Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LAPING, N. J.
Right arrow Articles by ZHU, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LAPING, N. J.
Right arrow Articles by ZHU, Y.
J Am Soc Nephrol 12:883-890, 2001
© 2001 American Society of Nephrology

Identification of a Novel Nuclear Guanosine Triphosphate-Binding Protein Differentially Expressed in Renal Disease

NICHOLAS J. LAPING*, BARBARA A. OLSON* and YUAN ZHU{dagger}

* Department of Renal Pharmacology, SmithKline Beecham Pharmaceuticals, King of Prussia, Pennsylvania.
{dagger} Department of Molecular Genetics, SmithKline Beecham Pharmaceuticals, King of Prussia, Pennsylvania.

Correspondence to Dr. Nicholas J. Laping, Department of Renal Pharmacology, UW2521, SmithKline Beecham Pharmaceuticals, 709 Swedeland Road, P.O. Box 1539, King of Prussia, PA 19406. Phone: 610-270-5310; Fax: 610-270-5681; E-mail: nicholas_j_laping{at}sbphrd.com


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abstract. A novel guanosine triphosphate—binding protein, chronic renal failure gene (CRFG), was discovered by differential display PCR to be regulated differentially in renal disease. Within the rat kidney, CRFG mRNA was localized to the outer medulla and was highly expressed in epithelial cells. The specific renal expression of CRFG mRNA in the outer medulla was reduced dramatically in several rat models of renal disease, including diabetic nephropathy, partial nephrectomy, ischemia, and anti-Thy1.1—induced nephritis. CRFG was localized selectively in the nucleus of human and rodent cells, as determined by immunocytochemistry and green fluorescence fusion protein. Cellular mRNA levels of CRFG were also increased after serum administration, when cells proliferate. These data suggest that CRFG may be involved in regulating guanosine triphosphate—dependent nuclear events that are associated with cell proliferation and that are important in normal renal function and essential for growth and development.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Chronic renal disease is marked by progressive decline in renal function, persistent proteinuria, and, frequently, glomerular and interstitial fibrosis. Although several risk factors that are associated with chronic renal disease are well described, including diabetes mellitus and hypertension, the molecular mechanisms that transduce the sequela of chronic renal disease remain a subject of intense study. Diabetic nephropathy is marked by persistent proteinuria and progressive loss of renal function without ischemia. The obese Zucker rat has mild glucose intolerance and peripheral insulin resistance similar to those in patients with type II diabetes mellitus (1). The obese Zucker rat is used as a model of hyperinsulinemic obesity, which results in kidney enlargement, proteinuria, focal segmental glomerulosclerosis, interstitial fibrosis, and loss of renal function (2, 3). To identify genes that are regulated differentially in chronic renal disease, we performed differential display PCR on renal RNA from lean and obese Zucker rats.

Many guanosine triphosphate (GTP)—binding proteins take part in the signaling cascade of several growth factors and hormones that can affect the development and response to injury of renal cells. GTP-binding proteins also affect intracellular signaling by modulating the activity of enzymes, as well as regulating transport of proteins and RNA across the nuclear membrane. We describe here a novel GTP-binding protein, chronic renal failure gene (CRFG), that has selective expression in the outer medulla of the kidney, which is lost with renal disease or injury. To determine whether diabetes or features common to other models of chronic renal disease regulate CRFG, we measured its mRNA levels in subtotally nephrectomized rats, as well as in anti-Thy1.1—induced nephritic rats.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Male Zucker rats of the lean and obese strains, male Lewis rats (Charles River, Wilmington, MA), male Fisher 344 rats (F344; Harlan Sprague Dawley), and male Sprague Dawley rats (Harlan Sprague Dawley; Charles River, Raleigh, NC) were housed under controlled light, temperature, and humidity conditions. Male Sprague Dawley rats (250 to 300 g body wt) received 5/6 subtotal nephrectomy, as described elsewhere (4). Nephrectomized rats were killed, and kidneys were collected 1 d, 1 wk, and 2 wk after subtotal nephrectomy. Male Lewis rats (200 g) received 1 ml of anti-Thy1.1 antibody or control serum injected into the tail vein (anti-rat CD90; Cedarlane, Ontario, Canada) and were killed 8 d after the injection. Twenty-four-h urine protein levels were determined by the sulfosalicylic acid method (5). Animals were killed with 120 mg/kg pentobarbital, and kidneys were removed. Kidneys were collected and frozen on dry ice for RNA extractions or were snap-frozen in liquid nitrogen for in situ hybridizations. Animals were treated in accordance with the National Institutes of Health guidelines for use of animals in research. The appropriate institutional animal care committee approved all procedures.

