Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MARIC, C.
Right arrow Articles by ALCORN, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MARIC, C.
Right arrow Articles by ALCORN, D.
J Am Soc Nephrol 12:450-455, 2001
© 2001 American Society of Nephrology

Angiotensin II Binding to Renomedullary Interstitial Cells Is Regulated by Osmolality

CHRISTINE MARIC*, DAVID CASLEY{dagger}, PETER J. HARRIS{ddagger} and DAINE ALCORN*

* Department of Anatomy and Cell Biology, University of Melbourne, Victoria, Australia.
{dagger} Department of Medicine (Austin and Repatriation Medical Centre), University of Melbourne, Victoria, Australia.
{ddagger} Department of Physiology, University of Melbourne, Victoria, Australia.

Correspondence to Dr. Christine Maric, Department of Anatomy and Cell Biology, University of Melbourne, Victoria, 3010, Australia. Phone: +61 3 9344 5251; Fax: +61 6 9347 5219; E-mail: c.maric{at}anatomy.unimelb.edu.au


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abstract. Angiotensin II (Ang II) AT1A receptors are localized to renomedullary interstitial cells (RMIC) in the inner stripe of the outer medulla but not in the inner medulla. Thus, there seems to be a correlation between decreases in AT1A receptor binding to RMIC and increases in interstitial osmolality, suggesting that osmolality is important in determining Ang II binding to RMIC. Cultured RMIC were incubated in media of differing osmolalities (330, 630, 930, and 1230 mOsm/kgH2O). 125I-[Sar1, Ile8] Ang II binding to AT1A receptors on RMIC grown in hyperosmolal media (930 mOsm/kgH2O) was reduced compared with isoosmolal (330 mOsm/kgH2O) media and was progressively reduced with further increases of osmolality. Similar studies were performed using bradykinin (BK) as a control peptide. Binding of the BK receptor ligand 125I-[HPP-Hoe 140] to B2 receptors was not affected by varying osmolality of the media. Reverse transcriptase-PCR demonstrated the presence of the mRNA expression for both AT1A and B2 receptors at each osmolality. The conclusion is that osmolality modulates Ang II binding to RMIC; in these cells, this phenomenon is restricted to Ang II as BK binding is not affected. Osmolality-induced changes in Ang II binding may modulate the actions of this peptide on RMIC and provide an important mechanism by which these cells modulate renal medullary function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Renomedullary interstitial cells (RMIC) traverse the spaces between renal medullary tubules and blood vessels in a pattern that resembles the rungs of a ladder (1). This characteristic anatomical arrangement provides evidence that RMIC play a passive role in providing structural support for the renal medulla. However, studies from this and other laboratories demonstrating the presence of receptors for vasoactive peptides including angiotensin II (Ang II) (2), bradykinin (BK) (3), endothelin (ET) (4), and atrial natriuretic peptide (ANP) (5) on RMIC suggest that these cells have the potential to play an active role in modulating renal function. We and others have demonstrated that in cultured RMIC, Ang II, BK, ET, and ANP promote cell contraction, cell mitogenesis, and synthesis of extracellular matrix (2,6,7). These studies lead to the proposition that RMIC may modulate renal blood flow and urine concentration through interactions with vasoactive peptides (4,8).

Previous in vivo studies from this group, using high-resolution autoradiography, demonstrated the presence of Ang II binding sites on RMIC in the inner stripe of the outer medulla (ISOM) but not in the inner medulla (IM) (9). In contrast, binding sites for BK, ET, and ANP have been localized to RMIC throughout the renal medulla (10,11,12). These findings suggested that there is a regional restriction associated with Ang II binding to RMIC in vivo. Interestingly, RMIC, despite the region of the medulla from which they originate, all have the ability to bind Ang II when cultured in an isoosmolal condition, suggesting a specific relation between osmolality and Ang II receptor binding properties and/or receptor expression.

