2007 JASN IMPACT FACTOR 7.111	HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP
advanced	CURRENT ISSUE	ARCHIVES	JASN Express	ONLINE SUBMISSION

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by TSUJIE, M. Articles by HORI, M. Search for Related Content PubMed PubMed Citation Articles by TSUJIE, M. Articles by HORI, M.

Electroporation-Mediated Gene Transfer that Targets Glomeruli

Department of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, Suita, Osaka, Japan.

Correspondence to Dr. Enyu Imai, Department of Internal Medicine and Therapeutics (A8), Osaka University Graduate School of Medicine, Suita 565-0871, Japan. Phone: 81-6-6879-3632; Fax: 81-6-6879-3639; E-mail: kidney{at}medone.med.osaka-u.ac.jp

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract. Electroporation has been applied to introducing DNA into several organs; however, gene expression was localized around the injected area. Examined was the efficiency of intrarenal injection of DNA followed by in vivo electroporation, using FITC-labeled oligodeoxynucleotides (FITC-ODN) and plasmid DNA expressing ß-galactosidase or luciferase. FITC-ODN or expression vectors were injected into the left renal artery; thereafter, the left kidney was electroporated between a pair of tweezer-type electrodes. FITC-ODN were transferred into all glomeruli, and transfected cells were identified as mesangial cells. Four d after transfection of the pCAGGS-LacZ gene, ß-galactosidase expression was observed in 75% of glomeruli. To compare the transfection efficacy by electroporation with that by the hemagglutinating virus of Japan (HVJ) liposome method, a luciferase reporter gene, pActLuc, was transferred into glomeruli by either electroporation or the HVJ liposome method. On day 4, electroporation resulted in higher glomerular luciferase activity than did the HVJ liposome method. We also observed that co-transfection of pcEBNA, an expression vector for Epstein-Barr virus nuclear antigen, and poriP-cLuc, oriP-harboring vector, resulted in an eightfold higher luciferase gene expression than simple poriP-cLuc. No histologic damages were seen in glomeruli or tubular epithelial cells. In conclusion, gene transfer into renal artery followed by electroporation was an effective and simple strategy for gene transfer that targets glomerular mesangial cells.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Gene therapy is now moving from experimental studies to clinical applications. It has opened new possibilities not only for the therapy of inherited diseases but also for new treatments of acquired diseases (1). For gene therapy, the gene transfer method is often one of the limiting steps. In the field of nephrology, the glomerular mesangial cell is a central region of the inflammatory response in the initiation and progression of various glomerular diseases. Successful gene transfer techniques that target glomerular mesangial cells can provide a powerful and attractive tool for revealing the mechanism of glomerular diseases and may be applicable to a therapeutic intervention in renal diseases. To this end, we and others have examined several approaches; however, the conventional liposomes and viral vectors limit the use for transferring genes into glomeruli (2,3). Therefore, several modified approaches have been developed.

One of the simple nonviral methods of introducing genes is using electric pulses. In 1982, Neumann et al. (4) demonstrated that in vitro electroporation of cells in the presence of plasmid DNA resulted in DNA transfer and expression. Since then, this method has become a widely used technique for in vitro transfection. Recently, gene transfer by electroporation in vivo was demonstrated to be effective for introducing DNA into mouse muscle (5), mouse skin (6), chick embryos (7), rat liver (8), and murine melanoma (9). The combination of local DNA injection and in vivo electroporation resulted in highly efficient gene expression, but the gene expression was observed in the limited area, where the injected DNA was distributed. To apply this simple gene transfer technique to the treatment of various glomerular diseases, we should introduce therapeutic genes diffusely into glomeruli. Therefore, we attempted to develop a glomerulus-targeting electroporation in vivo: DNA injection via renal artery followed by application of electric fields. Electroporation is free from oncogenicity, immunogenicity, and cytotoxicity of viral vectors. In addition, combined gene transfer may be achieved easily by electroporation with a mixture of two or more genes. To confirm this hypothesis, we examined whether combined gene transfer with an Epstein-Barr virus nuclear antigen-1 (EBNA-1) expression vector could enhance the transgene expression in an origin of latent viral DNA replication (oriP)-harboring plasmid vector.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
FITC-Labeled Oligodeoxynucleotides
The 15-base-long phosphorothioate oligodeoxynucleotides (ODN) labeled with FITC (FITC-ODN) at the 5' end (5'-FITC-CGAGGGCG-GCATGGG-3') were purchased from Bex (Tokyo, Japan). The ODN were deprotected on the column, dried, resuspended in balanced salt solution (BSS; 140 mM NaCl, 5.4 mM KCl, 10 mM Tris-HCl [pH 7.6]), and quantified by spectrophotometer.