Cell Culture
Renal epithelial carcinoma A498 cells and rodent NIH3T3 cells were obtained from American Type Culture Collection (Manassas, VA) and grown in Eagle minimal essential medium with 10% fetal bovine serum with penicillin and streptomycin (50 U and 50 µg/ml, respectively). A498 cells were grown to confluence and serum-starved for 48 h before the addition of 10% serum-containing media for 48 h, after which RNA was extracted.

Differential Display
CRFG cDNA was isolated by the modified differential display method (6) from total kidney RNA of lean Zucker rats. Total RNA was extracted by guanidinium thiocyanate denaturation and acidified phenol-chloroform extraction (7). Kidney RNA from lean and obese Zucker rats was treated with RQ1 DNase, and cDNA was synthesized by use of Moloney murine leukemia virus reverse transcriptase and the primer ACC-ACA-CAT-CTG-A. PCR was done with the primers ACC-ACA-CAT-CTG-A and TGT-TGG-GAA-CAA-G. The reamplified 226-bp cDNA was cloned into the PCRII vector by use of the TA cloning kit (Invitrogen, Carlsbad, CA).

Full-Length cDNA Cloning
On the basis of the 226-bp rat cDNA fragment generated by differential display, a human expressed-sequence tag clone (HHEMG39) was identified in the cDNA database of Human Genome Science (Rockville, MD), which contained a 1.3-kb partial human cDNA sharing 91% homology with the rat sequence in the coding region. The full-length human CRFG (hCRFG) was cloned by use of the marathon cDNA of human kidney (Clontech, Palo Alto, CA). PCR was performed according to the manufacturer's protocol, with use of gene-specific primers corresponding to the expressed-sequence tag clone (5' RACE primer: 5'-CTGTCATACTCTCCAGCAGCTGT-TCTCAGC-3' and 5'-CTTCCAATTTCTTCATGATGGCTGG-3'). The PCR products were cloned into pCRII vector (Invitrogen) and sequenced. Subsequently after a putative open-reading frame was revealed, a pair of primers flanking the open-reading frame (5'-AGCATGGCACATTACAACTTCAAGAAA-3' and 5'- TCTAGCGAAGCCACGCCAACCAAAC 3') were used to isolate the entire coding region of hCRFG. The reverse transcription—PCR was performed at 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min for 25 cycles. The 1.9-kb fragment was cloned into pCRII and sequenced. The rat and mouse CRFG were cloned by degenerate reverse transcription—PCR with use of human primers.

Northern Blot
CRFG cDNA was labeled by random priming (Stratagene, La Jolla, CA) with [{alpha}-32P]dATP (NEN, Boston, MA) and used as a probe, which resulted in the detection of two transcripts of 1.5 and 2.5 kb. Equivalent loading and transfer of RNA samples was verified by vacuolar the H+-ATPase (8) (2.9 kb) or the ribosomal protein L32 (rpL32, 0.6 kb) (9) mRNA levels. Membranes were exposed to a phosphor-imaging plate, and bands were quantified with ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Statistical significance was determined by ANOVA (SuperANOVA software; Abacus Concepts, Berkeley, CA).

In Situ Hybridization
Hybridizations were performed as described elsewhere (8). Briefly, thaw-mounted cryostat kidney sections (12 µm) from 4-mo-old Zucker rats or 3- and 24-mo-old F344 rats were fixed in 4% paraformaldehyde for 2 min. The tissue sections were incubated in a humidified chamber at 50°C with 35S-UTP cRNA probe in the hybridization solution and washed. Slides were exposed to a phosphor-image plate and scanned with Phosphor Imager (Molecular Dynamics).