The aim of the current study was to investigate the hypothesis that binding of Ang II to AT1A receptors on RMIC is regulated by osmolality. In an attempt to understand the possible mechanisms underlying the osmotic regulation of vasoactive peptide receptors, the study also examined the effects of osmolality on the presence of the mRNA for the AT1A receptor. We compared these results with those for BK B2 receptors, which seem not to be affected by changes in osmolality.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Isolation and Culture of RMIC
The cells were isolated as described previously (6). Briefly, kidneys of Sprague-Dawley rats were perfused with Hank's balanced salt solution and removed, and their medullae were dissected, cut, and digested in a 0.1% collagenase type 1 solution. Fragmented tissue was then sieved through a stainless steel mesh, and the dispersed cells were resuspended in a 1:1 mixture of culture medium RPMI 1640 and Dulbecco's modified Eagle's medium, conditioned by 3T3 Swiss albino mouse fibroblasts in the log phase of growth. Homogeneous cell populations were generally reached by passage 10, verified by morphologic and immunocytochemical analysis as described previously (6). Cells between passages 10 and 20 were used in all experiments.

Manipulation of Medium Osmolality
RMIC were plated in 25-mm2 culture flasks at 1 x 105 cells/cm2 in culture medium RPMI 1640 (330 mOsm/kgH 2O) for 24 h. The osmolality of the media was then either kept at 330 mOsm/kgH2O or increased daily by increments of 100 mOsm/kgH 2O such that the final osmolalities (330, 630, 930, and 1230 mOsm/kgH 2O) all were reached at the same time point. The osmolality of the media, once it reached 1230 mOsm/kgH2O, was also decreased daily by decrements of 100 mOsm/kgH2O until isoosmolal (330 mOsm/kgH 2O) conditions. Once the desired osmolality was achieved, the cells were counted using a routine hemocytometer method and their viability was assessed by Trypan blue exclusion and plated in 96-well plates at 1 x 105 cells/cm2 at their corresponding osmolalities. The cells were allowed 24 h to attach and then were used for either reverse transcriptase-PCR (RT-PCR) or radiolabeled ligand binding.

The osmolality was adjusted by addition of NaCl and mannitol (the concentrations of NaCl and mannitol at particular media osmolalities were 0.08 M, 0.10 M, at 630 M mOsm/kgH2O; 0.16 M, 0.20 M, at 930 M mOsm/kgH2O; and 0.25 M, 0.30 M, at 1230 M mOsm/kgH2O).

Radiolabeled Ligand Binding Assay
After exposure to various osmotic challenges, RMIC were washed twice with a buffer containing 10 mM Na2HPO 4, 120 mM NaCl, 26 mM NaHCO3, 5.4 mM KCl, 5.6 mM glucose, and 5 mM ethylenediamine tetraacetic acid (pH 7.4), osmolality 330 mOsm/kgH2 O. Cells were then incubated with 1 µM [Sar1,Ile8] Ang II or 1 µM HPP-Hoe 140 (to detect nonspecific binding), buffer (50 mM Tris/HCl, 150 mM NaCl, 1 mM ethylenediamine tetraacetic acid, 25 mM MgCl 2, and 0.25% bovine serum albumin to detect total binding), 1 µM Losartan (to detect AT1 receptor binding), or 1 µM PD 123319 (to detect AT2 receptor binding), followed by addition of 125I-[Sar1, Ile8] Ang II or 125I-[HPP-Hoe 140] at a dose of 3 x 105 cpm/sample for 1 h at room temperature. For competition binding, the cells were incubated with [Sar1, Ile8] Ang II (10-5 to 10-11 M) or HPP-Hoe 140 (10-5 to 10-11 M) in the presence of 125I-[Sar1, Ile8] Ang II or 125I-[HPP-Hoe 140] at a dose and time indicated above. Cells were then washed with a buffer containing 30 mM NaCl and 10 mM Tris/HCl, scintillation fluid was added, and bound radioactivity was measured in a Packard TopCount (Meriden, CT).

Results are expressed as specific binding. Specific binding is defined as total binding minus nonspecific binding. Values were normalized to the final cell number counted using a hemocytometer. Results were analyzed using the GraphPad Prism software (GraphPad Software Inc., San Diego, CA), and binding constants were determined as described (13).