Plasmid DNA
The CLaI-NarI fragment of p205 (10) (a kind gift from Dr. Bill Sugden, University of Wisconsin, Madison, WI), which contains the oriP and triplet repeat (717 bp)-deleted EBNA-1 sequences, was isolated and pEBc vector was constructed by cloning this fragment into the BglII site of pcDNA3 (Invitrogen, San Diego, CA) by bluntend ligation. It has already been reported that this truncated EBNA-1 gave the most efficient replication of oriP-containing DNA (10). Then, pEBAct was constructed by replacing the cytomegalovirus (CMV) promotor of pEBc with the chicken ß-actin promotor derived from pAct-CAT (11). Luciferase gene was isolated from pGL2 promotor vector (Promega, Madison, WI), and pEBActLuc was constructed by cloning the luciferase gene at HindIII and BamHI sites of pEBAct. pCAGGS-LacZ expression vector, in which ß-galactosidase cDNA is driven by CMV enhancer and ß-actin promoter, was kindly provided by Dr. Jun-ichi Miyazaki (Osaka University Graduate School of Medicine, Osaka, Japan). pCMV-luciferase (pcLuc, 7.6 kb) was constructed by cloning the luciferase gene into pcDNA3 (Invitrogen, San Diego, CA) at the HindIII and BamHI sites. A truncated EBNA-1 sequence from p205 was cloned into the BamHI site of pcDNA3 to form pCMV-EBNA-1 (pcEBNA, 7.6 kb), and the oriP sequence was cloned into the BglII site of pcLuc to construct poriP-CMV-luciferase (poriP-cLuc, 10.2 kb).

Animals and In Vivo Transfection Via Renal Artery
To test the possibility of delivering a foreign gene into mesangial cells by electroporation, we first tried to introduce FITC-ODN. Six-wk-old male Sprague-Dawley (SD) rats (Japan SLC, Inc., Hamamatsu, Japan), weighing approximately 150 g, were anesthetized by intraperitoneal injection of pentobarbital (50 mg/kg) and handled in a humane manner in accordance with the guidelines of the Animal Committee of Osaka University. The left kidney and renal artery were surgically exposed with a mid-line incision, and a 24-gauge catheter (Terumo, Tokyo, Japan) was inserted into the left renal artery. After the proximal site of the abdominal aorta was clamped, the left kidney was perfused with BSS via renal artery. We then infused FITC-ODN solution (50 µg in 500 µl of BSS) into the left kidney via the catheter in a one-shot manner and clamped the renal vein immediately after injection. Thereafter, the left kidney was sandwiched between a pair of oval-shaped tweezer-type electrodes, and electric pulses were delivered (see below). After transfection, the catheter was removed and the puncture was fixed with Aronalfa (Toagosei Co. Ltd., Tokyo, Japan), and then the clamps were released. FITC-ODN-transfected left kidneys or contralateral right kidneys were removed 10 min after transfection, and 4-µm-thick cryostat sections of unfixed snap-frozen specimens were examined by fluorescence microscopy (n = 6).