CRFG Transfection/Localization
Full-length CRFG was cloned into pEGFP mammalian expression vector under control of the cytomegalovirus promoter (Clontech). A498 renal epithelial cells and NIH 3T3 cells were transfected with the CRFG construct or the empty vector with Lipofectamine Plus (Life Technologies, Gaithersburg, MD). The transfected cells were seeded on glass slides for 24 h and then covered with mounting medium (Vectamount; Vecta Laboratories, Inc., Burlingame, CA). Green fluorescence protein was visualized by fluorescence microscopy with use of FITC filters. A peptide sequence of CRFG, ARSGSCSRTPRDVSG, was synthesized and conjugated with keyhole-limpet hemocyanin (American Peptide Co., Sunnyvale, CA) and used to raise antibodies in rabbits (Covance, Inc., Richmond, CA). C23 antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). A498 cells were seeded on glass slides and fixed with acetone for immunocytochemical analysis. The CRFG antiserum was used at 1:10000 dilution, and C23 antibody was used at 1:400 dilution.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Differential Display PCR, Cloning, and Sequence Analysis
A 226-bp DNA fragment was found to have lower expression in kidney RNA from obese Zucker rats than from lean Zucker rats (Figure 1A). The sequence of the DNA fragment was used to design primers for 5' RACE. An additional 200 nucleotides were identified for 5' of the original fragment. With the additional sequence, a human homologous cDNA clone was identified in the Human Genome Sciences EST database. This was not a full-length clone, and it was also extended by 5'-RACE (Figure 2). Similarly, the rat and mouse CRFG full-length cDNA was obtained (Figure 3).



View larger version (65K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Renal expression of chronic renal failure gene (CRFG) mRNA in several models of progressive renal disease. (A) Differential display PCR identified a 226-nt fragment present in lean but absent in obese Zucker rat renal RNA. (B) Northern blot confirming the expression of CRFG in lean but not obese renal RNA, with use of the 226-nt cDNA as probe in comparison with clusterin mRNA. (C) The cDNA probe recognizes two different mRNA species on a poly A + mRNA Northern blot from rats that died after 5/6 nephrectomy 1 d, 1 wk, and 2 wk after surgery. (D) CRFG mRNA is dead in 24-mo-old F344 rat kidney.

 


View larger version (86K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Nucleotide and protein sequence of CRFG.

 


View larger version (63K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. Alignment of human, rat, mouse, and yeast CRFG.

 

hCRFG encodes a polypeptide of 635 amino acids that is 45% homologous to yeast GTP-binding protein YPL093w. Mouse CRFG encodes the same number of amino acids, and the homology between hCRFG and mouse CRFG is 93%. Rat CRFG also shares 93% homology with hCRFG, but it has a two-amino-acid insertion at position 566. A GTP-binding motif, GYPNVGKS, is conserved among all species (Figure 3). During the preparation of this article, a human sequence was published in GenBank (accession number AF120334) that is identical to hCRFG, except that it is missing a Met at position 593. By radiation hybrid mapping, hCRFG was localized on chromosome 10 p15.2-.3. This region contains the genes for interleukin 2 (IL-2) and the receptors for IL-9 and IL-15.

mRNA Expression
In rats, CRFG mRNA has two transcripts: one at 1.5 and one at 2.5 kb. Northern blot analysis confirmed that CRFG mRNA levels were decreased in the kidneys of 4-mo-old obese Zucker rats, compared with lean littermates (Figure 1B). This decrease was evident in all animals, regardless of degree of renal disease, which is variable at age 4 mo. In contrast, clusterin mRNA was increased only in those animals with severe proteinuria (Figure 1B). From left to right, urine protein excretion in the lean rats was 17.5, 11.4, 17.0, 27.5, 14.0, and 21.3 mg/d, respectively. In the obese rats, urine protein excretion was 45.4, 41.0, 112.3, 68.8, 174.2, and 45.4 mg/d, respectively. Similarly, CRFG mRNA was decreased in the remnant kidney of the 5/6 nephrectomized rat (Figure 1C), as well as in the kidney of the aged F344 rat (Figure 1D). In the rat, the highest expression of CRFG was found in the kidney, compared with brain, liver, testes, spleen, heart, and lung (Figure 4). As shown in Figure 4, decreased mRNA levels as a result of diabetic nephropathy in the obese Zucker rat were seen only in the kidney. In situ hybridization localized CRFG mRNA to tubules of the outer medulla, which is lost in the obese Zucker rat (Figure 5, A and B) and the 24-mo-old F344 rat (Figure 5, C and D). In addition, inducing nephritis by venous injection of anti-Thy1.1 in Lewis rats decreased CRFG mRNA in the outer medulla 8 d after anti-Thy1.1 treatment (Figure 5, E and F). At the time of death, the control and anti-Thy1.1—treated animals had urine protein excretion levels of 8.1 ± 0.5 and 82.2 ± 20 mg/d, respectively. In contrast, creatinine clearance was not different between vehicle- and anti-Thy1.1—injected rats (542 ± 45 and 583 ± 20 ul/min per 100 g, respectively, n = 3 to 4).