RT-PCR and Southern Blotting
After exposure of cultured RMIC to media of varying osmolality (as described above), RNA was isolated using the RNeasy mini kit (Qiagen, Clifton Hill, Victoria, Australia). RT reaction was performed on 5 µg of RNA in 100 mM KCl, 50 mM Tris-HCl (pH 8.4), 6 mM MgCl2, 10 mM dithiothereitol, 500 µM dNTP (Promega, Annandale, New South Wales, Australia), 12 µg/ml random hexamers (Boehringer Mannheim, Castle Hill, New South Wales, Australia), 40 units of RNasin (Promega), and AMV RT (for negative controls; Boehringer Mannheim; 25 units) at 42°C for 1 h. Reverse transcription was followed by PCR. Primers used for amplification of the AT1A receptor mRNA were as follows: sense 5'TTGGAAACAGCTTGGTGGTGAT3'; antisense 5'CCAGGAAAAGAAGAAGAAAAGCAC3' corresponding to regions 130 to 152 and 736 to 759 of the rat AT1A receptor (14). The same antisense primer was used for amplification of the AT1B receptor, and the sense primer was 5'CCAGCGCCACGCTGT3' corresponding to region 20 to 35 of the rat AT1B sequence (15). The primers used for amplification of the AT2 receptor mRNA were as follows: sense 5'GCTGATTTATGATAACTGCTTTAAAC3'; antisense 5'AGGTCCAAAGAGCCAGTCATATCTATAAGA3' corresponding to regions 49 to 74 and 313 to 342 of the rat AT2 receptor, respectively. The primers used for amplification of the B2 receptor were as follows: sense 5'GCCAATAACTTCGACTGGCTGTTCGGA3'; antisense 5'CTCCGTCTGGACCTCCTTG AACTTCTTCATC3', corresponding to regions 367 to 393 and 774 to 810 of the rat B2 receptor (16). Denaturation, annealing, and extension were carried out at 94°C, 60°C, and 72°C, respectively, for 1 min each for 30 cycles, followed by a final extension at 72°C for 10 min. PCR products were analyzed by electrophoresis on a 1.4% agarose gel then transferred onto Hybond N+ (Amersham, Buckingamshire, UK) using alkali blotting in 0.4 M NaOH. The membrane was hybridized with a corresponding 32P-labeled oligonucleotide probe at 42°C for 2 h, washed in SSC/0.1% sodium dodecyl sulfate, and then exposed to an x-ray film for 1 d.

Statistical Analysis
All results are expressed as mean ± SEM and were analyzed using t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Cell Isolation and Morphology
When the previously described method was followed, homogeneous cell populations were generally reached at passage 10, verified by morphologic and immunocytochemical analyses (6). These cells resembled RMIC found in the IM of the adult kidney (1). With increases in osmolality, the cells appeared more rounded and had a lower rate of proliferation (data not shown). However, no significant differences in the percentage of dead cells were observed (330 mOsm/kgH2O, 1.9 ± 0.2%; 630 mOsm/kgH2O, 2.3 ± 0.3%; 930 mOsm/kgH2O, 2.4 ± 0.3%; 1230 mOsm/kgH2O, 2.5 ± 0.4%).

Receptor Binding
RMIC cultured at 330 mOsm/kgH2O specifically bound 125I-[Sar1, Ile8] Ang II (1904 ± 85 cpm x 10-4/cell; Figure 1B). Binding of 125I-[Sar1, Ile8] Ang II to RMIC cultured in a 630 mOsm/kgH2O culture medium was similar to that of RMIC cultured in isoosmolal (330 mom/kgH2O) culture medium (1754 ± 101 cpm x 10-4/cell; Figure 1B). However, when RMIC were cultured at 930 mOsm/kgH2O, the specific 125I-[Sar1, Ile8] Ang II binding was reduced (924 ± 74 cpm x 10-4/cell; P < 0.01; Figure 1B). Further increases in osmolality to 1230 mOsm/kgH2O reduced specific 125I-[Sar1, Ile8] Ang II binding even further (591 ± 90 cpm x 10-4/cell; P < 0.05; Figure 1B). A gradual decrease in osmolality of the culture media from 1230 mOsm/kgH2O to 330 mOsm/kgH2O restored the ability of RMIC to bind 125I-[Sar1, Ile8] Ang II (1929 ± 92 cpm x 10-4/cell; Figure 1B). Ang II competition binding revealed a gradual increase in Kd (suggesting a gradual decrease in receptor affinity) and Bmax (suggesting an increase in receptor binding sites) (Figure 1A, Table 1). Binding of 125I-[Sar1, Ile8] Ang II was completely abolished in the presence of losartan (the AT1 receptor antagonist) and was not affected in the presence of PD 123319 (the AT2 receptor antagonist), suggesting that 125I-[Sar1, Ile8] Ang II bound to AT1 receptors (data not presented).