To examine the efficiency of transgene expression in glomeruli, 200 µg of pCAGGS-LacZ gene was transferred by electroporation as above. The pCAGGS-LacZ gene-transfected rats (n = 4) were killed 4 d after transfection. The transfected left kidneys and contralateral right kidneys were removed, and the glomeruli were isolated by the sieving technique. To avoid the effect of internal ß-galactosidase activity of tubular epithelial cells (12), we stained isolated glomeruli by X-gal staining (13). We extracted glomerular DNA from the remaining glomeruli to examine whether transfected pCAGGS-LacZ vector can exist in the glomeruli.

To compare the transfection efficiency of electroporation with that of the hemagglutinating virus of Japan (HVJ) liposome method, 200 µg of luciferase expression plasmid DNA, pEBActLuc, was transferred into the left kidney by either electroporation or the HVJ liposome method (14,15). The glomeruli from pEBActLuc-transfected rats were isolated by the sieving technique 4 d after transfection. The transfection efficiency and the expression intensity of a luciferase gene in glomeruli were compared by using electroporation and the HVJ liposome method.

To examine the possibility of combined gene transfer, we introduced 163 µg of poriP-cLuc gene with or without 121 µg of pcEBNA into glomeruli by electroporation. The glomerular luciferase activities were analyzed 4 d after transfection.

Electric Pulse Delivery and Electrodes
Electric pulses were delivered using an electric pulse generator (Electro Square Porator T820M; BTX, San Diego, CA) connected to a switch box (MBX-4; BTX), and monitored using a graphic pulse analyzer (Optimizor 500; BTX). The shape of the pulse was a square wave, i.e., the voltage remained constant during the pulse duration. A pair of tweezers were tipped with gold-plated stainless electrodes (oval shape adjusted against kidney; 15 mm x 10 mm). Six pulses of the indicated voltage (25, 50, 75, or 100 V) were administered between the kidney at a rate of one pulse/s, with each pulse being 50 ms in duration.

Immunofluorescence Microscopy
To identify the cells into which FITC-ODN were introduced, we stained the transfected kidneys with the monoclonal antibody OX-7, a specific marker for rat mesangial cells (a kind gift from Dr. Ken-ichi Isobe and Dr. Seichi Matsuo, Nagoya University, Nagoya, Japan). Cryostat sections (4-µm slices) were incubated with OX-7, followed by rhodamine-conjugated anti-mouse IgG (Chemicon International Inc., Temecula, CA). Thus, transfected FITC-ODN and mesangial area were observed as green and red fluorescence, respectively. The sections were also stained with an antibody to laminin, a specific marker of basement membrane. The sections were incubated with a rabbit polyclonal anti-laminin antibody (Monosan, Am Uden, The Netherlands), followed by rhodamine-conjugated anti-rabbit IgG. The green fluorescence of FITC and the red fluorescence of rhodamine were taken by photomicrograph on the same film by double exposure.

X-Gal Staining
The pCAGGS-LacZ-transfected rats were anesthetized by intraperitoneal injection of pentobarbital and killed 4 d after transfection. The glomeruli were isolated with the sieving technique and immersed in 1% glutaraldehyde in phosphate-buffered saline (PBS) for 1 h. The X-gal assay was performed as follows (13). Glomeruli were washed by PBS and then incubated at 37°C for 4 h in X-gal solution (PBS: 1 mg/ml X-gal, 5 mM K₃Fe(CN)₆, 5 mM K₄Fe(CN)₆, 2 mM MgCl₂). To stop the enzymatic reaction, we washed the glomeruli in water.

PCR Analysis
Using PCR analysis on isolated glomeruli, we examined further whether the transfected pCAGGS-LacZ vector can exist in the glomerulus 4 d after transfection. Glomerular DNA extracted from pCAGGS-LacZ-transfected left kidneys or contralateral right kidneys were subjected to PCR analysis using two primers specific for the pCAGGS plasmid vector, GGAAAACCCTGGCGTTACCC and CGACCCAGCGCCCGTTGCAC, which yield 512-bp fragments. The cycles were 94°C for 30 s, 55°C for 60 s, and 72°C for 60 s. After 30 cycles, we analyzed the PCR product as well as pCAGGS-LacZ plasmid vectors as positive control.

Luciferase Assay
Glomerular luciferase activity was measured as reported by Wolff et al. (16) with minor modification. Four d after transfection, four to six rats were examined for glomerular luciferase activity. The transfected left kidney was removed, and glomeruli were isolated by the graded sieving technique. Isolated glomeruli from luciferase gene-transfected kidney were homogenized in 50 µl of 1 x cell lysis reagent (Promega) and centrifuged. The supernatant of the lysate was examined for luciferase activity using Promega Luciferase Assay System and a Lumat LB 9501 luminophotometer (EG&G Berthold, Wildbad, Germany). Glomerular luciferase activity of the transfected kidney was corrected based on glomerular protein concentration, which was determined by Bio-Rad protein assay system (Bio-Rad, Hercules, CA) (17). The data were expressed by dividing corrected luciferase activity (luciferase/protein concentration) in glomeruli for each individual transfected kidney. We repeated the experiments at least three times.

Statistical Analyses
All values are expressed as means ± SEM. Statistical significance (defined as P < 0.01) was evaluated using the one-way ANOVA.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Gene Transfer into Mesangial Cells of Glomeruli
To determine the possibility of transferring a foreign gene into glomeruli, we selectively infused FITC-ODN into the left kidney of normal rats via the renal artery and clamped the left renal vein immediately after infusion. Thereafter, the left kidney was electroporated between a pair of tweezer-type electrodes. Although the electrodes did not cover the overall surface of the kidney, FITC-ODN were present diffusely in all glomeruli including the upper or lower pole in the transfected left kidneys (Figure 1A), whereas we observed no fluorescence in the contralateral right kidneys (Figure 1B). FITC-ODN were accumulated in the nuclei of the glomeruli (Figure 1A) and also were detected in some interstitial cells. Weak luminescence was observed in aggregation along the brush border membrane of tubular epithelial cells; however, FITC was not localized in the nuclei (Figure 1C). Immunofluorescence staining with the OX-7 antibody revealed that the FITC-ODN were accumulated in the nuclei of mesangial area, where it is colored red in Figure 1D.

View larger version (57K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. Representative fluorescence photomicrographs of FITC-labeled oligodeoxynucleotide (FITC-ODN)-transfected kidneys. FITC-ODN accumulated mainly in the nuclei of glomerular cells of the transfected left kidney. FITC-positive nuclei were also detected outside the tubular basement membrane stained by rhodamine-conjugated anti-laminin antibody (A). No fluorescence was observed in the contralateral right kidneys (B). Weak luminescence was observed in aggregation along the brush border membrane of tubular epithelial cells; however, FITC was not localized in the nuclei (C). To examine the cellular localization of the transfected ODN, we used OX-7, a specific monoclonal antibody for mesangial cells, and rhodamine-conjugated rabbit anti-mouse IgG to stain mesangial cells. FITC-positive nuclei (green) were seen mainly in the mesangial area (red) (D). The color of FITC-positive nuclei thus changed from green to yellow. Magnifications: x100 in A and B; x200 in C; x400 in D.

Gene Expression in Glomeruli
To examine the transgene expression by this gene transfer method, we performed the X-gal staining on isolated glomeruli 4 d after pCAGGS-LacZ gene transfection. Four d after transfection, ß-galactosidase expression was observed in 75% of glomeruli (Figure 2A). No X-gal-positive glomeruli were observed in the normal rats (Figure 2B). To address whether the transfected pCAGGS-LacZ vector can exist in the glomerulus, we analyzed glomerular DNA 4 d after pCAGGS-LacZ transfection. PCR analysis demonstrated that the pCAGGS vector existed in transfected glomeruli but not in the glomeruli of the contralateral right kidneys (Figure 2C).

