding to PCT was 10-fold
higher than that of control phage. Because this motif did not mediate highly
tubule-specific binding, we did not analyze further the binding properties.
Control phage showed similar binding to both tubule types. The resistance of
phage binding to acidic elution suggested internalization of phage upon
binding to its cognate receptor. Tubules were incubated with phage for 40 min
at 37°C in the presence of 100 µM chloroquine, which prevents
endosome/lysosome fusion (20).
Incubation of tubules for a prolonged period of time at 37°C (2 h) in the
absence of chloroquine led to a significant decrease of phage recovery (not
shown), suggesting lysosomal degradation of the phage.
|
The cell specificity of the ELRGDMAAL-displaying phage was examined further by determining phage binding to various epithelial cell lines (Table 2). Whereas binding to cell lines or to microdissected PCT was low, ELRGDMAAL-displaying phage bound with a high preference to isolated CCD (39-fold over control phage). This phage showed relatively high binding (13.9-fold over control phage) to colon carcinoma epithelial T84 cells but not to colon carcinoma SW620 cells. Surprisingly, binding to MDCK cells, a cell line derived from canine kidney with some features of CCD, was not significantly increased, indicating low expression levels of the corresponding receptor in this transformed cell line.
|
Inhibition of Phage Binding to Microdissected CCD by Coincubation
with Synthetic Peptide
Competition assays revealed significantly inhibited binding of ELRGDMAAL-
or ELRGDRAHW-displaying phage to CCD after preincubation of tubules with
synthetic peptide (not shown) or when the peptide was added simultaneously
with phage (Figure 2). A random
control peptide had no effect. The synthetic peptide did not affect phage
binding and recovery after a 15-min preincubation of tubules with phage,
suggesting receptor internalization upon ligand binding. The half-maximal
inhibition (IC50) of either ELRGDMAAL- or ELRGDRAHW-displaying phage binding
to CCD by the synthetic peptide ELRGDMAAL was approximately 500 nM
(Figure 2B).
|
Internalization of ELRGDMAAL-Displaying Phage upon Binding to
Microdissected CCD
To identify ligands for the receptor-mediated endocytosis pathway, we
performed biopanning at 37°C for 40 min, and phage that were resistant to
acidic buffer elution were selected from the cell-associated fraction.
Isolated tubules were centrifuged onto glass coverslips by cytospin, and the
localization of CCD-bound phage was visualized by confocal microscopy
(Figure 3). The focus of the
confocal microscope was set through the center of the two cell layers of the
centrifuged tubule. After a 2-min incubation time, a multifocal staining
pattern restricted to the CCD cell surface indicated binding of
ELRGDMAAL-displaying phage to the basolateral membrane
(Figure 3, D and J). A
scattered staining of phages was observed after 40 min, typical for endosomal
localization (Figure 3F).
Incubation of CCD with a control phage
(Figure 3, A and B) or with
ELRGDMAAL-displaying phage in the presence of 10 µM synthetic peptide
(Figure 3, G and H) resulted in
background immunofluorescence. Incubation of PCT with ELRGDMAAL-displaying
phage resulted in no detectable immunofluorescence and was not distinguishable
from that of control phage (not shown).
|
Selection of Phage with Preferential Binding to Colon Carcinoma T84
Cells
Because the CCD-binding motif ELRGDMAAL exhibited considerable binding to
T84 cells, we tested the specificity of the ex vivo selection on
kidney tubules by performing analogous experiments on T84 cells. We screened
phage-display peptide libraries on colon carcinoma T84 cells and recovered
phage expressing circular peptides with the consensus RGDLGXL(K/R)
(Table 3). Like the CCD-binding
motif, this peptide contains an RGD sequence but different, highly conserved
flanking amino acids. Whereas the T84-binding peptide was recovered
exclusively in a circular form, caused by a structural constraint imposed by
two cysteine residues flanking the variable region, the CCD binding peptide
was selected exclusively from the linear library and is not structurally
constrained.
|
Incubation of T84 cells with library LL9 yielded predominantly phage with the consensus sequences NFYXGXRSL and VHXWD. These sequences, which were not analyzed further, may have higher affinity for their putative receptors on T84 cells than the linear sequence ELRGD(R/M)AX(W/L). This may explain the absence of ELRGD(R/M)AX(W/L)-displaying phage among phage recovered from T84 cells.