View larger version (16K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. (A) Competition binding curves demonstrated a gradual increase in Kd (suggesting a decrease in receptor affinity) with gradual increases in osmolality. [UNK], 330 mOsm/kgH2O; {blacksquare}, 630 mOsm/kgH2O; {blacktriangledown}, 930 mOsm/kgH2O; {diamondsuit}, 1230 mOsm/kgH2O. (B) At 330 mOsm/kgH2O, 125I-[Sar1, Ile8] angiotensin II (Ang II) specifically bound to renomedullary interstitial cells (RMIC). Specific 125I-[Sar1, Ile8] Ang II binding at 630 mOsm/kgH2O was similar to that at 330 mOsm/kgH2O. Increases in ambient osmolality to 930 and 1230 mOsm/kgH2O reduced specific 125I-[Sar1, Ile8] Ang II binding. When osmolality was returned to isoosmolal conditions, 125I-[Sar1, Ile8] Ang II binding was restored (total binding [TB] high low). Values are means ± SEM of five experiments (or three experiments for the reversal of osmolality) in triplicate. *, P < 0.05; **, P < 0.01; ***, P < 0.001 from 330 mOsm/kgH2O.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Effects of osmolality on receptor binding parameters
 

At 330 mOsm/kgH2O, the specific binding of 125I-[HPP-Hoe 140] to RMIC was 595.0 ± 61.0 cpm x 10-4/cell (Figure 2B). Further increases in medium osmolality from 630, 930, and 1230 mOsm/kgH2O did not influence 125I-[HPP-Hoe 140] binding to RMIC (592.0 ± 61.0 cpm x 10-4/cell; 529.0 ± 31.0 cpm x 10-4/cell; 498.5 ± 17.5 cpm x 10-4/cell, respectively; Figure 2B). Changes in osmolality did not significantly affect Kd or Bmax values, as revealed by BK competition binding (Figure 2A, Table 1).



View larger version (18K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. (A) From competition binding curves, no changes in Kd were observed after changes in osmolality. [UNK], 330 mOsm/kgH2O; {blacksquare}, 630 mOsm/kgH2O; {blacktriangledown}, 930 mOsm/kgH2O; {diamondsuit}, 1230 mOsm/kgH2O. (B) 125I-[HPP-Hoe 140] specifically bound to RMIC at 330 mOsm/kgH2O. Increases in medium osmolality from 630, 930, and 1230 mOsm/kgH2O did not affect specific 125I-[HPP-Hoe 140] binding. Values are means ± SEM of five experiments in triplicate.

 

RT-PCR
A PCR product of 770 bp, corresponding to the AT1A receptor mRNA, was detected in RMIC cultured under isoosmolal conditions (330 mOsm/kgH2O; Figure 3A). Bands of the same size were also detected in RMIC cultured at 630, 930, and 1230 mOsm/kgH2O (Figure 3A). A 710-bp band, corresponding to the BK B2 receptor mRNA, was detected in RMIC grown under isoosmolal conditions (Figure 3B). This PCR product was also observed in RMIC grown in media of 630, 930, and 1230 mOsm/kgH2O (Figure 3B). No PCR products were observed using primers for AT1B or AT2 receptors in RMIC following osmotic challenges (data not shown).



View larger version (11K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. (A) In RMIC cultured at 330 mOsm/kgH2O, a PCR product of 770 bp, corresponding to the Ang II AT1A receptor, was detected (lane 1). RMIC cultured at 630 (lane 2), 930 (lane 3), and 1230 mOsm/kgH 2O (lane 4) also expressed the mRNA for the AT 1A receptor. (B) A 710-bp PCR product, corresponding to the bradykinin B 2 receptor, was detected in RMIC cultured at 330 mOsm/kgH 2O (lane 1). RMIC cultured at 630 (lane 2), 930 (lane 3), and 1230 mOsm/kgH 2O (lane 4) also expressed the mRNA for the B2 receptor.