View larger version (54K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Tissue-specific regulation of CRFG mRNA in lean and obese Zucker rats. Shown is a representative Northern blot of tissues from one lean and one obese rat.

 


View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. In situ hybridization of CRFG in rat kidneys comparing lean (A) and obese (B) Zucker rats, 3-mo-old (C) and 24-mo-old (D) F344 rats, or control (E) and anti-Thy1.1-injected (F) Lewis rats.

 

Northern blot analysis with use of the human cDNA probe showed that CRFG is a single band of 3 kb in length in human renal tissue (data not shown). In contrast to the rat tissue distribution, hCRFG was expressed at very high levels in testes, adrenal gland, brain, and placenta, as determined by multitissue dot blot (Figure 6). Lower mRNA levels were detected in heart, pituitary gland, kidney, and all other tissues available on the multitissue blot (Clontech). The relative expression of CRFG within subregions of the brain was fairly uniform, with highest expression in the occipital cortex, lowest expression in the cerebellum, and intermediate levels in all other regions (data not shown).



View larger version (31K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. CRFG mRNA distribution in human tissues by multitissue RNA dot blot.

 

Subcellular Localization and Functional Analysis
To determine the subcellular localization of CRFG, we constructed a fusion protein with green fluorescence protein at the amino-terminal end of CRFG. When expressed in human renal epithelial carcinoma A498 cells or rodent NIH-3T3 fibroblasts, the fluorescence signal was concentrated in the nucleus (Figure 7). Within the nucleus, enhanced signal is detected over nuclear structures reminiscent of nucleoli (Figure 7, E and F). Antibody raised against the C-terminal region of CRFG also shows nuclear localization superimposable with fluorescence signal of the green fluorescent protein fused to CRFG (Figure 8, A and B). In contrast, the phosphoprotein C23/nucleolin did not colocalize with green fluorescence CRFG (Figure 8, C and D).



View larger version (47K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. Nuclear localization of green fluorescent protein (GFP)—CRFG in human renal A498 and rodent NIH3T3 cells shown in bright field (A, C, and E) and green fluorescence with FITC filter (B, D, and F). A498 cells transfected with GFP expression vector (A and B). A498 cells transfected with fusion vector of GFP with CRFG (C and D). NIH3T3 cells transfected with GFP-CRFG fusion vector (E and F). Subnuclear structures colocalize with CRFG (arrows).

 


View larger version (25K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 8. CRFG does not colocalize with C23. Immunofluorescence of green fluorescent CRFG in A498 cells (A and C). (B) CRFG detected with specific antibody raised against CRFG. The antibody detects the same structures visualized with GFP-CRFG (A and B). In contrast, the antibody against the nucleolar phosphoprotein C23 does not recognize the nuclear structures associated with GFP-CRFG (C and D).

 

The nuclear localization of CRFG and the requirement of yeast ortholog YPL093w for vegetative growth (10) suggested that this gene might play a role during cell growth. Therefore, the mRNA levels of CRFG were examined in serum-starved (quiescent) A498 cells, followed by serum stimulation. Fetal bovine serum added to quiescent cells increased CRFG mRNA levels 1.8-fold (P <= 0.05, n = 8).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Chronic renal disease is associated with cellular and molecular changes that affect the survival, growth, and differentiation of renal cells that consequently reduce renal function. A significant pathology associated with chronic renal disease is interstitial fibrosis and tubular degeneration. We identified CRFG, a nuclear protein that is expressed selectively in the tubules of the outer medulla of rats. The selective renal expression is reduced in obese Zucker rats, regardless of degree of proteinuria. In contrast, only those Zucker rats with very high urine protein excretion levels had elevated renal clusterin mRNA levels. Clusterin is a multifunctional protein that is involved in apoptosis, neurodegeneration, inhibition of complement-mediated cell lysis, and kidney development (see reviews in references 11,12,13). Within the kidney, clusterin mRNA levels increase after ureteral obstruction (12) and after reduction in renal mass (14). High levels of clusterin are also expressed in degenerating tubules of diabetic rats and aged F344 rats and correlate tightly to the degree of proteinuria (15). Our data show, however, that clusterin mRNA is elevated only in animals with proteinuria levels >60 mg/d, whereas CRFG mRNA is decreased in all 4-mo-old obese Zucker rats that excrete protein at >20 mg/d. Thus, CRFG seems to be more sensitive than clusterin to small changes in urinary protein excretion.

The renal pathology and the associated change in expression of injury markers is surprisingly similar between aged F344 and obese Zucker rats (15, 16). Therefore, it was expected that the loss of CRFG expression in aged F344 rats would be similar to that seen in obese Zucker rats. However, CRFG expression was also decreased in the remnant kidney model, as well as in anti-Thy1.1—induced nephritis. It was unexpected that the tubular CRFG mRNA was decreased in the anti-Thy1.1—induced nephritis model, in which the origin of injury is in the glomerulus. However, this model also has elevated levels of proteinuria, which are 6-fold higher 1 d after the antibody injection and 10-fold higher after 8 d, whereas creatinine clearances were unchanged. Moreover, tubular upregulation of clusterin mRNA has been reported in murine lupuslike nephritis (17), indicating that tubular changes can occur as soon as glomerular basement membrane permeability is affected. In addition, aged F344 rats have significant proteinuria at age 24 mo (18,19), and rats develop proteinuria after 5/6 nephrectomy (4,20). Thus, a common component of all of these models is some degree of proteinuria but not a change in glomerular filtration (e.g., anti-Thy1.1 model). Because the renal mRNA levels of CRFG are dramatically reduced not only in diabetic rats but also in other models of renal disease, diabetes or elevated blood glucose levels specifically did not cause the change in CRFG expression. Rather, it seems that the tubules of the outer medulla were sensing the earliest changes in glomerular basement membrane permeability, such as proteinuria, and responded by decreasing CRFG expression well before GFR is grossly affected. The identity of the urinary protein that affects CRFG remains to be determined.

A common feature of many renal diseases is increased expression of cytokines and growth factors that include insulin-like growth factor-I (21,22), hepatocyte growth factor (23,24), transforming growth factor-ß (9, 25,26,27), and monocyte chemoattractant protein-1 (28,29,30). Because most renal diseases include loss of glomerular integrity, increased levels of insulin-like growth factor-I, transforming growth factor-ß, and hepatocyte growth factor have been detected in the ultrafiltrate (31). Ultrafiltrate from nephrotic kidneys can induce monocyte chemoattractant protein-1 expression in tubular epithelial cells and thus contribute to macrophage infiltration and interstitial fibrosis (30,31). If CRFG expression is regulated by cytokines and growth factors, then its promoter may detect changes in glomerular basement membrane integrity that precede gross tubular degeneration and glomerular sclerosis by sensing cytokines in the ultrafiltrate.

CRFG is a highly conserved gene with significant homology among yeast, mouse, rat, and human. This is an essential gene in yeast, because knockouts do not grow (10). In particular, a GTP-binding sequence, GYPNVGKS, is conserved in yeast YPL093w as well as in mouse, rat, and human CRFG. The GTP-binding consensus sequence, GXXXXGKS, is conserved among numerous {alpha} subunit GTP-binding regulatory proteins as well as Rab and renin-angiotensin system—related GTP-binding proteins and many others (32,33,34). Indeed, structural analysis of sequence domains shows that CRFG is related distantly to novel GTP-binding proteins that map to the major histocompatibility complex class I region (35) and renin-angiotensin system. Although sequence analysis identifies high probability of at least two coiled regions (amino acids 400 to 450 and 550 to 570), no other features or similarities to other known proteins were identified. The closest gene related to CRFG seems to be DRG, which is also a GTP-binding protein with unknown function that interacts with the oncoproteins SCL and TAL (36,37,38). If CRFG is functionally related to DRG, then perhaps it may be involved in regulating proliferation. Consistent with this hypothesis, CRFG is localized to distinct structures in the nucleus, and its expression is increased in cells after serum stimulation. However, CRFG failed to colocalize with C23, also known as nucleolin, which is involved in ribosome assembly (39). Therefore, CRFG is probably not involved in C23-dependent processes of ribosome biogenesis. Colocalizations with many of the other identified nuclear proteins may clarify in which nuclear events CRFG takes part.

