 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Departamento de Ciencias Fisiologicas, Facultad de Ciencias Biologicas,
Pontificia Universidad Catolica de Chile, Santiago, Chile
Department of Pharmacology, New York Medical College, Valhalla, New
York.
Correspondence to Dr. Nicholas R. Ferreri, Department of Pharmacology, New York Medical College, Valhalla, NY 10595. Phone: 914-594-4079; Fax: 914-347-4956; E-mail: nick_ferreri{at}nymc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
COX-1 is constitutively expressed in many cell types, whereas COX-2 gene transcription is induced by mitogens, growth factors, cytokines, and tumor promoters (1,5,6,7). The mRNA encoding COX isoenzymes (constitutive COX-1 and inducible COX-2) has been demonstrated in rat kidneys (8). Moreover, immunohistochemical localization studies have demonstrated that COX-2 is present in the peri-macula densa region and a subset of thick ascending limb (TAL) epithelial cells located in the cortex and outer medulla (9,10).
The regulation of renal COX-2 expression and function in vivo is not completely understood. However, this isoform is expressed during NaCl depletion (9,11,12) and is responsible for renal developmental changes, particularly morphogenesis of the nephron (13,14,15). Chronic dietary salt depletion produced a threefold increase in COX-2 immunoreactivity in cortical TAL cells and cells of the macula densa, which is an extension of the TAL and the renal tubular component of the juxtaglomerular apparatus that includes the glomerular afferent artery and contiguous mesangium (9). Although COX-2 expression is regulated by glucocorticoids in extrarenal cells (16), the effects of glucocorticoids (which have well described effects on renal function) on renal COX-2 expression have not been studied. This study was designed to assess the effects of endogenous glucocorticoids on renal COX-2 expression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Adrenalectomy
Animals (n = 24) were adrenalectomized (ADX) under general
anesthesia (17) with a
combination of ketamine (25 mg/kg, intraperitoneally) and xylazine (2.5 mg/kg,
intraperitoneally) and were maintained with normal rat chow and 0.9% NaCl in
the drinking water for 5 d after surgery. They were then randomly assigned to
two groups; one group received dexamethasone (DEX) (1 mg/kg per d,
subcutaneously) for 2 d (ADX plus DEX group, n = 12) and the other
group received saline solution (ADX group, n = 12). DEX (Oradexon, 5
mg/ml; NV Organon, Oss, Holland) was dissolved in sterile saline solution, to
yield a 1 mg/ml solution, before administration. Other experimental groups
(n = 6 each) consisted of sham-operated rats that were treated with
DEX or vehicle, as described above. The animals were maintained in the
Pontificia Universidad Catolica de Chile animal care facilities, and the
experimental procedures were in accordance with institutional and
international standards for the humane care and use of laboratory animals
(Animal Welfare Assurance Publication A5427-01, Office for Protection from
Research Risks, Division of Animal Welfare, National Institutes of Health). At
the appropriate times, the kidneys were removed under anesthesia
(ketamine/xylazine); one kidney was used for morphologic analysis and the
other kidney for reverse transcription (RT)-PCR, Western blot analysis, and
COX activity studies.
Tissue Processing and Immunohistochemical Analyses
The localization of COX-2 protein was evaluated by immunohistochemical
analysis using specific antibodies (see below). The cellular origin of COX-2
was assessed by two complementary methods, i.e., immunostaining of
consecutive sections with antibodies against COX-2 and Tamm-Horsfall
glycoprotein (a specific marker for TAL cells)
(18) and sequential
double-immunolabeling for COX-2 and Tamm-Horsfall glycoprotein in the same
tissue sections. Macrophages, which are a possible source of COX-2, were
identified with a monoclonal antibody (ED1) to a cytoplasmic antigen present
in monocytes and macrophages
(19). The renal tissue samples
from the different groups were coded and studied independently, in a blinded
manner, by two expert observers who were not aware of the codes. Renal slices
(3-mm thick), including the cortex, medulla, and papilla, were fixed by
immersion in Bouin's solution for 24 h at room temperature. The tissue was
then dehydrated, embedded in Paraplast plus (Monoject Scientific, St. Louis,
MO), serially sectioned at 5-µm thickness with a rotatory microtome,
mounted on glass slides, and stored until immunostaining.
Single-Immunolabeling in Consecutive Sections
Immunostaining was performed using an indirect immunoperoxidase technique,
as described previously, to localize COX-2 and other proteins in normal rat
kidneys (10). Briefly, for
sequential double-immunolabeling for COX-2 and Tamm-Horsfall glycoprotein,
consecutive tissue sections were dewaxed, rehydrated, rinsed in 0.05 M
Tris-phosphate-saline (TPS) buffer (pH 7.6) and incubated with the primary
antiserum overnight at 22°C, followed by 30-min incubations at 22°C
with the secondary antibody (1:20) and then the peroxidase-antiperoxidase
(PAP) complex (1:150). Peroxidase activity was detected by incubation of the
sections with 0.1% (wt/vol) 3,3'-diaminobenzidine and 0.03% (vol/vol)
hydrogen peroxide. When a monoclonal antibody (ED1) was used, incubation with
a rabbit antimouse IgG antibody was included as a link between the primary and
secondary antibodies. The antisera and PAP complex were diluted in TPS buffer
containing 0.25% (vol/vol) Triton X-100 and 0.7% (wt/vol)
-carrageenan. The sections were rinsed with TPS buffer between
incubations, counterstained with hematoxylin, dehydrated and cleared with
xylene, and coverslipped.
Double-Immunolabeling in the Same Tissue Sections
This technique was performed with a modification of a previously described
procedure (20). Sections were
incubated overnight at 22°C with the first primary antibody (anti-murine
COX-2), followed sequentially by unlabeled secondary antibody, PAP complex,
and diaminobenzidine/hydrogen peroxide for color development, yielding a brown
color. Incubation in 3% hydrogen peroxide/methanol for 20 min eliminated any
remaining peroxidase activity. Subsequently, the second primary antibody
(anti-Tamm-Horsfall glycoprotein) was applied overnight at 22°C, followed
by unlabeled secondary antibody, PAP complex, and Vector SG substrate (Vector
Laboratories, Burlingame, CA) as the second reagent for color development,
yielding a blue reaction product. The sections were dehydrated and cleared
with xylene and then coverslipped, without hematoxylin counterstaining.
Controls for the immunostaining procedures included preabsorption of the
primary antibody with the COX-2 carboxyl-terminal peptide, omission of the
primary antibody, and replacement of the primary antibody with normal or
preimmune rabbit serum. The tissue sections were observed and photographed
using a Nikon Optiphot microscope with a Nikon Microflex UFX IIA photographic
system (Nikon Corp., Tokyo, Japan).
Antisera and Chemicals
Specific antibodies (dilution, 1:200 to 1:800) raised against peptides (15
to 29 amino acids) derived from carboxyl-terminal amino acid sequences unique
to murine COX-2 were used. Two of the antisera were of rabbit origin. One
antiserum was raised in our laboratory, as described
(10). The second antiserum,
160106, was purchased from Cayman Chemicals (Ann Arbor, MI)
(13,21).
A third antiserum (SC-1747, of goat origin) was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). The specificity of these antisera was
previously established by Western blotting and immunohistochemical analyses
(10,13,21).
The monoclonal antibody against macrophages (ED-1)
(19), which was used at a
1:400 dilution, was purchased from Serotec (Oxford, England). Secondary
antibodies and the corresponding PAP complexes were purchased from INC
Pharmaceuticals-Cappel (Aurora, OH). Triton X-100,
3,3'-diaminobenzidine, -carrageenan, Tris-HCl, hydrogen
peroxide, phosphate salts, and other chemicals were purchased from Sigma
Chemical Co. (St. Louis, MO).
Quantitative Morphologic Analyses
TAL cells were identified by the presence of Tamm-Horsfall glycoprotein and
the anatomic arrangement of rays beginning in the cortex (juxtaglomerular
apparatus) and ending in the medulla
(22). The percentage of TAL
cells containing COX-2 was quantitated in consecutive sections stained
alternately for Tamm-Horsfall glycoprotein and COX-2. In axially sectioned TAL
tubules, COX-2-positive TAL cells were counted and expressed as percentages of
the total numbers of TAL cells counted in the consecutive sections, according
to the following formula: % COX-2 = number of COX-2-positive TAL cells/total
number of TAL cells x 100.
Western Blot Analyses
Renal microsomes were prepared as described previously
(23). Renal tissues were
lysed, and protein concentrations were determined using a detergent-compatible
Bio-Rad protein assay kit (Bio-Rad, Richmond, CA). Sixty micrograms of renal
microsomes were mixed with an equal volume of 2x sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis sample buffer (100 mM Tris-HCl, pH
6.8, 200 mM dithiothreitol, 4% SDS, 0.2% bromphenol blue, 20% glycerol) and
were boiled for 3 min. The proteins in renal microsomes were separated on 10%
SDS-polyacrylamide gels and transferred to either nitrocellulose or
polyvinylidene difluoride membranes. Nonspecific sites on the membranes were
blocked by incubation in blocking solution (5% nonfat dry milk in
Tris-buffered saline-Tween) for 30 min at room temperature. After blocking,
membranes were probed with the rabbit polyclonal antibody against murine COX-2
(which was also used for immunohistochemical analyses) for 1 h at room
temperature, washed with Tris-buffered saline-Tween, and incubated with
horseradish peroxidase (HRP)-conjugated antiserum. Proteins were detected
using enhanced chemiluminescence or enhanced chemifluorescence/PhosphorImaging
techniques.
Isolation of Total RNA and RT-PCR Analyses
Total RNA was isolated using Trizol reagent (Life Technologies) and
precipitation with isopropyl alcohol. A 3-µg aliquot of total RNA was used
for cDNA synthesis, using the Superscript preamplification system (Life
Technologies), in a 20-µl reaction mixture containing Superscript II
reverse transcriptase (200 U/µl) and random hexamers (50 ng/µl). The
reaction mixture was incubated at room temperature for 10 min to allow
extension of the primers by reverse transcriptase, and was then incubated at
42°C for 50 min, at 70°C for 15 min, and at 4°C for 5 min. An
aliquot of the cDNA was then amplified using Taq DNA polymerase (2.5
U) in the presence of sense and antisense primers (1 µM) for murine COX-2
or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The following primer sets
were used: COX-2 sense, TACAAGCAGTGGCAAAGGC; COX-2 antisense,
CAGTATTGAGGAGAACAGATGGG; GAPDH sense, ACCACAGTCCATGCCATCAC; GAPDH antisense,
TCCACCACCCTGTTGCTGTA. The PCR primer sets for COX-2 and GAPDH amplified
fragments with transcript sizes of 304 and 452 bp, respectively. Amplification
(35 cycles) was performed with denaturation for 1 min at 94°C, annealing
for 1 min at 53°C, and polymerization for 2 min at 72°C, followed by
autoextension for 8 min at 72°C. Preliminary experiments were performed to
ensure that PCR was performed within the linear range of product
formation.
Assessment of COX Activity
COX activity was assessed in renal cortical microsomes (50 µg) that had
been incubated for 10 min with AA (7 µM) in a Tris buffer (pH 8.0)
containing tryptophan (5 mM), hematin (1 µM), glutathione (1 mM), and
epinephrine (10 mM). Prostanoids were extracted from the aqueous phase of the
reaction buffer three times with 2 vol of ethyl acetate, and PGE2
concentrations in the extracted samples were determined by enzyme-linked
immunosorbent assay (Oxford, MI). Briefly, samples and HRP-conjugated
PGE2 were added for 1 h to wells of a 96-well plate, which were
coated with anti-PGE2 antibody. Substrate for HRP was added to each
well for 30 min, and the reaction was stopped by addition of 1N HCl.
Quantitation was performed by measuring absorbance at 450 nm; protein
concentrations were determined using the Bradford method.
Statistical Analyses
The differences among percentages of COX-2-positive TAL cells were assessed
with the Kruskal-Wallis test. The t test was used to detect
differences in COX activities; P < 0.05 was considered
significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
50 µg (100, 250, or 500 µg/kg per d) (Vio CP,
unpublished observations).
|
|
|
ADX Induction of TAL COX-2 Protein Expression
In sham-operated or untreated rats, the expression of COX-2 protein was
observed in small scattered groups of epithelial cells belonging to TAL
tubules located in the outer medulla and cortex
(Figure 2, a and b). The number
of COX-2-positive cells increased greatly in ADX animals. Moreover,
recruitment of COX-2-positive TAL cells toward the more medullary portion of
the TAL was observed after ADX (Figures
1b and
3c). Thus, whereas COX-2 was
observed in TAL cells close to the corresponding glomeruli of sham-operated or
untreated rats, the increased numbers of COX-2-positive TAL cells in ADX rats
yielded nearly continuous staining of TAL epithelial cells, intermingled with
a few COX-2-negative TAL cells (Figures
2 and
3b). A more detailed
examination of COX-2-positive TAL cells along axially sectioned tubules was
performed to assess whether the increase in the percentage of COX-2-positive
TAL cells was attributable to random expression or a defined recruitment
pattern along the TAL segment. This analysis demonstrated that, whereas
COX-2-positive TAL cells in shamoperated rats were confined to a few cells in
the outer cortex (Figure 1a),
the increased expression of COX-2 observed after ADX followed a well defined
pattern of recruitment of COX-2-positive TAL cells toward the outer medulla
(Figures 2 and
3, b and c).
Lack of Increase in COX-2 Protein Expression in Renal Macrophages
after ADX
Because ADX was previously shown to increase COX-2 expression in murine
peritoneal macrophages (24),
renal macrophages were identified with a specific monoclonal antibody (ED-1),
to assess the possible contribution of these cells to the COX-2 expression
pattern. As shown in Figures
1,2,3,
COX-2 protein expression was restricted to tubular epithelial cells. No
staining was observed in the few macrophages located within the
tubulointerstitium. Moreover, neither ADX nor DEX treatment altered the number
of macrophages observed in each field. These data support the observation that
the increase in COX-2 expression after ADX is restricted to tubular epithelial
cells of the cortical and outer medullary TAL.
ADX-Induced Increases in COX-2 mRNA Accumulation and Protein
Expression and Effects of DEX
Immunohistochemical analysis of COX-2 protein expression was confirmed by
assessment of COX-2 mRNA accumulation and protein expression. Analysis of
total RNA from renal cortex revealed small amounts of COX-2 mRNA in
shamoperated rats, which increased after ADX; no concomitant increase in GAPDH
mRNA accumulation was observed (Figure
4). This increase was attenuated when ADX animals were treated
with DEX (Figure 4). Similarly,
a substantial increase in COX-2 protein expression was observed in cortical
microsomes obtained from ADX rats, and treatment with DEX attenuated this
increase (ADX group, 0.34 ± 0.12 arbitrary units; ADX plus DEX group,
0.02 ± 0.01 arbitrary units; n = 4, P < 0.01)
(Figure 5).
|
|
Analysis of COX Activity
Renal cortical microsomes were prepared from kidneys removed from each of
the treatment groups, for assessment of the effects of ADX on COX activity.
PGE2 formation was more than twofold higher in microsomes prepared
from ADX rats, compared with sham-operated or untreated control rats
(Figure 6). Treatment with DEX
abolished the increase in PGE2 formation induced by ADX
(Figure 6). These data indicate
that COX-2 protein expressed in response to ADX is enzymatically active, and
they suggest that endogenous glucocorticoids may affect COX-2 expression via a
mechanism that regulates protein expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The phenomenon of induction, which is described herein for COX-2 in the TAL, is similar to the well described developmental recruitment of renin-containing myoepithelial cells in afferent arterioles (25). In fetal and neonatal life, renin is expressed in large sections of the preglomerular vasculature, including afferent arterioles and interlobular arteries. Expression decreases with maturation and, in adult animals, is restricted to a small number of myoepithelial cells in the afferent arterioles close to the glomeruli (25). In adult animals, interruption of the inhibitory feedback mechanism mediated by angiotensin II, in response to inhibition of angiotensin-converting enzyme, resulted in recruitment of myoepithelial cells expressing renin (26). Therefore, blockade of this inhibitory mechanism elicited derepression of renin expression, resulting in recruitment of cells that did not express renin in the basal state. We postulate that, in adult rats, COX-2 in the TAL is under tonic inhibition by glucocorticoids. This inhibitory mechanism is removed after ADX, resulting in induction and recruitment of COX-2-expressing TAL cells. A similar mechanism may have contributed to the regulation of COX-2 expression in murine peritoneal macrophages, inasmuch as ADX produced two- to threefold elevations of COX-2 mRNA and protein levels in these cells, an effect that was suppressed by replacement with DEX (16). Similarly, DEX inhibited platelet-induced COX-2 expression in mesangial cells (27). Our results are also in agreement with the recent study by Zhang et al. (28), who reported that upregulation of renal COX-2 expression after ADX was reversed by replacement therapy with either corticosterone or deoxycorticosterone. These data suggest that factors other than the removal of glucocorticoids could contribute to the regulation of COX-2 in the kidney. In contrast to the study of Zhang et al. (28) and this study, no signs of COX-2 induction were observed in the kidneys of ADX mice (16). This discrepancy can be explained by the use of renal medullary microsomes (16,24), compared with the use of cortical microsomes in the study by Zhang et al. (28) and in this study. Moreover, a study investigating the distribution of COX-2 in dissected nephron segments demonstrated COX-2 expression in the macula densa-containing segment, cortical TAL, and inner medullary collecting ducts, in an approximate ratio of 100:10:1 (12), confirming that the principal source of COX-2 in tubular cells is the TAL segment. The abundant COX-2 expression in the inner medulla is likely attributable to extratubular cells such as interstitial cells (12).