 


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The characteristic "ladder-like" arrangement of RMIC is consistent with their role in providing a structural framework for the renal medulla. However, studies from this and other laboratories have demonstrated the presence of Ang II, BK, ET, and ANP binding sites on these cells, highlighting their potential to exert an active role in the control of renal function (6,7,10,17).

The hypothesis of the current study is based on two previous observations. First is that there is a regional restriction of Ang II binding to RMIC in the kidney, likely to be a consequence of changes in local environmental factors. Second is that in vitro, RMIC all possess Ang II receptors regardless of the region of origin.

High-resolution autoradiographic localization of vasoactive peptide receptors in the kidney has verified that Ang II binding sites are located on RMIC (9). Furthermore, Ang II binding is restricted to RMIC of the ISOM, whereas no significant binding capacity is observed in the IM under normal physiologic conditions (9). In contrast, BK, ET, and ANP receptors are commonly found to coexist in various cell types throughout the renal cortex and medulla (10,11,12). The somewhat restricted medullary distribution of Ang II receptors may relate to local environmental factors such as local concentrations of Ang II and/or osmolality of the interstitium. After chronic salt loading or administration of angiotensin-converting enzyme inhibitors, both of which decrease intrarenal Ang II levels, increases in in vivo labeling of Ang II receptors in the ISOM have been observed (18). However, binding of Ang II was still restricted to RMIC in the ISOM, indicating that it was unlikely that local Ang II levels were involved in changing the distribution of binding. An alternative explanation for the restricted distribution of Ang II binding therefore could be the presence of wide variations in interstitial osmolality.

Our previous studies were performed on cells isolated from whole renal medullae and therefore included cells that originated from both isoosmolal ISOM and hyperosmolal IM. Because Ang II binding studies in fresh tissue have shown no significant Ang II binding in hypersomolal areas of the IM, the majority of those cells in culture would not be expected to have Ang II receptors. Interestingly, all RMIC in culture displayed Ang II binding capacity and changes in cell function when challenged with Ang II. Collectively, these studies support the view that osmolality of the surrounding fluid is a determinant of receptor expression and function, providing a potentially important regulatory mechanism for the actions of Ang II on renal medullary function.

In the present study, gradual increases in osmolality of the culture medium resulted in progressive decreases in Ang II binding to AT1A receptors in RMIC. This change was reversible as the capacity of the receptors to bind to its ligand was restored with reversal of the osmolality to isoosmolal level. This phenomenon seemed to be a feature of AT1A receptors, as changes in osmolality did not affect binding to BK B2 receptors. These findings support our hypothesis that binding of Ang II to RMIC is dependent on the osmolality of the surrounding fluid and that this receptor binding dependency on osmolality is completely reversible. Although this phenomenon did not seem to apply to all receptors (BK receptors were unaffected), there has also been a report of osmolality-induced changes of ET binding. Reduction in binding of ET to cultured RMIC was observed under hyperosmolal conditions (4). However, unlike Ang II, ET binding in the kidney is observed traversing regions of both low and high osmolality. These distributions are subtype dependent, with binding to the ETA receptor subtype being restricted to regions of low osmolality (11). Interestingly, we found that only the ETA receptor subtype is retained in RMIC cultured from the whole medulla (17), but it is likely that ETB receptors could be retained if the osmolality of the medium is increased. Such a mechanism would appear be different from that observed for AT1A receptors.

The examination of Ang II receptor mRNA was carried out in an attempt to dissect out the mechanisms that govern the osmotically sensitive change in Ang II binding to RMIC. The presence of mRNA for AT1A receptors was observed in RMIC regardless of the osmolality of the medium in which they were incubated. Similarly, occurrence of mRNA for the BK B2 receptor was found to be independent of osmolality. Although the present study did not set out to quantitate changes in the amount of receptor protein with osmolality, estimates of receptor numbers derived from the competition binding assays indicate that the reduction of Ang II binding (after increased osmolalities) was not due to decreases in receptor numbers. To the contrary, the data are consistent with an increase in receptor number but decreased affinity with increases in osmolality. The decreased affinity of the receptor for its ligand could be explained through osmotically induced alterations in the tertiary structure of the receptor protein. A study that reported a change in the conformational state of the AT1 receptor leading to its inactivation supports this hypothesis (19). Although the current study made no attempt to measure the binding of internalized ligand separate from the cell surface bound ligand, studies are being performed to investigate whether receptor internalization plays a role in the osmolality-dependent receptor binding mechanism.

Thus, the present study suggests that the mechanism by which reduced Ang II binding occurs in hyperosmolal environments is not mediated at the transcriptional level but could be due to changes in the receptor protein structure. However, other mechanisms known to be involved in the regulation of osmotically sensitive systems may also play a role. For example, the activity of aldose reductase (an enzyme responsible for sorbitol synthesis and involved with intracellular organic osmolyte accumulation) increases in hyperosmotic conditions as a result of increases in both mRNA and protein synthesis (20,21). It has also been reported that Ang II AT1 receptor mRNA are likely to form hairpin loop-like structures that can interact with RNA binding proteins. AT1 5' leader sequence binding proteins have been identified, and their activity is regulated by deoxycorticosterone acetate (22). These binding proteins or their interaction with the AT1 mRNA may also be sensitive to changes in osmotic conditions, thus providing an additional level of receptor expression control.

In summary, the current study provides evidence to support the importance of osmolality in the regulation of AT1A receptor activity on RMIC. Although the mechanism underlying this phenomenon is unlikely to involve modulation of mRNA transcription, further studies are required to determine the precise mechanism of receptor regulation.

The study also provides a basis for examination of osmotically induced changes in receptor binding in vivo. We conclude that through osmotic regulation of AT1A receptors, RMIC may have an important role in determining renal responsiveness to Ang II.


   Acknowledgments
 
The authors thank Dr. Kathleen Curnow for her advice on RT-PCR and valuable comments on the manuscript and Drs. Walter Thomas and Arthur Christopoulos for their advice on binding studies. This work has been supported by research grants from the National Health and Medical Research Council of Australia and the Australian Research Council.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bohman S-O: The ultrastructure of the renal medulla. In: The Renal Papilla and Hypertension, edited by Mandal AK, Bohman S-O, New York, Plenum Press, 1980, pp7 -33
  2. Brown AC, Zusman RM, Haber E: Identification of angiotensin receptor in rabbit renomedullary interstitial cells in tissue culture. Circ Res 46:802 -807, 1980[Abstract/Free Full Text]
  3. Fredrick MJ, Abel FC, Rightsel WA, Miurhead EE, Odya CE: B2 bradykinin receptor-like binding in rat renomedullary interstitial cells. Life Sci37 : 331-338,1985[Medline]
  4. Vernace MA, Mento PF, Maita ME, Girardi EP, Chang MY, Nord EP: Osmolar regulation of endothelin signalling in rat renal medullary interstitial cells. J Clin Invest96 : 183-191,1995
  5. Fontoura BMA, Nussenzveig DR, Pelton KM, Maack T: Atrial natriuretic factor receptors in cultured renomedullary interstitial cells. Am J Physiol 258:C692 -C699, 1990[Abstract/Free Full Text]
  6. Maric C, Aldred GP, Antoine AM, Dean RG, Eitle E, Mendelsohn FAO, Williams DA, Harris PJ, Alcorn D: Effects of angiotensin II on cultured rat renomedullary interstitial cells are mediated via the AT1A receptors. Am J Physiol 271:F1020 -F1028, 1996[Abstract/Free Full Text]
  7. Hughes AK, Barry WH, Kohan DE: Identification of a contractile function for renal medullary interstitial cells. J Clin Invest 96:411 -416, 1995
  8. Koushanpour E, Kriz W: Mechanism of concentration and dilution of urine. In: Renal Physiology: Principles, Structure and Function, New York, Springer-Verlag, 1986, pp270 -309
  9. Zhuo J, Alcorn D, Allen AM, Mendelsohn FAO: High resolution localization of angiotensin II receptors in rat renal medulla. Kidney Int 42:1372 -1380, 1992[Medline]
  10. Dean RG, Maric C, Aldred GP, Casley D, Zhuo J, Harris PJ, Alcorn D, Mendelsohn FAO: Rat renomedullary interstitial cells possess bradykinin type 2 receptors in vivo and in vitro. Clin Exp Pharmacol Physiol 26:48 -55, 1999[Medline]
  11. Dean R, Zhuo J, Alcorn D, Casley D, Mendelsohn FAO: Cellular localization of endothelin receptor subtypes in the rat kidney following in vitro labelling. Clin Exp Pharmacol Physiol 23:524 -531, 1996[Medline]
  12. Sexton PM, Zhuo J, Mendelsohn FAO: Localization and regulation of renal receptors for angiotensin II and atrial natriuretic peptide. J Exp Med 166:41 -56, 1992
  13. Swillens S: How to estimate the total receptor concentration when the specific radioactivity of the ligand is unknown. Trends Pharmacol Sci 13:430 -434, 1992[Medline]
  14. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE: Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 351:233 -236, 1991[Medline]
  15. Kakar SS, Sellers JC, Devor DC, Musgrove LC, Neill JD: Angiotensin II type-1 receptor subtype cDNAs: Differential tissue expression and hormonal regulation. Biochem Biophys Res Commun183 : 1090-1096,1992[Medline]
  16. Pesquero JB, Lindsey CJ, Zeh K, Paive ACM, Ganten D, Bader M: Molecular structure and expression of the rat bradykinin B2 receptor gene: Evidence for alternative splicing. J Biol Chem 269:26920 -26925, 1994[Abstract/Free Full Text]
  17. Maric C, Aldred GP, Antoine AM, Eitle E, Dean RG, Williams DA, Harris PJ, Alcorn D: Actions of endothelin-1 on cultured rat renomedullary interstitial cells are modulated by nitric oxide. Clin Exp Pharmacol Physiol 26:392 -398, 1999[Medline]
  18. Zhuo J, Alcorn D, McCausland JE, Casley D, Mendelsohn FAO: In vivo occupancy of angiotensin II subtype 1 receptors in rat renomedullary interstitial cells. Hypertension23 : 838-843,1994[Abstract/Free Full Text]
  19. Feng Y-H, Miura S-I, Husain A, Karnik S: Mechanisms of constitutive activation of AT1 receptors: Influence of the size of the agonist switch binding residue Asn. Biochem37 : 15791-15798,1998[Medline]
  20. Garcia-Perez A, Martin B, Murphy HR, Uchida S, Murer H, Cowley BD Jr, Handler JS, Burg MB: Molecular cloning of cDNA coding for kidney aldose reductase. J Biol Chem 264:16815 -16821, 1989[Abstract/Free Full Text]
  21. Burger-Kentischer A, Müller E, Thurau K, Beck FX: Hypertonicity-induced accumulation of organic osmolytes in papillary interstitial cells. Kidney Int55 : 1417-1425,1999[Medline]
  22. Krishnamurthi K, Zheng W, Verbalis AD, Sandberg K: Regulation of cytosolic proteins binding cis elements in the 5' leader sequence of the angiotensin AT1 receptor mRNA. Biochem Biophys Res Comm 245:865 -870, 1998[Medline]
Received for publication February 29, 2000. Accepted for publication August 2, 2000.




This article has been cited by other articles:


Home page
 Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Lee, Z. Wu, K. Sandberg, S-E. Yoo, and C. Maric
Posttranscriptional mechanisms contribute to osmotic regulation of ANG type 1 receptors in cultured rat renomedullary interstitial cells
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2006; 290(1): R44 - R49.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
F. McCulloch, R. Chambrey, D. Eladari, and J. Peti-Peterdi
Localization of connexin 30 in the luminal membrane of cells in the distal nephron
Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1304 - F1312.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
R. K. Handa, S. E. Handa, and M. K. S. Elgemark
Autoradiographic analysis and regulation of angiotensin receptor subtypes AT4, AT1, and AT(1---7) in the kidney
Am J Physiol Renal Physiol, November 1, 2001; 281(5): F936 - F947.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MARIC, C.
Right arrow Articles by ALCORN, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MARIC, C.
Right arrow Articles by ALCORN, D.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP