 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
Department of Nephrology, Soroka University Medical Center, Ben-Gurion University of the Negev, Faculty of Health Sciences, Beer-Sheva, Israel.
Correspondence to Dr. Amos Douvdevani, Nephrology Laboratory, Soroka Medical Center, P.O. Box 151, Beer-Sheva 84101, Israel. Phone: + +972-7-6403214; Fax: + +972-7-6281361; E-mail: amosd{at}bgumail.bgu.ac.il
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(IFN, 5U/ml) or TNF
(1 ng/ml), there was a small increase in
CD40 mRNA and protein levels; when both cytokines were applied, the increase
in CD40 levels was more than threefold. CD40 ligation induced IL-15 production
by HPMC and was additive to IFN stimulation. CD40 ligation was strongly
synergistic with IFN in induction of RANTES (20-fold as compared with
unstimulated HPMC), whereas neither ligation nor IFN alone could induce
RANTES. Pretreatment of HPMC with TNF and IFN increased the
response to CD40 ligation in magnitudes that correlated with the elevation of
CD40 levels induced by the pretreatment. To conclude, the presence of a
functional CD40 on HPMC whose ligation induced IL-15 and RANTES production was
detected. It is possible that this receptor acts as a major mediator of
T-cell—regulated immune and inflammatory response during
peritonitis. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
[TNF], and interferon-
[IFN]), thus amplifying the inflammatory signals and inducing effective
endothelial activation, which are required for migration of leukocytes to the
peritoneal cavity
(4,5,6,7,8,9).
Li et al. (2)
demonstrated that the chemokines IL-8, MCP-1, and RANTES are mainly secreted
from a monolayer of HPMC into the apical compartment and suggested that this
mechanism is important for the recruitment of leukocytes from blood vessels
into the peritoneum. We recently demonstrated that HPMC support T-cell
activation by presenting antigen and by secreting IL-15, a T-cell growth
factor and activator (10). In
the current study, we further investigated lymphocyte-mesothelial cross talk
by examining the possibility that the CD40 activation pathway functions in
mesothelial cells. CD40 is a cell surface receptor that belongs to the tumor
necrosis factor receptor family. It was originally identified and functionally
characterized on B lymphocytes. Its critical role in T-cell—dependent
humoral immune responses has been demonstrated in patients with hyper-IgM
syndrome, as well as by gene targeting in mice
(11). In recent years,
however, it has become clear that CD40 is expressed also on monocytes,
dendritic, endothelial, and epithelial cells
(11). The CD40 ligand (CD154),
a member of the TNF family, is mainly expressed on activated CD4-positive T
cells. Using CD154, Th cells activate CD40 on their target cells by direct
cell-to-cell contact. Activation of CD40 induces the secretion of cytokines
and chemokines and upregulates the expression of adhesion and accessory
molecules to increase the efficiency of antigen presentation
(11). The central role of CD40
in immune response is best illustrated by its role in graft rejection.
Blocking CD154 molecules effectively reduced graft rejection in various
experimental models and, as recently demonstrated, prevents acute rejection of
renal graft in nonhuman primates
(12).
There are no data concerning the expression of CD40 on mesothelial cells.
However, from the data accumulated on the role of CD40 in other tissues, we
hypothesized that CD40 ligation on HPMC might be a pathway used by T helper
cells to regulate an inflammatory and immune response in the peritoneum. We
therefore tested mesothelial cells for the presence of CD40 and for its
functionality in inducing the secretion of IL-15 and RANTES. Another reason
for testing the effect of CD40 ligation on those factors is that the authors
previously found that CD40 ligation upregulates IL-15 in tubular epithelial
cells (TEC) in addition to others' observation that CD40 induces IL-15
upregulation on dendritic cells and upregulates RANTES secretion by TEC and
endothelial cells
(13,14,15,16).
We were especially interested in IL-15 and RANTES because both are involved in
T-cell recruitment and activation. IL-15 is a T-cell chemoattractant and a
potent T-cell activator with biologic functions similar to those of IL-2
(17). IL-15—deficient
mice (IL-15 -/-) are lymphopenic and specifically lack natural killer (NK)
cells and memory CD8-positive T cells and have a compromised immune response
to various pathogens (18). We
previously reported that HPMC produce IL-15 and that IFN upregulates
its production (10). RANTES is
a chemotactic cytokine for T lymphocytes, monocytes, and eosinophils and
belongs to the CC subfamily of chemokines. Secretion of RANTES and other
chemokines from HPMC in response to cytokines or bacterial stimulation have
also been reported
(2,4,9,19).
On the basis of these observations, the aim of this study was to show whether
mesothelial cells express CD40 and to demonstrate the role of CD40-CD154
ligation in upregulation of IL-15 and RANTES synthesis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD154 Expressing L Cells. For CD40 activation, we used a cell line of mouse fibroblast L cells, transfected with the complete human CD154 coding sequence and a neomycin resistance gene for selection of stable transfectants. Both types of cells were cultured in RPMI and supplemented with 10% heat-inactivated fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (Biological Industries, Bet Haemek, Israel). The parental nontransfected cells (L cells) were used as the negative control. Both parental and CD154-transfected cells were kindly supplied by Schering-Plough Corporation (Dardilly, France) and have been described (21). CD40 activation using CD154-expressing cells is commonly used to activate CD40 on various cell types in different experimental models (16,21,22).
HPMC Activation Protocols
Induction of CD40 for RNA Analysis and Flow Cytometry. For RNA
analysis, HPMC were seeded in 24-well plates (2 x 104
cells/well) and cultured to confluence. HPMC were washed twice with medium and
incubated for 6 h with medium alone or with medium containing IFN (5
U/ml; Peprotech, Rocky Hill, NJ) or TNF (1 ng/ml; R&D System,
Minneapolis, MN) or with a combination of both cytokines. After stimulation,
supernatants were removed and RNA was extracted from the cells. Preliminary
experiments indicated that CD40 mRNA reach peak levels at approximately 6 h.
For flow cytometry, HPMC were grown in 75 cm2 flasks and incubated
for 16 h with medium or with cytokines in the same concentrations and
combination as for RNA analysis.
Activation of HPMC for the Production of IL-15 and RANTES. HPMC were
seeded in 12-well plates (4 x 104 cells/well) for IL-15
analysis or 24-well plates (2 x 104 cells/well) for RANTES
and cultured to confluence. HPMC were washed twice with medium and incubated
with IFN in various concentrations, or with CD40L cells (expressing
CD154) or control L cells (3 x 105 in 12-well plates or 5
x 104 in 24-well plates) or with a combination of IFN
and the cells. For IL-15 analysis, the final incubation volume was 0.75 ml and
the incubation time was 72 h and for RANTES, 0.5 ml and 24 h. To prevent
overgrowth of L cells and CD40L cells in the co-culture experiments, were grew
them in the M-199 medium, which inhibits fibroblast growth, for the last 24 h
before harvesting. For total IL-15 (secreted and cell associated) analysis at
the end of incubation, plates were placed on ice and cells were lysed by
adding NP40 to a final concentration of 0.1%. Lysates were collected and
stored at -20°C. For RANTES assay, supernatants from 24-well plates were
collected and stored at -20°C. Cells from two wells were counted in each
plate for definition of cell number per well. All tissue culture reagents
contained less than 0.025 ng/ml of endotoxin.
Increase of CD40 Expression. To increase CD40 expression on HPMC,
we performed several experiments after 16 h of preincubation of HPMC with
TNF (1 ng/ml) or with IFN (5 U/ml) or with a combination of both
and then activated with IFN and CD40L cells for 24 h.
CD154 Blocking. In some experiments, we blocked CD154 on CD40L cells by pretreating these cells for 60 min with anti-CD154 monoclonal antibodies (1 µg/ml, clone 24 to 31; Ancell, Bayport, MA). An isotype-matched antibody at the same concentration was used as a control.
Transwell Experiments. A six-well Transwell system (Corning Costar Corporation, Cambridge, MA) was used to conduct co-culture experiments. The system consists of two compartments: a top well with a porous matrix (0.4-µm pore size) and a bottom well. This set-up allows co-culture of two types of cells to grow in the same medium with soluble factors exchanged through the pores while preventing direct contact between them. HPMC were grown to confluence in the bottom well, and L cells were added either to the same well—allowing contact—or in the top well—avoiding contact.
Flow Cytometry Analysis of CD40
For flow cytometry analysis, HPMC were harvested by
ethylenediaminetetraacetate solution (1:2000, Biological Industries), then
washed and incubated in 100 µl of phosphate-buffered saline containing 0.5%
bovine serum albumin and 0.05% sodium azide for 1 h on ice with anti-CD40
monoclonal antibodies (clone EA-5; Ancell). The cells then were washed and
incubated with fluorescein (FITC)-conjugated F(ab') anti-mouse IgG
(Jackson, West Grove, PA). The antibodies were diluted to recommended
concentrations according to the manufacturer's instructions. Background
fluorescence was adjusted with cells labeled with matching isotype control
antibodies as the first antibody. HPMC had no affinity to control antibodies,
and fluorescence levels were always similar to that seen in nonstained cells.
Analyses were done on a Coulter flow cytometer (Epics XLMCL, Miami, FL).
mRNA Analysis
CD40 mRNA was determined by reverse transcription-PCR (RTPCR) of total RNA
extracted from HPMC. HPMC were incubated as described above. At the end of
each experiment, total RNA was extracted from cells using the RNeasy Mini Kit
(Qiagen, Hilden, Germany). The RNA suspension was converted immediately to
cDNA.
For cDNA generation, to each 7 µl of reverse transcriptase reaction mixture, 13 µl of RNA sample was added. The reaction mixture contain 1 µl of Moloney murine leukemia virus-reverse transcriptase (MMLV-RT; 200 U/µl; Life Technologies BRL, Gaithersburg, MD), 4 µl of 5 x reverse transcriptase buffer (Life Technologies BRL), 0.5 µl DTT (0.1 M, Life Technologies BRL), 0.5 µl RNase inhibitor (40 U/µl; Sigma, Rehovot, Israel), 1 µl of oligo-d(T) 12 to 18 mer (40 pmol/µl, Roche), and 1 µl of dNTP (2.5 nmol/µl each nucleotide; Sigma). The reaction tube was incubated for 1 h at 37°C, then the volume of each sample was adjusted to 60 µl and the enzyme was inactivated by incubation for 10 min at 65°C.
CD40 and ß-actin cDNA were then amplified by PCR using specific primers: CD40 sense, AGAGTTCACTGAAACGGAATGCC; CD40 antisense, ACAGGATCCCGAAGATGATGG; ß-actin sense, ATGGATGATGATATCGCCGCG; ß-actin antisense, CTAGAAGCATTTGCGGTGGACGATGGAGGGGCC. Five µl of reverse transcription product was added to 45 µl of PCR reaction mixture containing 32.75 µl of H2O, 2.5 µl of 5' primer (20 µM), 2.5 µl of 3' primer (20 µM), 2 µl of dNTP (2.5 nmol/µl each nucleotide; Sigma), 5 µl of 10 x reaction buffer, and 0.25 µl Taq DNA polymerase (Sigma). A negative control consisting of the reaction mixture without cDNA was included in each run. PCR was run for 20 to 25 cycles with ß-actin primers under the following conditions: 90 s at 95°C, then 5 to 10 cycles of 45 s each at 95°C, 90 s at 60°C, and 60 s at 72°C. The last 15 cycles were run under the same conditions but at 72°C; incubation was prolonged by 5 s in each cycle. PCR with CD40 primers was run with the same protocol except that the annealing temperature was 55°C instead of 60°C. Every experiment was amplified with at least two different numbers of cycles to ensure that amplification was in the exponential phase of PCR.
We found that 30 to 35 cycles for CD40 and 20 to 25 cycles for ß-actin were in the exponential phase of amplification, thus permitting comparison of mRNA levels in different samples. Under these conditions, we also found a linear dose response of the PCR product to increasing doses of cDNA.
Eight µl of each sample containing amplified cDNA were loaded on an agarose gel (1.5%) containing ethidium bromide (0.5 µg/ml). A DNA size marker was run on the same gel ("100 bp ladder"; Life Technologies BRL). PCR products were quantified by video densitometry of agarose gel with the ImageMaster VDS-CL (Amersham Pharmacia Biotech, Freiburg, Germany). To correct for differences in loading, we corrected densitometric values of CD40 cDNA with corresponding values of ß-actin cDNA. To allow comparison of different gels, we normalized the densitometric CD40/ß-actin ratios for the IL-15/ß-actin ratio of the unstimulated HPMC run in each gel.
Enzyme-Linked Immunosorbent Assay of IL-15 and RANTES
IL-15 and RANTES in supernatants and cell lysates were measured in
duplicate using enzyme-linked immunosorbent assay (ELISA) to human IL-15 or
RANTES made with commercially available antibodies and standards (R&D
Systems). ELISA was performed according to the manufacturer's protocol; for
IL-15, we used monoclonal anti-human IL-15 antibody (type MAB647) and
biotinylated monoclonal anti-human IL-15 antibody (type BAM247). The range of
the IL-15 ELISA was 3 to 300 pg/ml, and the sensitivity was 2.0 pg/ml. For
RANTES, we used monoclonal anti-human RANTES (type MAB678) and biotinylated
monoclonal anti-human RANTES antibody (type BAF278). The range of the RANRES
ELISA was 39 to 2500 pg/ml, and the sensitivity was 10 pg/ml. For detection,
we used streptavidin horseradish peroxidase (type 43-4323; Zymed, San
Francisco, CA; 1:20,000) and tetramethylbenzidine solution (TMBSingle
Solution; Zymed). ELISA reaction was stopped with H2SO4
(2 N). Optical density was read with an ELISA reader at 450 nm and at 550 nm
for reference.
Statistical Analyses
Results are expressed as mean ± SEM. To compare levels between
groups, either Dunnet's method of multiple analysis and a one-way ANOVA or a
two-way ANOVA was used. P values below 0.05 were considered
significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(1 ng/ml) or IFN (5 U/ml), and when both cytokines were
applied, a synergistically fourfold increase in CD40 mRNA levels was observed.
As shown in Figure 2, CD40
protein levels, as analyzed by flow cytometry, correlated with mRNA levels.
Similar to mRNA levels, we found a constitutive expression of CD40 on
unstimulated cells, a small increase in the mean (28 or 61%) after TNF
or IFN stimulation, and a synergism between TNF and IFN
that increased CD40 protein by threefold.
|
|
Activation by CD40L Cells
To demonstrate CD40 functionality, we assayed the effect of CD40 activation
by CD154 on IL-15 and RANTES production. The interaction between HPMC and
activated T cells involves many molecules apart from CD40/CD154. To evaluate
the isolated effect of CD40 ligation on HPMC, we co-cultured the HPMC with a
murine fibroblast cell line (L cells) genetically engineered to express human
CD154 (CD40L cells). As a control, we used parental unmodified L cells. We
added CD40L cells to the HPMC monolayer, and several hours after addition of
the cells, they formed aggregates on HPMC indicating cell-to-cell contact.
When the parental L cells were added, we observed less contact with HPMC (not
shown).
IL-15 Production
As depicted in Figure 3,
IL-15 production by mesothelial cells is significantly enhanced in a
dose-dependent manner by CD40 activation by CD40L cells as compared with the
low effect of unstimulated HPMC or HPMC treated with L cells. In some
experiments, unmodified L cells had a nonspecific stimulatory effect on HPMC,
but it never reached the specific effect of CD40L cells. Because we previously
found that IFN enhances IL-15 production by HPMC and TEC
(10,15),
we compared the effect of IFN to CD40 activation and combined these two
treatments (Figure 4). The
effect of CD40 activation was similar in magnitude to that observed with
IFN treatment, and the combination of IFN and CD40 activation
resulted in an additive increase of IL-15 production. Exposure of HPMC to
CD40L cells preincubated with a blocking antibody to CD154 significantly
decrease IL-15 production as compared with incubation with CD40L cells
preincubated with a nonspecific isotype control antibody in the same
concentration. Inhibition of CD154 was effective when HPMC were stimulated by
CD40L cells alone or in combined activation with IFN.
|
|
RANTES Secretion
We tested the dose response of HPMC to IFN
(Figure 5). At all tested doses
(0.1 to 1000 U/ml), stimulation with IFN alone had no significant
effect on RANTES secretion. However, the combination of CD40 ligation and
IFN was synergistic for induction of RANTES from a concentration of 0.5
U/ml and reached a plateau at 5 U/ml IFN. RANTES accumulation over time
is depicted in Figure 6.
Accumulation after IFN and CD40 ligation was at a fairly invariable
rate of approximately 2 ng/ml per 104 cells per day up to 72 h. In
contrast, no significant accumulation of RANTES (when compared with L-cell
treatment) was found after IFN or CD40 ligation. As shown in
Figure 7, the induction of
RANTES stimulated by exposing HPMC to IFN and CD40L cells was blocked
by preincubation of the CD40L cells with anti-CD154 antibodies before adding
them to HPMC. In contrast, an isotype-matched control antibody had no effect.
The effect of CD40L cells on HPMC was contact dependent and not dependent on
soluble mediators, as clearly demonstrated by the Transwell experiments
depicted in Figure 8. CD40L
cells separated by a porous membrane (0.4-µm pore size) in the Transwell
system had no stimulatory effect on HPMC in contrast to the marked effect of
CD40L cells co-cultured with HPMC in the same compartment.
|
|
|
|
Effect of CD40 Upregulation on RANTES Secretion
Because we found that treatment of HPMC with TNF and IFN
increase the levels of CD40 (Figures
1 and
2), HPMC were pretreated with
these cytokines and then exposed to CD40L cells or to CD40L cells and
IFN to discover whether CD40 upregulation has an effect on the response
to CD40 stimulation (Figure 9).
Without pretreatment, we observed that CD40L cells induced only low RANTES
secretion. This effect was not higher than that seen in the nonspecific
induction of L cells.
|
Pretreating HPMC with TNF and IFN significantly increased the
response to CD40L cells. This effect was significantly higher (four- to
sixfold) when HPMC were pretreated with both cytokines together, as compared
with pretreatment with TNF or IFN alone. As compared with
nonpretreated HPMC, a twofold increase in RANTES secretion was found after
pretreatment with TNF or IFN alone and stimulation with CD40L
cells and IFN, and a more than sevenfold increase was seen after
pretreatment with both cytokines and by the same stimulation. When the RANTES
levels were compared after pretreatment with one cytokine with pretreatment
with two cytokines, the increase was approximately threefold, similar to that
found in CD40 levels after pretreatment with the two cytokines.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and
IFN. CD40 was first demonstrated on B cells, but its presence on HPMC
was anticipated because besides being expressed on B cells, CD40 has been
detected on endothelial cells, fibroblasts, and various epithelial cells,
including kidney tubular cells
(11). CD40 ligation induces
expression of adhesion molecules as well as secretion of various cytokines and
chemokines on endothelial and epithelial cells. Therefore, we decided to
demonstrate the effect of CD40 ligation by measuring IL-15 and RANTES
production. To isolate the role of the CD40 ligand/CD154 from other lymphocyte signals, we activated CD40 on HPMC with a murine cell line genetically modified to express human CD154 (CD40L-cells). In this way, nonrelevant signals were avoided and CD40 was uniquely activated.
After CD40 ligation, both IL-15 and RANTES production by HPMC were
significantly affected. CD40 ligation induced a significant increase of IL-15
production by HPMC, whose effect was additive to IFN stimulation. These
findings are similar to the additive effect seen in TEC, dendritic cells, and
muscle cells derived from polymyositis dermatomyositis patients
(16,23,24).
The effect of CD40 ligation on RANTES secretion was different from the
effect on IL-15 levels. When HPMC were activated by one inducer, either CD40
ligation or IFN stimulation, it did not induce significant RANTES
secretion. Similar to our findings, Visser et al.
(4) showed that IFN (0
to 3000 U/ml) does not induce RANTES secretion from HPMC. However, the
combination of CD40 ligation with IFN was highly synergistic for
inducing RANTES secretion. Similar observations corresponding to our findings
were made by Altenburg et al.
(25) and by Sugiura et
al. (24). These authors
described a synergism between CD40 ligation and IFN for inducing RANTES
and other chemokines in cervical carcinoma cells and in muscle cells.
To ascertain that the effect induced by the CD40L cells was specifically
due to expression of CD154 and not by nonspecific cell contact, we used the
parental L cells as a control for nonspecific activation. L cells had only a
low stimulatory effect on HPMC. This effect was usually less than 40% of that
of CD40L cells on the production of IL-15 and less than 10% of the synergistic
effect of CD40 L cells with IFN for the production of RANTES. The
nonspecific stimulation of the L cells could be related to cytokine secretion
or perhaps is due to irritation from cell contact. We ascertained the
specificity of CD40L cells to activate CD40 by blocking the CD154 molecules
that they express with anti-CD154 antibodies. Pretreating CD40L cells with
anti-CD154 effectively blocked the induction of IL-15 and RANTES.
CD154 molecules are mainly active as membrane-bound molecules, not as soluble molecules. Therefore, to demonstrate that HPMC activation by CD40L cells is contact dependent, we used the "Transwell" system. This experiment clearly demonstrated that RANTES production is suppressed when contact is avoided by separating the CD40L cells from the HPMC with a membrane of 0.4-µ pore size. This experiment also demonstrated that soluble factors secreted from CD40L cells, which diffuse freely through the porous membrane, have no effect on HPMC.
Visser et al. (4)
demonstrated that TNF and IL-1ß synergizes with IFN in
inducing the chemokines RANTES, MCP-1, and IP-10. It is therefore suggested
that an additional signal to IFN is needed to achieve a significant
secretion of these chemokines by HPMC. The second signal for RANTES secretion
could be provided by a proinflammatory cytokine or by CD154. CD154 and
IFN are mainly expressed by T helper cells, and we found that a
combination of both upregulates the production of IL-15 and RANTES. Because
IL-15 and RANTES are potent T-cell modulators, this effect might be part of a
positive feedback loop that enhances T-cell recruitment and activity in the
peritoneum.
Our RT-PCR and flow cytometry data indicate that TNF and IFN
upregulate the expression of CD40 on HPMC. Similarly, Albanesi et al.
(26) and Sugiura et
al. (24) demonstrated
that combined treatment of human keratinocytes or muscle cells with TNF
and IFN upregulates CD40. Our results suggest that the rise in CD40
levels is functional because pretreatment of HPMC with TNF and
IFN resulted in an increase in RANTES production. The augmented RANTES
production was in clear correlation with the increase in CD40 levels; low
increase in RANTES production was obtained after preincubation with any one of
the cytokines, and combined pretreatment with TNF and IFN was
synergistic in its effect on the increase in RANTES secretion. We therefore
suggest that TNF and IFN pretreatment increase the effect of
CD40 ligation by increasing the number of CD40-signaling receptors.
We have demonstrated the presence of CD40 on primary culture of HPMC,
although in vivo expression and functionality of this receptor still
remain to be established. However, it is reasonable to consider that in the
peritoneum, CD40 and its ligand will have a role in central inflammatory and
immune reactions such as leukocyte chemoattraction and antigen presentation,
activities that were previously demonstrated for CD40
(11,13,14,24,25,27,28).
CD40 expressed on mesothelial cells may synergize in the peritoneum with
proinflammatory cytokines such as TNF and IFN, which have been
detected in the peritoneal effluent during peritonitis
(5). This mechanism may play a
significant role in the generation of an effective immune response in the
peritoneal cavity.
In conclusion, our data indicate that a functional CD40 is expressed on
HPMC that is regulated by TNF and IFN. Ligation of CD40
increased the production of IL-15 and was highly synergistic to IFN in
RANTES secretion. Our data suggest that CD40 plays a role in T-cell regulation
of immune and inflammatory responses in the peritoneum.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  N. Tejman-Yarden, M. Zlotnik, E. Lewis, O. Etzion, C. Chaimovitz, and A. Douvdevani Renal cells express a functional interleukin-15 receptor Nephrol. Dial. Transplant., March 1, 2005; 20(3): 516 - 523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ben-Dor, M. Steiner, L. Gheber, M. Danilenko, N. Dubi, K. Linnewiel, A. Zick, Y. Sharoni, and J. Levy Carotenoids activate the antioxidant response element transcription system Mol. Cancer Ther., January 1, 2005; 4(1): 177 - 186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Yang, R. Ye, Q. Kong, Q. Yang, X. Dong, and X. Yu CD40 is expressed on rat peritoneal mesothelial cells and upregulates ICAM-1 production Nephrol. Dial. Transplant., June 1, 2004; 19(6): 1378 - 1384. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