View larger version (66K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. ß-galactosidase activity in glomeruli. The X-gal staining was performed on isolated glomeruli 4 d after pCAGGS-LacZ gene transfection. (A) ß-galactosidase expression was observed in 75% of glomeruli. (B) No X-gal-positive glomeruli were observed in the normal rats. (C) PCR analysis demonstrated that the pCAGGS vector existed in transfected glomeruli but not in the glomeruli of the untransfected contralateral right kidneys. Lane 1, molecular weight marker; lanes 2 through 5, glomerular DNA from pCAGGS-LacZ-transfected left kidney; lanes 6 through 9, glomerular DNA from the untransfected right kidney; lane 10, positive control; lane 11, negative control.

Effect of Voltage on Transgene Expression
To determine the optimal parameter of the electric field intensity, we perfused the left kidney with a luciferase reporter gene, pEBActLuc, and then the perfused kidney was electro-transferred with 25, 50, 75, and 100 electrode voltages. On day 4, luciferase activities were not significantly dependent on voltages 25 to 100 V (4.00 ± 2.60 x 10⁵, 4.70 ± 2.93 x 10⁵, 6.47 ± 3.68 x 10⁵, and 8.71 ± 7.58 x 10⁵ RLU/µg glomerular protein at 25, 50, 75, and 100 V, respectively), although they tended to be increased in accordance with voltages (Figure 3A). We analyzed the relationship between glomerular luciferase activities and electric current on different voltages. However, luciferase activities did not correlate significantly with electric current (luciferase activities versus electric current, r = 0.10, P = 0.23). On histologic examination, we observed little harmful effect on treated kidneys except small burns on the surface of the kidney in contact with electrodes. The burn injury became prominent at 100 V and less at 25 to 75 V. There was no histologic damage in glomeruli and tubular epithelial cells by electric pulses even at 100 V.

View larger version (15K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. Luciferase activity in glomeruli. (A) We transferred pEBActLuc by electroporation with 25, 50, 75, or 100 V. Luciferase activities were observed to be dependent on the voltages at 25 to 100 V, although there were no significant differences. However, small burns were observed at 100 V on the surface in contact with electrodes. (B) pEBActLuc was transferred into glomeruli by either electroporation or the hemagglutinating virus of Japan (HVJ) liposome method. On day 4, electroporation resulted in higher glomerular luciferase activity than did the HVJ liposome method; *, P < 0.05. (C) Combined gene transfer of poriP-cLuc with pcEBNA resulted in an eightfold higher level of glomerular luciferase activity than poriP-cLuc only; **, P < 0.01.

Transfection Efficacy
To compare the transfection efficacy by electroporation with that by the HVJ liposome method, pEBActLuc was transferred into glomeruli by either electroporation with 75 V or the HVJ liposome method. On day 4, the electroporation-mediated gene transfer technique resulted in significantly higher glomerular luciferase activity than did the HVJ liposome method (6.47 ± 3.68 x 10⁵ versus 1.18 ± 0.24 x 10⁵ RLU/µg glomerular protein, electroporation versus HVJ liposome method, P = 0.02; Figure 3B).

Combination Gene Transfer
To enhance the expression of transgene, poriP-cLuc, with or without pcEBNA, was introduced into glomeruli by electroporation. EBNA-1 has been reported to bind the oriP sequence and enhance gene expression (18). Combination gene transfer of poriP-cLuc with pcEBNA resulted in an eightfold higher level of glomerular luciferase activity than poriP-cLuc without pcEBNA (5.30 ± 1.00 x 10⁵ versus 0.70 ± 0.36 x 10⁵ RLU/µg glomerular protein, respectively; P < 0.01; Figure 3C).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we first demonstrated that in vivo electroporation provides an efficient approach for glomerulus-targeted gene transfer. By using electroporation, we observed FITC-ODN diffusely in all glomeruli. X-gal staining showed that ß-galactosidase expression was observed in 75% of glomeruli. This broad distribution of gene transduction was distinguished from the expression in the previous reports concerning electroporation. Gene transfer and expression have been reported to occur only around the area where the needle-injected DNA was disseminated, as reported in muscle (5), liver (8), melanoma (9), and so forth. We assume that the key to our efficient gene transfer to glomeruli lies on the following two points: (1) DNA solution was distributed diffusely in the kidney by injection via renal artery, and (2) electric pulses could efficiently affect the DNA-injected kidney with the use of tweezer-type electrodes.

In our experiments, we infused DNA into the renal artery and immediately clamped the renal vein until the application of electric fields so that renal blood vessels were filled with DNA solution. As the glomerular capillaries have abundant fenestrations, a large volume of DNA solution can also enter the mesangial area through these fenestrations. In addition, we used a pair of oval-shaped tweezer-type electrodes. Although these electrodes could not cover the overall surface of the kidney, FITC-ODN were accumulated in the nuclei of the glomeruli. Because the kidney is a well conductor of electric pulses, it seemed to be affected diffusely by electric fields. Goto et al. (19) reported that the electric field in the "larger" tumor mass created by needle-type electroporation and the needle-injected DNA solution would become more inhomogeneous, leading to patchy expression of the transgene. We also examined the transfection efficiency with a pair of small round-shaped electrodes or needle-type electrodes; however, these electrodes resulted in less luciferase activity than the oval-shaped electrodes (data not shown). Compared with the previous reports, it is expected that the uniform electric field in the kidney created by the tweezer-type electrode and DNA injection via the renal artery would induce homogeneous expression of the transgene. Therefore, a well-adjusted electrode that fits to the shape of the kidney seems to be ideal for in vivo electroporation.

FITC-ODN filtrated by glomerular basement membrane were also detected in association with the brush border membrane, as previously reported (20,21). However, the luminescence observed at the brush border membrane was weak compared with that in glomeruli. In addition, FITC-ODN were localized in the nuclei of glomerular cells 10 min after transfection; however, we could not find the nuclear localization in tubular epithelial cells. As it was reported that intravenously injected ODN were not totally degenerated after being phagocytosed by the proximal tubules (22), antisense ODN gathered along the brush border may have an effect in tubular cells. We, however, need to introduce ODN directly into the nuclei by escaping from the cytoplasmic granules (endosome and lysosomes) (23), because the effects of antisense ODN normally are dependent on RNase H-mediated degradation of the target RNA. Therefore, our observation that ODN were accumulated in the nuclei of glomerular cells but not tubular epithelial cells suggests that antisense ODN could have effects only in glomerular cells.

Rols et al. (9) showed that a ß-galactosidase can be expressed in 4% of transfected cells by a direct needle injection of the plasmid followed by electroporation in the melanoma. In the present study, the glomerular ß-galactosidase or luciferase gene expression was observed in 75% of glomeruli, whereas FITC-ODN were introduced into all glomeruli. Several expression steps might reduce the number of X-gal-positive glomeruli. We reported that the HVJ liposome-mediated gene transfer method allows us selective gene delivery into the glomeruli, mainly mesangial cells, while its expression is limited to 35% of glomeruli (14,15). Overall, in vivo electroporation with intrarenal-arterial DNA injection was more effective than the HVJ liposome method.

Gene transfer by electroporation, which uses plasmid DNA as the vector, has several advantages over the conventional gene transfer method using viral vectors. In addition, preparation of a large quantity of highly purified plasmid DNA is easy and inexpensive. Furthermore, we made a device to prolong the expression of transgene with an EBV replicon-based plasmid, containing the latent viral DNA oriP and EBNA-1 (24). We emphasize that combination gene therapy can be planned and performed easily and simply in the same manner as for single-gene therapy, merely by mixing more than one therapeutic plasmid. Gene transfer can be repeated without apparent immunologic responses to the DNA vector. It is unlikely that recombination events occur with the cellular genome, eliminating the risk of the insertional mutagenesis possibly associated with the use of viral vectors. The usefulness and safety will have to be assessed for further application of in vivo electroporation to humans. The improvement to this method may provide a new approach to gene therapy for human diseases. In conclusion, we believe that we have demonstrated that electroporation is highly efficient in transferring into glomeruli and that it may present fewer obstacles for clinical applications.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Crystal RG: Transfer of genes to humans: Early lessons and obstacles to success. Science270 : 404-410,1995[Abstract/Free Full Text]
2. Imai E, Isaka Y: Strategies of gene transfer to the kidney. Kidney Int 53:264 -272, 1998[Medline]
3. Fine LG: Gene transfer into the kidney: Promise for unravelling disease mechanisms, limitations for human gene therapy [Editorial]. Kidney Int 49:612 -619, 1996[Medline]
4. Neumann E, Schaefer-Ridder M, Wang Y, Hofschneider PH: Gene transfer into mouse lyoma cells by electroporation in high electric fields. EMBO J 1:841 -845, 1982[Medline]
5. Aihara H, Miyazaki J: Gene transfer into muscle by electroporation in vivo. Nat Biotechnol 16:867 -870, 1998[Medline]
6. Titomirov AV, Sukharev S, Kistanova E: In vivo electroporation and stable transformation of skin cells of newborn mice by plasmid DNA. Biochim Biophys Acta 1088:131 -134, 1991[Medline]
7. Muramatsu T, Shibata O, Ryoki S, Ohmori Y, Okumura J: Foreign gene expression in the mouse testis by localized in vivo gene transfer. Biochem Biophys Res Commun 233:45 -49, 1997[Medline]
8. Heller R, Jaroszeski M, Atkin A, Moradpour D, Gilbert R, Wands J, Nicolau C: In vivo gene electroinjection and expression in rat liver. FEBS Lett 389:225 -228, 1996[Medline]
9. Rols MP, Delteil C, Golzio M, Dumond P, Cros S, Teissie J: In vivo electrically mediated protein and gene transfer in murine melanoma. Nat Biotechnol 16:168 -171, 1998[Medline]
10. Yates JL, Warren N, Sugden B: Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313:812 -815, 1985[Medline]
11. Fregien N, Davidson N: Activating elements in the promoter region of the chicken beta-actin gene. Gene48 : 1-11,1986[Medline]
12. Kitamura M, Taylor S, Unwin R, Burton S, Shimizu F, Fine LG: Gene transfer into the rat renal glomerulus via a mesangial cell vector: Site-specific delivery, in situ amplification, and sustained expression of an exogenous gene in vivo. J Clin Invest94 : 497-505,1994
13. Lanford RE, White RG, Dunham RG, Kanda P: Effect of basic and nonbasic amino acid substitutions on transport induced by simian virus 40 T-antigen synthetic peptide nuclear transport signals. Mol Cell Biol 8:2722 -2729, 1988[Abstract/Free Full Text]
14. Isaka Y, Fujiwara Y, Ueda N, Kaneda Y, Kamada T, Imai E: Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 92:2597 -2601, 1993
15. Akagi Y, Isaka Y, Arai M, Kaneko T, Takenaka M, Moriyama T, Kaneda Y, Ando A, Orita Y, Kamada T, Ueda N, Imai E: Inhibition of TGF-beta 1 expression by antisense oligonucleotides suppressed extracellular matrix accumulation in experimental glomerulonephritis. Kidney Int 50: 148-155,1996[Medline]
16. Wolff JA, Williams P, Acsadi G, Jiao S, Jani A, Chong W: Conditions affecting direct gene transfer into rodent muscle in vivo. Biotechniques 11:474 -485, 1991[Medline]
17. Schleicher E, Wieland OH: Evaluation of the Bradford method for protein determination in body fluids. J Clin Chem Clin Biochem 16:533 -534, 1978[Medline]
18. Sugden B, Warren N: A promoter of Epstein-Barr virus that can function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection. J Virol 63:2644 -2649, 1989[Abstract/Free Full Text]
19. Goto T, Nishi T, Tamura T, Dev SB, Takeshima H, Kochi M, Yoshizato K, Kuratsu J, Sakata T, Hofmann GA, Ushio Y: Highly efficient electro-gene therapy of solid tumor by using an expression plasmid for the herpes simplex virus thymidine kinase gene. Proc Natl Acad Sci USA97 : 354-359,2000[Abstract/Free Full Text]
20. Rappaport J, Hanss B, Kopp J, Copeland TD, Bruggeman LA, Coffman TM, Klotman PE: Transport of phosphorothioate oligonucleotides in kidney: Implications for molecular therapy. Kidney Int47 : 1462-1469,1995[Medline]
21. Noiri E, Peresleni T, Miller F, Goligorsky MS: In vivo targeting of inducible NO synthase with oligodeoxynucleotides protects rat kidney against ischemia. J Clin Invest 97:2377 -2383, 1996[Medline]
22. Oberbauer R, Schreiner G, Meyer T: Renal uptake of an 18-mer phosphorothioate oligonucleotide. Kidney Int48 : 1226-1232,1995[Medline]
23. Wanger R: Gene inhibition using antisense oligodeoxynucleotides. Nature 372:333 -335, 1994[Medline]
24. Tsujie M, Isaka Y, Nakamura H, Akagi Y, Kaneda Y, Ueda Naohiko, Imai Enyu, Hori M: Prolonged transgene expression in glomeruli using an EB virus replicon vector system combined with AVE type HVJ liposomes. J Am Soc Nephrol 10:449A , 1999

This article has been cited by other articles:

				H. Suga, H. Nagasaki, T.-a. Kondo, Y. Okajima, C. Suzuki, N. Ozaki, H. Arima, T. Yamamoto, N. Ozaki, M. Akai, et al. Novel Treatment for Lithium-Induced Nephrogenic Diabetes Insipidus Rat Model Using the Sendai-Virus Vector Carrying Aquaporin 2 Gene Endocrinology, November 1, 2008; 149(11): 5803 - 5810. [Abstract] [Full Text] [PDF]

				A. Gazdhar, P. Fachinger, C. van Leer, J. Pierog, M. Gugger, R. Friis, R. A. Schmid, and T. Geiser Gene transfer of hepatocyte growth factor by electroporation reduces bleomycin-induced lung fibrosis Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L529 - L536. [Abstract] [Full Text] [PDF]

				J. Ma, T. Matsusaka, H. Yang, H. Kawachi, F. Shimizu, Y. Isaka, E. Imai, V. Kon, and I. Ichikawa Local Actions of Endogenous Angiotensin II in Injured Glomeruli J. Am. Soc. Nephrol., May 1, 2004; 15(5): 1268 - 1276. [Abstract] [Full Text] [PDF]

				K. Yazawa, Y. Isaka, S. Takahara, E. Imai, N. Ichimaru, Y. Shi, Y. Namba, and A. Okuyama Direct transfer of hepatocyte growth factor gene into kidney suppresses cyclosporin A nephrotoxicity in rats Nephrol. Dial. Transplant., April 1, 2004; 19(4): 812 - 816. [Abstract] [Full Text] [PDF]

				E. A. Nunamaker, H.-Y. Zhang, Y. Shirasawa, J. N. Benoit, and D. A. Dean Electroporation-mediated delivery of catalytic oligodeoxynucleotides for manipulation of vascular gene expression Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2240 - H2247. [Abstract] [Full Text] [PDF]

				C. Daniel, Y. Takabatake, M. Mizui, Y. Isaka, H. Kawashi, H. Rupprecht, E. Imai, and C. Hugo Antisense Oligonucleotides Against Thrombospondin-1 Inhibit Activation of TGF-{beta} in Fibrotic Renal Disease in the Rat in Vivo Am. J. Pathol., September 1, 2003; 163(3): 1185 - 1192. [Abstract] [Full Text] [PDF]

				E. Imai Gene Therapy for Renal Diseases: Its Potential and Limitation J. Am. Soc. Nephrol., April 1, 2003; 14(4): 1102 - 1104. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by TSUJIE, M. Articles by HORI, M. Search for Related Content PubMed PubMed Citation Articles by TSUJIE, M. Articles by HORI, M.