 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
The Third Department of Medicine, Shiga University of Medical Science,
Seta, Otsu, Shiga
Japan Foundation for Aging and Health, Higashiura Cho, Aichi,
Japan.
Correspondence to Dr. Masakazu Haneda, The Third Department of Medicine, Shiga University of Medical Science, Seta, Otsu, Shiga, 520-2192, Japan. Phone: 81-77-548-2222; Fax: 81-77-543-3858; E-mail: haneda{at}belle.shiga-med.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-3, IL-4, IL-5, interferon-
, granulocyte-macrophage
colony-stimulating factor, and FAS ligand and to upregulate expression of
these genes in T cells during immune responses
(1,2).
Proteins of NFAT are present in the cytoplasm of resting lymphocytes,
translocate into the nucleus after activation of lymphocytes, and can activate
target gene expression. This process was shown to be regulated by
dephosphorylation of the regulatory domain of NFAT by calcineurin
(1,3),
one of the serine-threonine phosphatases, which became activated by
stimulation that increased intracellular calcium concentrations
(4). Immunosuppressive agents
cyclosporin A (CsA) and FK506 were found to inhibit NFAT-mediated gene
expression in T lymphocytes by preventing nuclear translocation of NFAT
through the inhibition of calcineurin activity
(1). The NFAT family consists of at least five isoforms: NFAT1, NFAT2 (NFATc), NFAT3, NFAT4, and NFAT5 (1,5). Although the distribution of NFAT originally was thought to be restricted to lymphoid systems, the expression of some NFAT isoforms, such as NFAT1 or NFAT3, has been revealed to be ubiquitous (6). Until recently, little was known about the mechanism of activation, targets, or functions of NFAT in nonlymphoid tissues. However, evidence that indicates an important role of NFAT in nonlymphoid tissues has emerged during the past several years. In cardiomyocytes, NFAT3 was found to induce the expression of brain natriuretic peptide, a peptide overexpressed in the hypertrophic heart, through binding to the promoter region of brain natriuretic peptide gene (7). In addition, overexpression of an active form of NFAT3 in the mouse heart resulted in cardiac hypertrophy, suggesting that NFAT3 might play an important role in the process of cardiac hypertrophy (7). In the developing heart, expression of NFAT2 protein was shown to be restricted to valvular precursor cells during valve formation, and mice that lacked NFAT2 gene died from cardiac failure in utero because of defects of cardiac valves (8,9). These reports indicate that the family of NFAT plays an important role not only in the process of cardiac development but also in pathologic conditions such as cardiac hypertrophy. Moreover, NFAT has been shown to regulate skeletal muscle fiber size and adipocyte differentiation (10,11).
It is widely known that treatment with CsA results in renal dysfunction characterized by glomerulosclerosis and renal interstitial fibrosis (12), which suggests that NFAT might contribute to development of the renal dysfunction induced by CsA. However, the precise functions of NFAT in kidney cells have not been clarified. Renal mesangial cells are present in renal glomeruli and respond to various extracellular stimuli (13). On activation, mesangial cells are able to proliferate, to produce extracellular matrix proteins, and to release numerous cytokines or autocoids, which suggests that mesangial cells play an important role in the process of various forms of glomerular damage (13). Because growth factors, vasoactive substances, and mechanical stresses have been reported to activate intracellular calcium signal transduction in mesangial cells (14,15), we hypothesized that NFAT might be present in mesangial cells and participate in the process of mesangial cell activation. Here, we present evidence that NFAT2 is present in cultured rat mesangial cells and activated by endothelin-1 (ET-1). Furthermore, the activated NFAT2 can upregulate cyclooxygenase-2 (COX-2) gene expression in mesangial cells. The results of our study provide the first evidence for the expression and physiologic functions of NFAT in mesangial cells and also identify a novel target gene of NFAT.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids
To make a probe for rat COX-2 mRNA expression, we amplified a fragment of
rat COX-2 cDNA (bases 1229 to 1813) by reverse transcription-PCR with
the use of rat kidney mRNA, as described elsewhere
(19). The cDNA fragment was
subcloned into pCR II vector with a TA cloning kit (Invitrogen, Carlsbad, CA).
To construct a reporter of rat COX-2 promoter, a fragment of rat COX-2
promoter (bases -983/+24) was amplified by PCR with the use of rat genomic DNA
as a template (20). The PCR
product was subcloned into a luciferase expression vector, PGL2 basic
(Promega, Madison, WI), at MluI-XhoI sites. To produce a
5'-deleted reporter (-373/+24), the rat COX-2 promoter reporter (bases
-983/+24) was digested with SmaI and then re-ligated. A mutation of
the reporter (bases -373/+24) was made by PCR with the use of the QuickChange
Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) and a pair of
oligonucleotides shown in Figure
1B, below (mutated D oligonucleotides). Expression vectors of
mouse NFAT1c, human NFAT2 and NFAT4, and human ET-A receptor were obtained
from Dr. A. Rao (Harvard University, Boston, MA), Dr. N. Arai (DNAX
Institute), and Dr. M. Yanagisawa (University of Texas Southwestern Medical
Center, Dallas, TX), respectively
(21,22,23).
To make a dominant negative form of NFAT (DN-NFAT), a region encoding mouse
NFAT1c amino acid residues 1 to 167 was amplified by PCR and cloned into
pcDNA3 (Invitrogen). The sequence authenticity of these plasmids was confirmed
with the use of a rhodamine terminator cycle sequence system (ABI) and an ABI
PRISM 310 genetic analyzer (Foster City, CA).
|
Immunoblot Analysis
Mesangial cells were lysed in an ice-cold lysis buffer containing 150 mM
NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% sodium dodecyl sulfate, 1% Nonidet P-40,
and protease inhibitor cocktail (Boehringer Mannheim, Mannheim, Germany). The
cell lysates and nuclear extracts prepared as described below were subjected
to sodium dodecyl sulfate—polyacrylamide gel electrophoresis (7.5% gel
for NFAT or 10% gel for COX-2) and transferred to polyvinylidenedifluoride
membranes (Millipore, Bedford, MA). The membranes were probed with specific
antibodies for NFAT2 (7A6; Affinity Bioreagents Inc., Golden, CO), NFAT1
(G1-D10), NFAT3, NFAT4 (Santa Cruz Biotechnology, Santa Cruz, CA), or COX-2
(Cayman Chemical, Ann Arbor, MI). Immunoreactive bands were detected with an
enhanced chemiluminescence detection system (New England Biolaboratories,
Boston, MA).
Northern Blot Analysis
Total RNA (12 µg) of mesangial cells, which was isolated with TRIzo1
Reagent (Life Technologies-BRL), was electrophoresed through 1%
formaldehyde-agarose gels and transferred onto nylon membranes (Nytran;
Schleicher & Schwell, Dassel, Germany). The membranes were hybridized with
[32P]-labeled rat COX-2 cDNA, which was labeled by use of
a Bca BEST labeling kit (TAKARA, Otsu, Japan), and subjected to
autoradiography as described elsewhere
(24). The membranes were
reprobed with 36B4 as an internal standard
(25).
Immunocytochemical Analysis
Mesangial cells plated on round cover glasses in 12-well culture dishes
were treated with indicated stimuli. The cells were washed twice with ice-cold
phosphate-buffered saline and fixed with phosphate-buffered saline containing
3% paraformaldehyde and then with methanol at -20°C. The fixed cells were
incubated with the primary antibody for NFAT2 (1:250 dilution) overnight at
4°C, washed, and then incubated with a biotinylated secondary antibody
(1:500 dilution; Vector Laboratories, Burlingame, CA). Immunoreactive stains
were developed with VECTASTAIN ABC kit (Vector Laboratories). For
quantification of nuclear staining of NFAT2, the percentages of nuclear
staining in total cells in two experiments were determined by three
independent observers, and the mean percentages were calculated.
Nuclear Extraction and Electrophoretic Mobility Shift Analysis
Nuclear extracts were prepared as described by Mages et al.
(26) with minor modifications.
In brief, the cells were lysed with the addition of a hypotonic buffer (10 mM
HEPES [pH 7.8], 0.1 mM ethylenediaminetetraacetate [EDTA], 15 mM KCl, 2 mM
MgCl2, 1 mM dithiothreitol, and protease inhibitor cocktail) with
0.8% Nonidet P-40 and microcentrifuged at 6000 x g for 10 min.
Pellets were resuspended with a high-salt buffer (20 mM HEPES [pH 7.8], 420 mM
NaCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.2 mM EDTA, and 25%
glycerol), rotated for 30 min at 4°C, and microcentrifuged at 13,000
x g for 30 min. Supernatants were used as nuclear proteins for
nuclear extraction and electrophoretic mobility shift analysis (EMSA). The
nuclear proteins (4 µg) were incubated with 1 µg of poly dI-dC in a
binding buffer (10 mM Tris [pH 7.5], 50 mM NaCl, 1 mM dithiothreitol, 1 mM
EDTA, and 5% glycerol) for 30 min and then reacted with an annealed
complementary NFAT consensus oligonucleotide (CGCCCAAAGAGGAAAATTTGTTTTCATA
[Santa Cruz]) from mouse IL-2 promoter or annealed synthetic complementary
oligonucleotides from the rat COX-2 promoter (Amersham) (see
Figure 1B, below) at room
temperature for 20 min; the oligonucleotides were labeled by reactions with
-32P-ATP and T4 oligonucleotide kinase (New England
Biolaboratories). The reaction mixtures were electrophoresed through 4%
polyacrylamide gels and were subjected to autoradiography. Competition
experiments were performed after the addition of an excess amount of the
indicated unlabeled doublestranded oligonucleotides to the reaction mixtures.
For supershift analysis, the indicated antibodies were preincubated at
37°C for 30 min before the reactions with the radiolabeled probes.
Reporter Analysis
SV-40 transformed mouse mesangial cells were plated in 12-well dishes.
After 24 h, the cells were transfected with 0.25 µg of the COX-2 promoter
reporter vectors and 1.0 µg of the ET-A receptor expression vector with one
of the NFAT2 expression vector, DN-NFAT, or a control vector (pcDNA3;
Invitrogen), as indicated. A CMV-LacZ plasmid (0.1 µg) was co-transfected
as an internal control for transfection efficiency and sample handling.
Twenty-four h after transfection, the cells were starved in DMEM with 0.1% FBS
for another 24 h, followed by stimulation with ET-1 (10-7 M;
Peptide Institute, Suita, Japan) for 8 h, and lysed in 150 µl of a reporter
lysis buffer (Promega) for 10 min. Ten-µl aliquots of extracts were used to
measure luciferase activity by use of Luciferase Assay System (Promega) and a
luminometer (Auto LUMIcounter Nu1422ES; Nition, Tokyo, Japan). Co-transfected
ß-galactosidase activity was also determined
(27) and used to normalize the
luciferase activity.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
After dephosphorylation by calcineurin, nuclear localization sequences of NFAT are unmasked and NFAT translocates into the nucleus, where it regulates target gene expression (1,3). Therefore, we next examined the nuclear translocation of NFAT2 in mesangial cells treated with Ca ionophore. Immunocytochemical analysis with the NFAT2 antibody revealed that NFAT2 translocated into the nucleus at 30 min after stimulation with Ca ionophore (Figure 2C). In addition, the nuclear translocation of NFAT2 in mesangial cells in response to Ca ionophore was completely suppressed by CsA (Figure 2C). These data indicate that NFAT2 was expressed in rat mesangial cells and translocated into the nucleus after Ca ionophore stimulation.
ET-1 and Activation of NFAT2 in Mesangial Cells
Because we have already reported that ET-1, a potent vasoactive substance,
can activate signal transduction cascades in mesangial cells that culminate in
an increase in intracellular calcium levels
(15), we used ET-1 as a
physiologic stimulus. Treatment of mesangial cells with ET-1 (10-8
M) induced the nuclear translocation of NFAT2 at 15 to 60 min, and this
nuclear staining returned to the basal level at 120 min
(Figure 3A). Similarly to the
nuclear translocation of NFAT2 induced by Ca ionophore, pretreatment with CsA
prevented ET-1—induced nuclear staining with NFAT2
(Figure 3A). The means of
percentages of the nuclear staining in total cells in two experiments were
1.1% (0 min), 76.6% (15 min), 52.5% (30 min), 53.8% (60 min), 2.5% (120 min),
and 2.1% (CsA+, 30 min). We also examined the expression of NFAT2 in the
nuclear fractions by immunoblot analysis. As shown in
Figure 3B, ET-1 increased the
amount of NFAT2 in the nucleus, which was inhibited by CsA.
|
We next examined the effects of ET-1 on the DNA binding activity of NFAT2 using EMSA with the NFAT consensus binding sequence from the mouse IL-2 promoter in mesangial cells. ET-1 increased the NFAT-DNA complex formation with a time course similar to that of NFAT2 nuclear translocation (Figure 3C) and in an ET-1 concentration-dependent manner (Figure 3D). CsA also inhibited the ET-1—induced increase in NFAT DNA binding activity (Figure 3C, lane 6, and E, lane 4). Furthermore, this ET-1—stimulated DNA-protein complex was completely supershifted by the NFAT2 antibody (Figure 3F), which indicates that the complex induced by ET-1 was composed of NFAT2. Together, these data demonstrate that a physiologic agonist, such as ET-1, can cause the nuclear translocation and increase the DNA binding activity of NFAT2 in cultured rat mesangial cells.
CsA Inhibition of ET-1—Induced COX-2 Gene Expression in
Mesangial Cells
We next examined the expression of the COX-2 gene as a candidate
NFAT2-regulated gene, because various stimuli have been shown to induce COX-2
expression (30) and CsA has
been shown to inhibit its expression stimulated by IL-1 or serotonin in
mesangial cells
(31,32).
As reported elsewhere
(33,34),
ET-1 induced the expression of COX-2 mRNA maximally at 2 h and of
COX-2 protein at 8 h (data not shown). Pretreatment with CsA suppressed this
ET-1—induced expression of COX-2 mRNA in a
concentration-dependent manner, with maximal suppression at 10-7 M
(Figure 4A), and it also
inhibited the expression of COX-2 protein stimulated by ET-1
(Figure 4B). These data
indicate that calcineurin may play an important role in the regulation of
ET-1—induced COX-2 expression in mesangial cells.
|
NFAT2 Enhancing of ET-1—Stimulated COX-2 Promoter Activity in
Mesangial Cells
The sequence extending 500 bases upstream from the transcription start site
in rat COX-2 promoter, where several cis-acting regulatory sites exist
(Figure 1A
(20,35)),
contains four putative NFAT binding sites (the sequences are GGAAA or TTTCC)
(3). The locations and
sequences of these sites are shown in
Figure 1. Thus, we speculated
that NFAT2 might bind directly to these sequences and regulate the rat COX-2
promoter activity. To test this, we transfected the NFAT2 expression vector
into COS cells, prepared nuclear extracts from the transfected cells, and
carried out EMSA with four double-stranded oligonucleotides containing the
candidate NFAT binding sequences in the rat COX-2 promoter
(Figure 1B). A recombinant
NFAT2 protein, prepared from the NFAT2 cDNA-transfected cells, showed strong
binding activity to the NFAT consensus oligonucleotide from mouse IL-2
promoter (Figure 5A, lane 3).
This NFAT2 binding activity was potentiated further by treatment of the cells
with 12-O-tetradecanoylphorbol 13-acetate (TPA) plus
ionomycin (TPA/Io) for 30 min (Figure
5A, lane 4), as described elsewhere
(22). Furthermore, NFAT2 from
the transfected cells stimulated with TPA/Io produced a DNA-protein complex
with the D oligonucleotide at sequences located between -81 and -46 in the rat
COX-2 promoter (Figure 1B);
this complex is indicated by the closed arrow in
Figure 5B (lane 4). This
binding band was completely competed out with an excess amount of the
unlabeled oligonucleotide containing the NFAT binding site in the mouse IL-2
promoter (NFAT con, Figure 5B,
lane 6), and it was supershifted by coincubation with the NFAT2 antibody
(Figure 5B, lane 7) but not by
coincubation with a preimmune serum (data not shown). This binding activity
was absent from cells transfected with a control vector
(Figure 5B, lanes 1 and 2).
Moreover, NFAT2 could not bind to a mutated D oligonucleotide
(Figure 5C), whose putative
NFAT binding site (GGAAA) was changed to TCTAA as Holtz-Hoppelmann et
al. (2) described
Figure 1B), which indicates
that NFAT2 can bind directly to this putative NFAT site in the D
oligonucleotide. NFAT2 did not bind to the A, B, or C oligonucleotides shown
in Figure 1B (data not
shown).
|
To determine whether NFAT2 can regulate COX-2 promoter activity, we next cloned the rat COX-2 promoter sequences into a luciferase reporter plasmid, PGL2 basic. Because transfection efficiency in primary culture of rat mesangial cells is low, we used SV-40 transformed mouse mesangial cells for reporter analysis. These mouse mesangial cells expressed NFAT2, and CsA inhibited COX-2 gene expression induced by FBS or TPA/Io in these cells (data not shown), which suggests that regulatory pathways similar to those in rat mesangial cells were conserved in the transformed mouse mesangial cells. We therefore transfected a reporter plasmid containing bases extending from -374 to +24 of the rat COX-2 promoter with ET-A receptor cDNA into the mouse mesangial cells and stimulated the transfected cells with ET-1 for 8 h. ET-1 enhanced COX-2 promoter activity by approximately 1.5-fold (Figure 6, A and B). Overexpression of NFAT2 expression plasmid significantly enhanced ET-1—stimulated reporter activity in a manner dependent on the amount of NFAT2 cDNA (Figure 6A). In contrast, an amino-terminal domain of NFAT1c, which functions as DN-NFAT (36), reduced basal and ET-1—stimulated reporter expression (Figure 6A). NFAT2 expression had no effect on the activity of the control reporter, PGL2 basic (data not shown). Furthermore, NFAT2 did not enhance the expression of a reporter (Figure 6B) that was mutated at the putative NFAT binding site (GGAAA to TCTAA) identified by EMSA as described above, which indicates that NFAT2 regulates COX-2 promoter activity through this putative NFAT binding site in mesangial cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The NFAT family has been reported to include five isoforms (NFAT1 through NFAT5). Although they have similar DNA binding specificities, they are distributed in different tissues and show different patterns of inducibility by various stimuli (1), which suggests that individual isoforms may serve specific cell functions. The activities of NFAT1 through NFAT4 are regulated by calcineurin, which can dephosphorylate these NFAT isoforms and cause their nuclear translocation (1,3), whereas NFAT5 is consistently present in the nucleus and has activity that is independent of calcineurin (5). In the present study, the immunoblot analysis, probing with antibodies that specifically recognize each isoform, revealed that rat mesangial cells expressed mainly the NFAT2 isoform. Previous reports have shown that NFAT1 and NFAT3 are constitutively expressed in most tissues and cell lines, whereas NFAT2 is not present ubiquitously and has expression that is induced after T-cell activation (6,22). However, we did not detect the presence of NFAT1 and NFAT3 in rat mesangial cells by immunoblot analysis. Furthermore, EMSA demonstrated that the protein complex with the NFAT consensus oligonucleotide was completely supershifted by the addition of the specific antibody for NFAT2, and it also demonstrated that NFAT2 was the main isoform in rat mesangial cells. An expression pattern similar to that in mesangial cells was observed in a study in rat glioma cells (29). We also revealed that Ca ionophore and a physiologic agonist, ET-1, could induce the nuclear translocation of NFAT2 and enhance its DNA binding activity in mesangial cells and that both of these events were suppressed by the treatment with CsA, an inhibitor of calcineurin. These data suggest that calcineurin is a major regulator of NFAT2 activity in mesangial cells and that the mechanism of regulation is similar to that in other types of cells. To our knowledge, this is the first report to show that physiologic stimuli like ET-1 can regulate NFAT activity in mesangial cells.
We also found several indications that NFAT2 is involved in the
ET-1—stimulated COX-2 expression in mesangial cells. First, ET-1
activates NFAT2 in mesangial cells, and ET-1-induced COX-2 expression is
inhibited by CsA, which prevents NFAT2 activation. Second, the NFAT binding
site is located in the promoter region of rat COX-2 gene, as
determined by EMSA. Third, the overexpression of NFAT2 increases the
ET-1—induced COX-2 promoter activation, whereas DN-NFAT decreases COX-2
promoter activity. Finally, the mutation of NFAT binding site completely
abolishes the COX-2 promoter activation induced by NFAT2. The promoter regions
of rat, mouse, and human COX2 have been isolated, sequenced, and shown to
contain several consensus cis-acting regulatory sequences, including
NF-
B, Sp-1, C/EBP, ATF/CRE, and E box
(Figure 1A). These sequences
were shown to be critical for COX-2 induction produced by various stimuli in
different species and cell types
(20,30,35,37,38,39).
However, there is no report indicating that the GGAAA sequences in the rat
COX-2 promoter function as NFAT binding sites and regulate the promoter
activity. The GGAAA sequence present in the rat COX-2 promoter, which was the
site of NFAT2 binding, is conserved in the mouse and human COX-2 promoters
(38), which suggests that NFAT
might also regulate mouse or human COX-2 promoter activity. Indeed, in human
Jurkat T cells, CsA was shown to inhibit expression of COX-2 gene
after T-cell activation (40).
NFAT has been found to bind to promoters and regulate their activities in
cooperation with other transcription factors, such as AP1 and GATA-4
(1,7,41).
In the rat COX-2 promoter, there is no putative binding site for transcription
factors near the NFAT2 binding site except for E box
(25,35,38).
The E box sequence (CACGTG) has been shown to be a binding site for upstream
stimulatory factor and a critical site for the regulation of the rat COX-2
promoter activity (38).
However, NFAT2 bound to this GGAAA sequence in the oligonucleotides, which did
not contain the E box sequence (Sawano H, Sugimoto T, unpublished
observations), which indicates that upstream stimulatory factor might not be
necessary for NFAT2 binding to rat COX-2 promoter. Indeed, Holtz-Hoppelmann
et al. (2) reported
that NFAT1 directly binds the GGAAA sequence in FASL promoter without
combination with other transcription factors. Further study is required to
determine whether NFAT2 can regulate the rat COX-2 promoter activity
cooperatively with other transcription factors.
ET-1 is a potent vasoconstrictor and has various effects on mesangial cell functions including cell growth, production of extracellular matrix, and secretion of cytokines and autocoids (42). ET-1 antagonists prevent progression of glomerular dysfunction in experimental animals (43), which suggests that ET-1 plays an important role in the pathogenesis of glomerular diseases. We have already reported that ET-1 increases intracellular Ca concentrations and activates various protein kinase cascades, including those of protein kinase C, tyrosine kinases, and mitogen-activated protein kinases in mesangial cells (15,44,45,46). In the present study, we demonstrated clearly that ET-1 activates another signaling pathway, calcineurin/NFAT signaling, in mesangial cells and that this pathway is necessary for ET-1—induced COX-2 expression. The COX-2 induction stimulated by ET-1 is thought to act as a negative feedback mechanism on mesangial cell contraction and growth through the release of vasodilatory prostaglandins, such as PGE2, which activate the cAMP-protein kinase A pathway (33,47). We have already reported that the cAMP—protein kinase A pathway has growth-inhibitory effects via a decrease in the activities of mitogen-activated protein kinases in mesangial cells (48,49). In this study, we showed that NFAT2 regulates ET-1—induced COX-2 expression in mesangial cells, which suggests that the calcineurin-NFAT cascade may participate in one of the negative feedback pathways regulated by ET-1 signaling in mesangial cells. Thus, treatment with CsA may potentiate mesangial cell contraction and growth by suppression of this negative feedback pathway. Indeed, CsA has been reported to induce glomerular contraction (50). Therefore, we speculate that the inhibition of COX-2 expression by CsA in mesangial cells, which we demonstrated here, is one of the causes of various CsA-induced glomerular dysfunctions such as decreased GFR or glomerular sclerosis (12), through potentiation of the action of ET-1 on glomeruli.
In this study, we provide the first experimental evidence that NFAT2 is involved in the regulation of COX-2 expression in mesangial cells. Our results may contribute to evaluation of the precise roles of the calcineurin/NFAT cascade in glomerular functions, the pathogenesis of glomerular diseases, and CsA-induced nephrotoxicity.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
After submission of the manuscript for this article, Iniguez et al. reported that NFAT1 is essential for COX-2 expression in human T lymphocytes (J Biol Chem 275: 23627-23635, 2000).
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and nuclear factor-interleukin-6 in the tumor necrosis
factor -dependent induction of cyclooxygenase-2 in MC3T3-E1 cells.
J Biol Chem 270:31315
-31320, 1995This article has been cited by other articles:
 |
|
 |
|
  A. Chahdi and A. Sorokin Endothelin-1 Couples {beta}Pix to p66Shc: Role of {beta}Pix in Cell Proliferation through FOXO3a Phosphorylation and p27kip1 Down-Regulation Independently of Akt Mol. Biol. Cell, June 1, 2008; 19(6): 2609 - 2619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-Y. Kim, R. Gul, S.-Y. Rah, S. H. Kim, S. K. Park, M.-J. Im, H. J. Kwon, and U.-H. Kim Molecular mechanism of ADP-ribosyl cyclase activation in angiotensin II signaling in murine mesangial cells Am J Physiol Renal Physiol, April 1, 2008; 294(4): F982 - F989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Doller, E.-S. Akool, R. Muller, P. Gutwein, C. Kurowski, J. Pfeilschifter, and W. Eberhardt Molecular Mechanisms of Cyclosporin A Inhibition of the Cytokine-Induced Matrix Metalloproteinase-9 in Glomerular Mesangial Cells J. Am. Soc. Nephrol., February 1, 2007; 18(2): 581 - 592. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ding, J. Li, C. Xue, K. Wu, W. Ouyang, D. Zhang, Y. Yan, and C. Huang Cyclooxygenase-2 Induction by Arsenite Is through a Nuclear Factor of Activated T-cell-dependent Pathway and Plays an Antiapoptotic Role in Beas-2B Cells J. Biol. Chem., August 25, 2006; 281(34): 24405 - 24413. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yan, J. Li, W. Ouyang, Q. Ma, Y. Hu, D. Zhang, J. Ding, Q. Qu, K. Subbaramaiah, and C. Huang NFAT3 is specifically required for TNF-{alpha}-induced cyclooxygenase-2 (COX-2) expression and transformation of Cl41 cells J. Cell Sci., July 15, 2006; 119(14): 2985 - 2994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-R. Yang, M.-J. Lin, K.-P. Yip, L. H. Jeyakumar, S. Fleischer, G. P. H. Leung, and J. S. K. Sham Multiple ryanodine receptor subtypes and heterogeneous ryanodine receptor-gated Ca2+ stores in pulmonary arterial smooth muscle cells Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L338 - L348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Liu, C. Zhang, N. Dronadula, Q. Li, and G. N. Rao Blockade of Nuclear Factor of Activated T Cells Activation Signaling Suppresses Balloon Injury-induced Neointima Formation in a Rat Carotid Artery Model J. Biol. Chem., April 15, 2005; 280(15): 14700 - 14708. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Duque, M. Fresno, and M. A. Iniguez Expression and Function of the Nuclear Factor of Activated T Cells in Colon Carcinoma Cells: INVOLVEMENT IN THE REGULATION OF CYCLOOXYGENASE-2 J. Biol. Chem., March 11, 2005; 280(10): 8686 - 8693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-C. Lin, J.-L. Lin, C.-S. Lin, M.-C. Tsai, M.-J. Su, L.-P. Lai, and S. K. S. Huang Activation of the Calcineurin-Nuclear Factor of Activated T-Cell Signal Transduction Pathway in Atrial Fibrillation Chest, December 1, 2004; 126(6): 1926 - 1932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. F. Pratt, D. Bokemeyer, M. Foschi, A. Sorokin, and M. J. Dunn Alterations in Subcellular Localization of p38 MAPK Potentiates Endothelin-stimulated COX-2 Expression in Glomerular Mesangial Cells J. Biol. Chem., December 19, 2003; 278(51): 51928 - 51936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sorokin and D. E. Kohan Physiology and pathology of endothelin-1 in renal mesangium Am J Physiol Renal Physiol, October 1, 2003; 285(4): F579 - F589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Molero, J. Farre, A. Garcia-Mendez, P. Jimenez Mateos-Caceres, C. Carrasco Martin, I. Millas, F. Navarro, M. Cordoba, S. Casado, and A. Lopez-Farre Endothelin-1 induced proinflammatory markers in the myocardium and leukocytes of guinea-pigs: Role of glycoprotein IIB/IIIA receptors Cardiovasc Res, January 1, 2003; 57(1): 109 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Suzuki, C. Gomez-Guerrero, I. Shirato, O. Lopez-Franco, P. Hernandez-Vargas, G. Sanjuan, M. Ruiz-Ortega, T. Sugaya, K. Okumura, Y. Tomino, et al. Susceptibility to T Cell-Mediated Injury in Immune Complex Disease Is Linked to Local Activation of Renin-Angiotensin System: The Role of NF-AT Pathway J. Immunol., October 15, 2002; 169(8): 4136 - 4146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hocherl, F. Dreher, H. Vitzthum, J. Kohler, and A. Kurtz Cyclosporine A Suppresses Cyclooxygenase-2 Expression in the Rat Kidney J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2427 - 2436. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||
) or treated with ET-1
(10-7 M; 
) for 8 h. Luciferase activity was measured and
normalized against ß-galactosidase activity expressed as relative light
units (103 RLU). (B) The effect of mutation of the NFAT binding
site on the rat COX-2 promoter activity. Mouse mesangial cells were
transfected with 0.25 µg of the wild-type reporter (-373/+24) or a mutant
promoter reporter that lacked the NFAT binding site (Mt -374/+24), as
described above. Error bars indicate SD from experiments performed in
triplicate. Shown are representative examples from at least three independent
experiments.