Analysis of the Binding Specificity of the Two Distinct RGD Ligands
for Either CCD or Colon Carcinoma T84 Cells
Binding of purified phage expressing the linear CCD-motif ELRGDMAAL, the
circular T84-motif CQARGDLGKIRC, or a control peptide sequence was determined
for both microdissected CCD and T84 cells
(Figure 4). Binding to CCD
compared with control phage was 39-fold increased for the ELRGDMAAL-displaying
phage and 5.4-fold for the CQARGDLGKIRC-displaying phage, demonstrating a
7-fold preference of ELRGDMAAL- over CQARGDLGKIRC-displaying phage for CCD. In
addition, the peptide CQARGDLGKIRC inhibited binding of
CQARGDLGKIRC-displaying phage to CCD with an IC50 of 1 µM (not shown),
compared with the IC50 of 500 nM of the ELRGDMAAL peptide
(Figure 2B). Both phage showed
approximately twofold increased binding to PCT compared with control phage
(not shown). These results indicate a clear preference of the putative CCD
cell surface receptor to bind the linear motif ELRGDMAAL.
|
Binding studies on T84 cells revealed 42- and 14-fold increased binding of CQARGDLGKIRC- and ELRGDMAAL-displaying phage over control phage, respectively, demonstrating a 3-fold preference of the CQARGDLGKIRC over the ELRGDMAAL motif for T84 cells. Although the CQARGDLGKIRC-Displaying phage bound at threefold higher levels to T84 cells than ELRGDMAAL-displaying phage, similar IC50 values of approximately 100 nM were obtained for both motifs in competition assays with the corresponding peptides (not shown).
Internalization of CQARGDLGKIRC-Displaying Phage upon Binding to T84
Cells
T84 cells incubated with CQARGDLGKIRC-displaying phage were centrifuged by
cytospin onto glass coverslips. The localization of phage was analyzed by
immunofluorescence staining and confocal microscopy. After 2 min of incubation
at 37°C, phage binding was restricted to the cell surface, whereas the
distributed pattern of phage staining observed after 40 min indicated
internalization of phage via the endocytotic pathway
(Figure 5). Experiments using
ELRGDMAAL-displaying phage resulted in a distribution pattern similar to that
of CQARGDLGKIRC-displaying phage, but staining was much less intense and
control phage did not result in a detectable immunofluorescence signal (not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The CCD-binding motif ELRGD(R/M)AX(W/L) was exclusively displayed in the linear form. In contrast, biopanning the polarized epithelial T84 cells yielded the peptide motif RGDLGXL(K/R) exclusively in the circular form. Both the CCD- and the T84-binding phage showed high specificity for and affinity to their target cells, suggesting binding to different receptors. Phage binding resisted low pH treatment, and low concentrations of the corresponding synthetic peptides competitively inhibited phage binding to target cells, with IC50 concentrations in the high nanomolar range. In addition, the significant decrease in phage recovery in the absence of chloroquine suggests that the CCD- and the T84-peptide ligands are internalized upon ligand binding and undergo lysosomal degradation.
The selection of ligands with an RGD sequence and binding to putative integrin receptors is not surprising. Both polarized cell types, CCD cells and colon epithelial T84 cells, exhibit interactions of their basolateral cell surface with the extracellular matrix. Integrin receptors play an important role by interacting with extracellular matrix proteins and adhesion molecules of neutrophils or pathogenic microorganisms (21).
The estimated number of approximately 50 phage particles bound per cell is relatively low. This phenomenon has been observed previously (8) and may be explained by the large size of phage particles. Phage binding to a receptor might sterically hinder the binding of additional phage to receptors located in close proximity. In addition, phage binding may cause internalization of other still unoccupied receptors.
The CCD and T84 motif both contain an RGD sequence, known to mediate
binding to the integrin family of receptors
(21). The presentation and the
residues that flank the RGD sequence clearly are different between the two
ligands and seem to be essential for rendering cell specificity and high
affinity binding. The linear CCD-binding motif ELRGD(R/M)AX(W/L) contains a
positively charged arginine or a methionine at position + 1, relative to the
RGD sequence, whereas the circular T84-binding peptide RGDLGXL(K/R) has a
hydrophobic leucine residue at this position. Whereas both the CCD- and the
T84-binding motifs have a hydrophobic residue at position +4 (W/L or L,
respectively), a positively charged amino acid (K/R) at position +5 is
characteristic for the T84-motif. Furthermore, the CCD motif contains a
glutamate and a leucine residue at positions -2 and -1, whereas the region
upstream of the RGD sequence of the T84 peptide is less conserved but contains
an uncharged or a positively charged residue at position -1. Although the
identity of the specific integrin receptor for both RGD ligands is unknown, it
is unlikely that they bind to the 
v integrin expressed in
tumor vasculature (22) and in
the vascular endothelium of the kidney
(23), because folding and
flanking residues of the CCD, the T84, and the v integrin
ligand (ACDCRGDCFCG) clearly are different.
RGD-recognizing integrins have been shown to be present in endosomes of a variety of cells (24), and integrin-mediated gene delivery vectors led to enhanced gene transfer into different cell lines (25,26,27). Using tracheal epithelial cells, Colin et al. (28) presented evidence for a clathrin-coated pit-dependent endocytic internalization of an RGD-oligolysine/DNA complex. In an approach to achieve gene transfer with synthetic virus-like particles via the integrin-mediated endocytosis pathway, Erbacher et al. (29) coupled the peptide CYGGRGDTP, present in fibronectin, vitronectin, and type I collagen, to polyethylenimine/DNA complexes. They observed markedly improved efficiency of gene transfer into HeLa cells of up to 100-fold over control. In contrast, the phage expressing the ELRGDMAAL peptide bound preferentially to CCD and showed only slightly increased binding to HeLa cells compared with a random control phage. Both peptides are not structurally constrained. Their main differences involve charge and length of the side chain of the residues in position -2 and -1, relative to the RGD sequence, with Glu, Leu in the CCD motif and Gly, Gly in the fibronectin-derived peptide. Evidence that changes in the amino acid context can dramatically affect the binding properties of RGD ligands has been provided by other investigators (21,30).
The kidney consists mainly of nonproliferating, terminally differentiated cells. Viral vector delivery to these cells is relatively inefficient, probably as a result of the lack of high affinity viral receptors on the cell surface (31,32). Nephron segment-specific peptide ligands, such as the ELRGD(R/M)AX(L/W) peptide, potentially could be used for the development of kidney-specific delivery vectors, either by direct incorporation into viral vectors such as adenovirus (33,34), by coupling to polyethylenimine (29,35) or oligolysine (26,27), or by indirect coupling to viral vectors or liposomes using polyethylene glycol (36). Alternatively, genetically modified filamentous bacteriophage could be used for gene transfer into mammalian cells (37,38,39). Alternative ligands may be identified by screening other defined tubular segments or isolated CCD using different libraries and conditions, e.g., in the presence of synthetic peptide.
Selective targeting of renal tubular epithelial cells may be achieved either through retrograde infusion, with possible applications to target papilla and outer medulla, or by arterial perfusion, which seems most promising for the targeting of glomerular cells or cortical segments (34,40,41,42). Targeting of epithelial cells via arterial delivery may be more challenging. Perfusion of the kidney for 40 min with high titer modified adenovirus led to the transduction of kidney cortical vasculature but not parenchymal cells (34). However, McDonald et al. (34) used an adenovirus whose fiber protein contained a ligand that has been shown previously to mediate homing to endothelial cells (5,23). It is likely that this fiber-modified adenoviral vector was trapped in endothelial cells. Access of vectors from the blood stream to parenchymal cells may be facilitated by interventions that act on tight junctions and enhance transendothelial migration. Arap et al. (43) demonstrated that a phage homing specifically to tumor endothelium had spread from the blood vessels into the tumors after circulation for 24 h. Similarly, arterial perfusion of vectors modified with a ligand specific for basolateral epithelial cells and circulation for a prolonged period of time may allow homing to the basolateral epithelial cell surface.
A notable finding in our study is the relatively low but significant cross-reactivity of the CCD-binding phage with T84 cells (13.9-fold over control) and that of the T84-binding phage with CCD (5.4-fold over control), suggesting at least some expression of both putative receptors on either cell type. CCD and colon epithelium play a role in the regulation of salt transport, and colonic epithelial T84 cells show enzyme activities comparable to those of primary cultured rabbit CCD cells (44).
Surprising, phage binding to MDCK cells, a cell line derived from canine kidney that is widely used as a cell model for CCD, was very low. Culturing of the cells could have led to dedifferentiation resulting in dramatically diminished expression of the putative integrin receptor, probably involved in adhesion of the basolateral membrane with the extracellular matrix. Another explanation is the species difference, because tubules were microdissected from rat and MDCK cells are derived from canine kidney. It is not surprising that the expression of cell surface receptors in cell lines differs from that in the native system. Cell dissociation disrupts intercellular communications and extracellular attachments. It has been shown that kidney tubular cells lose their epithelial polarity within minutes after dissociation (45,46). Our results emphasize the need for a native system of living cells to retain proper differentiation for the identification and characterization of ligands and their corresponding cell surface receptors. In addition to the disadvantage of altered differentiation of cell lines, the basolateral membrane of cells grown on culture dishes is directed toward the solid surface of the dish and is not directly accessible for analysis.
The presented method was designed to select high affinity binding phage undergoing internalization upon binding to their putative cell surface receptors and allowed the identification of a ligand that binds selectively to the basolateral membrane of CCD. Additional binding sequences may be identified by modification of the conditions chosen for the binding or elution of phage, such as temperature, pH, the presence or absence of the ions Mg2+ or Ca2+, or elution with specific known ligands. Different types of phage-display libraries with distinct presentation and length of the displayed peptide sequences could be applied to search for alternative motifs. In addition, affinity purification can be performed by inclusion of competing synthetic peptides, e.g., ELRGDMAAL in the case of CCD (8). The screening of phage-display libraries ultimately tends to result in the selection of the "best-fit" sequence, and only one or few distinct peptide sequences are obtained after several rounds of panning (5,8,43). Phage with lower affinity to their putative receptors or phage binding to receptors that are expressed at lower abundance may be found by analyzing clones after fewer rounds of affinity purification. Although these sequences may be less abundant or display a lower affinity to their corresponding receptors, they may be highly specific for the cell type of interest and be useful for the development of cell-type specific vectors.
The versatility of phage-display and biopanning using the present approach is expected to lead to the identification of additional ligands with tubule segment-specific binding properties (analogous to the CCD ligand) but will also result in the selection of high affinity non-cell-type specific ligands (analogous to the PCT ligand). Characterization of these ligands may contribute to the refinement of the current knowledge on interactions among endothelium, extracellular matrix, and epithelium and may help in the development of cell-specific, systemic delivery applications in the kidney.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  Y.-J. Lee, H.-J. Choi, J.-S. Lim, J.-H. Earm, B.-H. Lee, I.-S. Kim, J. Frokiaer, S. Nielsen, and T.-H. Kwon A novel method of ligand peptidomics to identify peptide ligands binding to AQP2-expressing plasma membranes and intracellular vesicles of rat kidney Am J Physiol Renal Physiol, July 1, 2008; 295(1): F300 - F309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Laumonier, J. Segers, S. Laurent, A. Michel, F. Coppee, A. Belayew, L. V. Elst, and R. N. Muller A New Peptidic Vector for Molecular Imaging of Apoptosis, Identified by Phage Display Technology J Biomol Screen, August 1, 2006; 11(5): 537 - 545. [Abstract] [PDF]
|
|
|
|
 |
|
 D. Hof, K. Cheung, H. E. Roossien, G. J. M. Pruijn, and J. M. H. Raats A Novel Subtractive Antibody Phage Display Method to Discover Disease Markers Mol. Cell. Proteomics, February 1, 2006; 5(2): 245 - 255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hou and X.-X. Gu Development of Peptide Mimotopes of Lipooligosaccharide from Nontypeable Haemophilus influenzae as Vaccine Candidates J. Immunol., April 15, 2003; 170(8): 4373 - 4379. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
) or from the
acid-eluted fractions (
). Data represent mean ± SD of the number
of phage plaques on lawns of bacterial cells, determined from seven
independent experiments.
) or by the
synthetic peptide ELRGDMAAL (