Recently, elegant studies by Zhang et al. (14) linked COX-2 to the differentiation and maturation of nephrons. COX-2 mRNA and protein expression were observed by the 16th embryonic day, remained low until birth, peaked in the first 2 wk after birth, and subsided to the low levels characteristic of adults by approximately the sixth postnatal week. These observations were confirmed by Vio et al. (15); the small numbers of COX-2-positive cells observed during early postnatal life increased from day 5 to day 15 and then decreased to adult levels. The percentages of TAL cells displaying COX-2 were 2.6, 7.8, 20.2, and 1.8% at 5, 10, 15, and 60 d of age, respectively (15). These studies support the existence of a reciprocal relationship between glucocorticoid levels and renal COX-2 expression, inasmuch as increased expression of renal COX-2 was evident during the first 2 to 3 wk after birth, when plasma levels of glucocorticoids were very low, suggesting derepression of COX-2 (29). Interestingly, a subset of cortical TAL cells in adult rats express low levels of COX-2 mRNA and protein (9,10). COX-2 expression in these cells appears to be insensitive to DEX administration, possibly because the cells are devoid of glucocorticoid receptors, which are expressed at higher densities in medullary TAL than in cortical TAL (30). Therefore, the glucocorticoid receptor distribution gradient is inversely proportional to the expression of COX-2; COX-2 expression is relatively abundant in the cortical TAL and decreases toward the outer medullary TAL, whereas glucocorticoid receptor expression is more abundant in the medullary TAL and decreases toward the cortical TAL. This suggests that, in adult rats, COX-2 expression is under the tonic inhibitory control of glucocorticoids, an effect that is unmasked by ADX. Glucocorticoid repression of COX-2 may be a protective mechanism against fibrosis, because induction of COX-2 under abnormal conditions (such as in the remnant kidney) may mediate tissue fibrosis and cell proliferation in glomeruli and the tubulointerstitium (31).
The observation of restricted distribution of COX-2 within TAL segments is not easily explained in terms of cell heterogeneity, because the TAL is derived from only one cell type, with very well defined features. The obvious exception is the macula densa, which is situated within and is functionally part of the TAL. Although subtle structural differences between medullary and cortical TAL have been observed, they develop gradually and may be unrelated to the differential expression of COX-2 (32,33,34). Serious consideration should be given to the possibility that the uneven (or scattered) distribution of COX-2 in the TAL could correspond to the previously described smooth- and rough-surface subtypes of TAL cells (33,34). It is interesting to note that the distribution of ROMK channels in the kidney also exhibits cellular heterogeneity along the TAL, as demonstrated using immunohistochemical methods (35). The eventual ultrastructural characterization of this subset of cells may have important functional implications, indicating either a different phenotype of TAL cells or a different functional state of TAL cells in response to the induction and recruitment phenomena.
The absence of COX-2 expression in the macula densa in this study may be related to differences in our experimental conditions, compared with those used by other investigators (9). For example, COX-2 expression in the macula densa of rats with normal sodium intake may be below the level of detection of our immunohistochemical methods. However, this was not the case after ADX, when the increase in COX-2 expression was observed without a concomitant increase in macula densa COX-2 levels. Perhaps a low-sodium diet is a selective stimulus for macula densa COX-2 expression, as suggested by Zhang et al. in their study of rat nephron development; those authors stated that "intense COX-2 immunoreactivity fills the cytoplasmic domain of cells that are concentrated in the vicinity of the nascent macula densa, but COX-2 immunoreactivity is not observed in the macula densa cells themselves" (14).
The differential expression of COX isoforms in the kidney may have important functional consequences. For example, recent studies demonstrated that COX isoforms are differentially regulated, in a zone-specific manner, by dietary salt (12), suggesting that COX-2 may have different functions in the cortex (vascular resistance) and medulla (salt and water homeostasis). Regarding the functional significance of COX-2 in TAL cells, this isoform participates in the regulation of tubuloglomerular feedback (36), the modulation of afferent arteriolar responses to increases in pressure (37), and renin release (38,39). Recent work from our laboratory demonstrated that TNF-mediated decreases in rubidium uptake (an in vitro correlate of natriuresis) by primary cultures of medullary TAL cells were COX-2 dependent (8). Moreover, ADX has been associated with a decrease in sodium reabsorption by the loop of Henle (40). Therefore, the preferential expression of COX-2 in the cortex, with extension to the corticomedullary junction, after ADX may reflect a functional adaptation to conserve salt in the absence of aldosterone. These findings suggest that the concept of COX-2 expression in the kidney, and other tissues only under pathologic conditions should be expanded to include enzyme expression also in normal tissue with regulation in a manner that permits participation in physiologic compensatory mechanisms (41).
In summary, ADX induces expression of enzymatically active COX-2 in the kidney, suggesting that renal COX-2 expression is subject to tonic inhibition by endogenous glucocorticoids. The induction of COX-2 in the cortical TAL after ADX proceeds in a defined pattern from the cortex toward the outer medullary TAL, indicating recruitment of TAL cells that, in the basal state, either do not express COX-2 or express it at levels below the threshold of detection.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Villanueva, C. Cespedes, A. A. Gonzalez, E. Roessler, and C. P. Vio Inhibition of bFGF-receptor type 2 increases kidney damage and suppresses nephrogenic protein expression after ischemic acute renal failure Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R819 - R828. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Eng, S. Mukhopadhyay, C. P. Vio, P. L. Pedraza, S. Hao, S. Battula, P. B. Sehgal, J. C. McGiff, and N. R. Ferreri Characterization of a long-term rat mTAL cell line Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1413 - F1422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Villanueva, C. Cespedes, A. A. Gonzalez, C. P. Vio, and V. Velarde Effect of ischemic acute renal damage on the expression of COX-2 and oxidative stress-related elements in rat kidney Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1364 - F1371. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Villanueva, C. Cespedes, A. Gonzalez, and C. P. Vio bFGF induces an earlier expression of nephrogenic proteins after ischemic acute renal failure Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1677 - R1687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Villanueva, C. Cespedes, and C. P. Vio Ischemic acute renal failure induces the expression of a wide range of nephrogenic proteins Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R861 - R870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Rodriguez, P. De la Cerda, E. Collyer, V. Decap, C. P. Vio, and V. Velarde Cyclooxygenase-2 induction by bradykinin in aortic vascular smooth muscle cells Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H30 - H36. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Baber, W. Deng, J. Rodriguez, R. G. Master, T. J. Bivalacqua, A. L. Hyman, and P. J. Kadowitz Vasoactive prostanoids are generated from arachidonic acid by COX-1 and COX-2 in the mouse Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1476 - H1487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Rodriguez, C. P. Vio, P. L. Pedraza, J. C. McGiff, and N. R. Ferreri Bradykinin Regulates Cyclooxygenase-2 in Rat Renal Thick Ascending Limb Cells Hypertension, August 1, 2004; 44(2): 230 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Madsen, J. Stubbe, T. Yang, O. Skott, S. Bachmann, and B. L. Jensen Low endogenous glucocorticoid allows induction of kidney cortical cyclooxygenase-2 during postnatal rat development Am J Physiol Renal Physiol, January 1, 2004; 286(1): F26 - F37. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-Z. Zhang, S.-w. Wang, H. Cheng, Y. Zhang, J. A. McKanna, and R. C. Harris Regulation of renal cortical cyclooxygenase-2 in young rats Am J Physiol Renal Physiol, November 1, 2003; 285(5): F881 - F888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hocherl, M. C. Kammerl, K. Schumacher, D. Endemann, H. F. Grobecker, and A. Kurtz Role of prostanoids in regulation of the renin-angiotensin-aldosterone system by salt intake Am J Physiol Renal Physiol, August 1, 2002; 283(2): F294 - F301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Kammerl, W. Richthammer, A. Kurtz, and B. K. Kramer Angiotensin II feedback is a regulator of renocortical renin, COX-2, and nNOS expression Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1613 - R1617. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wang, S.-J. An, W.-H. Wang, J. C. McGiff, and N. R. Ferreri CaR-mediated COX-2 expression in primary cultured mTAL cells Am J Physiol Renal Physiol, October 1, 2001; 281(4): F658 - F664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Leon, J. Marchetti, and C. P. Vio Renal Cyclooxygenase-2: Evidence for Recruitment of Thick Ascending Limb of Henle Cells in Microdissected Nephron Segments Hypertension, September 1, 2001; 38(3): 630 - 634. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