In summary, CRFG mRNA is expressed selectively in the outer medulla of rats, which is reduced dramatically in the development of renal disease with detectable proteinuria, regardless of the initial cause. This nuclear protein contains a GTP-binding domain that may affect nuclear events involved in cell growth and proliferation that are pertinent to renal tubular function. The expression and the role of CRFG in human development and disease remain to be determined.


   Acknowledgments
 
We thank J. A. Terrett for chromosomal localization of CRFG and Dr. C. Schnackenberg and Dr. C. Creasy for critical review and discussion.


   Footnotes
 
GenBank accession numbers: Bankit 372846 (hCRFG) = AF325353; Bankit 372847 (mouse CRFG) = AF325354; and Bankit 372848 (rat CRFG) = AF325355.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ionescu E, Sauter JF, Jeanrenaud B: Abnormal oral glucose tolerance in genetically obese (fa/fa) rats. Am J Physiol248 : E500-E506,1985[Abstract/Free Full Text]
  2. Kasiske BL, O'Donnell MP, Keane WF: The Zucker rat model of obesity, insulin resistance, hyperlipidemia, and renal injury. Hypertension Suppl I 19:I-110 -I-115, 1992
  3. Magil AB, Frohlich JJ: Monocytes and macrophages in focal glomerulosclerosis in Zucker rats. Nephron59 : 131-138,1991[Medline]
  4. Olson BA, Ali SM, Contino LC, Brooks DP, Laping NJ: Angiotensin-converting enzyme inhibition alters clusterin mRNA expression in the kidney following renal mass reduction. Pharmacology 57:13 -19, 1998[Medline]
  5. Russell PJ, Bennett S, Stricker P: Growth factor involvement in progression of prostate cancer. Clin Chem44 : 705-723,1998[Abstract/Free Full Text]
  6. Raftery LA, Twombly V, Wharton K, Gelbart WM: Genetic screens to identify elements of the decapentaplegic signaling pathway in Drosophila. Proc Natl Acad Sci USA 139:241 -254, 1998
  7. Chomczynski P, Sacchi N: Single step method for RNA isolation by acid guanidinium thiocyanate-phenol-chlorophorm extraction. Anal Biochem 162:156 -159, 1987[Medline]
  8. Shihab FS, Yamamoto T, Nast CC, Cohen AH, Noble NA, Gold LI, Border WA: Transforming growth factor-beta and matrix protein expression in acute and chronic rejection of human renal allografts. J Am Soc Nephrol 6:286 -294, 1995[Abstract]
  9. Border WA, Noble NA, Ketteler M: TGF-beta: A cytokine mediator of glomerulosclerosis and a target for therapeutic intervention. Kidney Int Suppl 49:S59 -S61, 1995[Medline]
  10. Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H, Chu AM, Connelly C, Davis K, Dietrich F, Dow SW, el Bakkoury M, Foury F, Friend SH, Gentalen E, Giaever G, Hegemann JH, Jones T, Laub M, Liao H, Liebundguth N, Lockhart DJ, Lucau-Danila A, Lussier M, M'Rameth N, Menard P, Mittmann M, Pai C, Rebischung C, Revuelta JL, Riles L, Roberts CJ, Ross-MacDonald P, Scherens B, Snyder M, Sookhai-Mahadeo S, Storms RK, Veronneau S, Voet M, Volckaert G, Ward TR, Wysocki R, Yen GS, Yu K, Zimmermann K, Philippsen P, Johnston M, Davis RW: Functional characterization of the Scerevisiae genome by gene deletion and parallel analysis. Science 285:901 -906, 1999[Abstract/Free Full Text]
  11. May PC, Finch CE: Sulfated glycoprotein 2: New relationships of this multifunctional protein to neurodegeneration. Trends Neurosci 15:391 -396, 1992[Medline]
  12. Rosenberg ME, Silkensen J: Clusterin and the kidney. Exp Nephrol 3: 9-14,1995[Medline]
  13. French LE, Chonn A, Ducrest D, Baumann B, Belin D, Wohlwend A, Kiss JZ, Sappino AP, Tschopp J, Schifferli JA: Murine clusterin: Molecular cloning and mRNA localization of a gene associated with epithelial differentiation processes during embryogenesis. J Cell Biol122 : 1119-1130,1993[Abstract/Free Full Text]
  14. Correa Rotter R, Hostetter TH, Manivel JC, Eddy AA, Rosenberg ME: Intrarenal distribution of clusterin following reduction of renal mass. Kidney Int 41:938 -950, 1992[Medline]
  15. Laping NJ, Olson BA, Day JR, Brickson BM, Contino LC, Short BG, Ali SM, Brooks DP: The age-related increase in renal clusterin mRNA is accelerated in obese Zucker rats. J Am Soc Nephrol9 : 38-45,1998[Abstract]
  16. Olson BA, Day JR, Laping NJ: Age-related expression of renal thrombospondin-1 mRNA in F344 rat: Resemblance to diabetes-induced expression in obese Zucker rats. Pharmacology58 : 200-208,1999[Medline]
  17. Moll S, Menoud PA, French L, Sappino AP, Pastore Y, Schifferli JA, Izui S: Tubular up-regulation of clusterin mRNA in murine lupus-like nephritis. Am J Pathol 152:953 -962, 1998[Abstract]
  18. Li YM, Steffes M, Donnelly T, Liu C, Fuh H, Basgen J, Bucala R, Vlassara H: Prevention of cardiovascular and renal pathology of aging by the advanced glycation inhibitor aminoguanidine. Proc Natl Acad Sci USA 93:3902 -3907, 1996[Abstract/Free Full Text]
  19. Mcdermott GF, Ingram A, Scholey J, Kirkland JL, Whiteside CI: Glomerular dysfunction in the aging fischer 344 rat is associated with excessive growth and normal mesangial cell function. J Gerontol Ser A Biol Sci Med Sci 51:M80 -M85, 1996
  20. Shimamura T, Morrison AB: A progressive glomerulosclerosis occurring in partial five-sixths nephrectomized rats. Am J Pathol 79:95 -106, 1975[Abstract]
  21. Woolf AS, Bosch RJ, Fine LG: Growth factors in the pathogenesis of renovascular complications of diabetes mellitus [Review]. J Hypertens Suppl 10:S11 -S16, 1992[Medline]
  22. Schena FP: Role of growth factors in acute renal failure. Kidney Int Suppl 66:S11 -S15, 1998[Medline]
  23. Hammerman MR: Growth factors and apoptosis in acute renal injury. Curr Opin Nephrol Hypertens 7:419 -424, 1998[Medline]
  24. Laping NJ: Hepatocyte growth factor in renal disease: Cause or cure? Cell Mol Life Sci 56:371 -377, 1999[Medline]
  25. Bitzer M, Sterzel RB, Bottinger EP: Transforming growth factorbeta in renal disease. Kidney Blood Press Res21 : 1-12,1998[Medline]
  26. Sharma K, Ziyadeh FN, Alzahabi B, McGowan TA, Kapoor S, Kurnik BR, Kurnik PB, Weisberg LS: Increased renal production of transforming growth factor-betal in patients with type II diabetes. Diabetes 46:854 -859, 1997[Abstract]
  27. Sharma K, Ziyadeh FN: Hyperglycemia and diabetic kidney disease. The case for transforming growth factor-beta as a key mediator. Diabetes 44:1139 -1146, 1995[Abstract]
  28. Wada T, Furuichi K, Segawa-Takaeda C, Shimizu M, Sakai N, Takeda S, Takasawa K, Kida H, Kobayashi K, Mukaida N, Ohmoto Y, Matsushima K, Yokoyama H: MIP-1 alpha and MCP-1 contribute to crescents and interstitial lesions in human crescentic glomerulonephritis. Kidney Int56 : 995-1003,1999[Medline]
  29. Janssen U, Phillips AO, Floege J: Rodent models of nephropathy associated with type II diabetes [Review]. J Nephrol12 : 159-172,1999[Medline]
  30. Schneider A, Panzer U, Zahner G, Wenzel U, Wolf G, Thaiss F, Helmchen U, Stahl RAK: Monocyte chemoattractant protein-1 mediates collagen deposition in experimental glomerulonephritis by transforming growth factor-beta. Kidney Int 56:135 -144, 1999[Medline]
  31. Wang SN, LaPage J, Hirschberg R: Glomerular ultrafiltration and apical tubular action of IGF-I, TGF-beta, and HGF in nephrotic syndrome. Kidney Int 56:1247 -1251, 1999[Medline]
  32. Dong QH, Shenker A, Way J, Haddad BR, Lin KI, Hughes MR, Mcbride OW, Spiegel AM, Battey J: Molecular cloning of human g-alpha(q) cDNA and chromosomal localization of the G-alpha(q) gene (Gnaq) and a processed pseudogene. Genomics 30:470 -475, 1995[Medline]
  33. Taparowsky E, Shimizu K, Goldfarb M, Wigler M: Structure and activation of the human N-ras gene. Cell34 : 581-586,1983[Medline]
  34. Zahraoui A, Touchot N, Chardin P, Tavitian A: The human Rab genes encode a family of GTP-binding proteins related to yeast YPT1 and SEC4 products involved in secretion. J Biol Chem264 : 12394-12401,1989[Abstract/Free Full Text]
  35. Vernet C, Ribouchon MT, Chimini G, Pontarotti P: Structure and evolution of a member of a new subfamily of GTP-binding proteins mapping to the MHC class I region. Mamm Genome5 : 100-105,1994[Medline]
  36. Zhao XF, Aplan PD: SCL binds the human homologue of DRG in vivo. Biochim Biophys Acta Mol Cell Res1448 : 109-114,1998[Medline]
  37. Mahajan MA, Park ST, Sun XH: Association of a novel GTP binding protein, DRG, with TAL oncogenic proteins. Oncogene12 : 2343-2350,1996[Medline]
  38. Schenker T, Lach C, Kessler B, Calderara S, Trueb B: A novel GTP-binding protein which is selectively repressed in sv40 transformed fibroblasts. J Biol Chem 269:25447 -25453, 1994[Abstract/Free Full Text]
  39. Ginisty H, Amalric F, Bouvet P: Nucleolin functions in the first step of ribosomal RNA processing. EMBO J17 : 1476-1486,1998[Medline]
Received for publication August 8, 2000. Accepted for publication November 8, 2000.




This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
Y. R. Lapik, J. M. Misra, L. F. Lau, and D. G. Pestov
Restricting Conformational Flexibility of the Switch II Region Creates a Dominant-Inhibitory Phenotype in Obg GTPase Nog1
Mol. Cell. Biol., November 1, 2007; 27(21): 7735 - 7744.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
L. N. Changolkar, C. Costanzi, N. A. Leu, D. Chen, K. J. McLaughlin, and J. R. Pehrson
Developmental Changes in Histone macroH2A1-Mediated Gene Regulation
Mol. Cell. Biol., April 1, 2007; 27(7): 2758 - 2764.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
J. M. Seubert, F. Xu, J. P. Graves, J. B. Collins, S. O. Sieber, R. S. Paules, D. L. Kroetz, and D. C. Zeldin
Differential renal gene expression in prehypertensive and hypertensive spontaneously hypertensive rats
Am J Physiol Renal Physiol, September 1, 2005; 289(3): F552 - F561.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
C. Morrison, A. J. Henzing, O. N. Jensen, N. Osheroff, H. Dodson, S. E. Kandels-Lewis, R. R. Adams, and W. C. Earnshaw
Proteomic analysis of human metaphase chromosomes reveals topoisomerase II alpha as an Aurora B substrate
Nucleic Acids Res., December 1, 2002; 30(23): 5318 - 5327.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LAPING, N. J.
Right arrow Articles by ZHU, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LAPING, N. J.
Right arrow Articles by ZHU, Y.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP