Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SUGIMOTO, T.
Right arrow Articles by KIKKAWA, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SUGIMOTO, T.
Right arrow Articles by KIKKAWA, R.
J Am Soc Nephrol 12:1359-1368, 2001
© 2001 American Society of Nephrology

Endothelin-1 Induces Cyclooxygenase-2 Expression Via Nuclear Factor of Activated T-Cell Transcription Factor in Glomerular Mesangial Cells

TOSHIRO SUGIMOTO*,{dagger}, MASAKAZU HANEDA*, HIROTAKA SAWANO*, KEIJI ISSHIKI*, SHIRO MAEDA*, DAISUKE KOYA*, KEN INOKI*, HITOSHI YASUDA*, ATSUNORI KASHIWAGI* and RYUICHI KIKKAWA*

* The Third Department of Medicine, Shiga University of Medical Science, Seta, Otsu, Shiga
{dagger} Japan Foundation for Aging and Health, Higashiura Cho, Aichi, Japan.

Correspondence to Dr. Masakazu Haneda, The Third Department of Medicine, Shiga University of Medical Science, Seta, Otsu, Shiga, 520-2192, Japan. Phone: 81-77-548-2222; Fax: 81-77-543-3858; E-mail: haneda{at}belle.shiga-med.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abstract. Nuclear factor of activated T cells (NFAT) originally was identified as a T-cell—specific transcription factor whose activity is regulated by calcineurin, one of the serine-threonine phosphatases. Recent studies have shown that NFAT also is expressed in nonlymphoid cells and plays an important role in various cell functions. It is widely known that treatment with cyclosporin A (CsA), which can inhibit calcineurin/NFAT signaling, results in glomerular dysfunction characterized by a decrease of GFR or glomerulosclerosis, suggesting that NFAT might regulate the glomerular function. However, the precise function of NFAT in glomerular cells remains to be clarified. Herein, evidence has been produced that NFAT2/NFATc, one of five known NFAT isoforms, is expressed in glomerular mesangial cells. Stimulation of mesangial cells with endothelin-1 caused translocation of NFAT2 into the nucleus with a concomitant increase in NFAT2 DNA-binding activity, both of which were inhibited by CsA. Furthermore, CsA inhibited endothelin-1—induced cyclooxygenase-2 (COX-2) expression in mesangial cells. NFAT2 bound directly to the GGAAA sequence, which is the minimal consensus sequence for NFAT binding, in a promoter region of rat COX-2 gene, and it enhanced the reporter activity of rat COX-2 promoter in mesangial cells. These findings provide the first evidence that NFAT2 is expressed and regulates COX-2 gene expression in mesangial cells. These results will contribute to evaluation of the precise roles of NFAT in glomerular functions and the CsA-induced nephrotoxicity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear factor of activated T-cell (NFAT) transcription factors were first found in T lymphocytes as transcription factors, which could bind to sites upstream of the coding region of interleukin-2 (IL-2) gene and induce IL-2 gene expression (1). In addition, NFAT has been reported to bind to the promoter sequences of other cytokine genes or early immune response genes such as tumor necrosis factor-{alpha}, IL-3, IL-4, IL-5, interferon-{gamma}, granulocyte-macrophage colony-stimulating factor, and FAS ligand and to upregulate expression of these genes in T cells during immune responses (1,2). Proteins of NFAT are present in the cytoplasm of resting lymphocytes, translocate into the nucleus after activation of lymphocytes, and can activate target gene expression. This process was shown to be regulated by dephosphorylation of the regulatory domain of NFAT by calcineurin (1,3), one of the serine-threonine phosphatases, which became activated by stimulation that increased intracellular calcium concentrations (4). Immunosuppressive agents cyclosporin A (CsA) and FK506 were found to inhibit NFAT-mediated gene expression in T lymphocytes by preventing nuclear translocation of NFAT through the inhibition of calcineurin activity (1).

The NFAT family consists of at least five isoforms: NFAT1, NFAT2 (NFATc), NFAT3, NFAT4, and NFAT5 (1,5). Although the distribution of NFAT originally was thought to be restricted to lymphoid systems, the expression of some NFAT isoforms, such as NFAT1 or NFAT3, has been revealed to be ubiquitous (6). Until recently, little was known about the mechanism of activation, targets, or functions of NFAT in nonlymphoid tissues. However, evidence that indicates an important role of NFAT in nonlymphoid tissues has emerged during the past several years. In cardiomyocytes, NFAT3 was found to induce the expression of brain natriuretic peptide, a peptide overexpressed in the hypertrophic heart, through binding to the promoter region of brain natriuretic peptide gene (7). In addition, overexpression of an active form of NFAT3 in the mouse heart resulted in cardiac hypertrophy, suggesting that NFAT3 might play an important role in the process of cardiac hypertrophy (7). In the developing heart, expression of NFAT2 protein was shown to be restricted to valvular precursor cells during valve formation, and mice that lacked NFAT2 gene died from cardiac failure in utero because of defects of cardiac valves (8,9). These reports indicate that the family of NFAT plays an important role not only in the process of cardiac development but also in pathologic conditions such as cardiac hypertrophy. Moreover, NFAT has been shown to regulate skeletal muscle fiber size and adipocyte differentiation (10,11).

It is widely known that treatment with CsA results in renal dysfunction characterized by glomerulosclerosis and renal interstitial fibrosis (12), which suggests that NFAT might contribute to development of the renal dysfunction induced by CsA. However, the precise functions of NFAT in kidney cells have not been clarified. Renal mesangial cells are present in renal glomeruli and respond to various extracellular stimuli (13). On activation, mesangial cells are able to proliferate, to produce extracellular matrix proteins, and to release numerous cytokines or autocoids, which suggests that mesangial cells play an important role in the process of various forms of glomerular damage (13). Because growth factors, vasoactive substances, and mechanical stresses have been reported to activate intracellular calcium signal transduction in mesangial cells (14,15), we hypothesized that NFAT might be present in mesangial cells and participate in the process of mesangial cell activation. Here, we present evidence that NFAT2 is present in cultured rat mesangial cells and activated by endothelin-1 (ET-1). Furthermore, the activated NFAT2 can upregulate cyclooxygenase-2 (COX-2) gene expression in mesangial cells. The results of our study provide the first evidence for the expression and physiologic functions of NFAT in mesangial cells and also identify a novel target gene of NFAT.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture and Transfection
Rat mesangial cells, which were obtained from glomeruli isolated from Sprague-Dawley rats, were cultured in RPMI 1640 (Gibco, Grand Island, NY) containing 20% fetal bovine serum (FBS), as described elsewhere (16). For experiments, the subconfluent rat mesangial cells were starved for 48 h by incubation with RPMI 1640 medium containing 0.4% FBS and then incubated with an experimental medium (RPMI 1640 medium with 0.4% free fatty acid-free bovine serum albumin and 20 mM HEPES [pH 7.4]). Mouse SV-40 transformed cells (American Type Culture Collection, Manassas, VA) were cultured with a 3:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and F12 medium with 5% FBS, and COS cells were cultured with DMEM with 10% FBS. Transfections of mouse SV-40 transformed cells and COS cells were done with lipofectAMINE-plus (Life Technologies-BRL, Gaithersburg, MD) and by the diethylaminoethyl-dextran method, respectively (17,18). Twenty-four h after transfection, the cells were starved for an additional 24 h with DMEM containing 0.1% FBS before stimulation.

Plasmids
To make a probe for rat COX-2 mRNA expression, we amplified a fragment of rat COX-2 cDNA (bases 1229 to 1813) by reverse transcription-PCR with the use of rat kidney mRNA, as described elsewhere (19). The cDNA fragment was subcloned into pCR II vector with a TA cloning kit (Invitrogen, Carlsbad, CA). To construct a reporter of rat COX-2 promoter, a fragment of rat COX-2 promoter (bases -983/+24) was amplified by PCR with the use of rat genomic DNA as a template (20). The PCR product was subcloned into a luciferase expression vector, PGL2 basic (Promega, Madison, WI), at MluI-XhoI sites. To produce a 5'-deleted reporter (-373/+24), the rat COX-2 promoter reporter (bases -983/+24) was digested with SmaI and then re-ligated. A mutation of the reporter (bases -373/+24) was made by PCR with the use of the QuickChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) and a pair of oligonucleotides shown in Figure 1B, below (mutated D oligonucleotides). Expression vectors of mouse NFAT1c, human NFAT2 and NFAT4, and human ET-A receptor were obtained from Dr. A. Rao (Harvard University, Boston, MA), Dr. N. Arai (DNAX Institute), and Dr. M. Yanagisawa (University of Texas Southwestern Medical Center, Dallas, TX), respectively (21,22,23). To make a dominant negative form of NFAT (DN-NFAT), a region encoding mouse NFAT1c amino acid residues 1 to 167 was amplified by PCR and cloned into pcDNA3 (Invitrogen). The sequence authenticity of these plasmids was confirmed with the use of a rhodamine terminator cycle sequence system (ABI) and an ABI PRISM 310 genetic analyzer (Foster City, CA).



View larger version (34K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Structure of rat cyclooxygenase-2 (COX-2) promoter region. (A) Consensus cis-regulatory sites in rat COX-2 promoter. "A," "B," "C," and "D" indicate the locations of putative nuclear factor of activated T cells 2 (NFAT2) binding sites in the rat COX-2 promoter. (B) Sequences and locations of the putative NFAT binding sites in the rat COX-2 promoter. Underlines indicate minimal consensus sequences for NFAT binding, and the arrow shows a mutation of the NFAT binding site in the D oligonucleotide. These oligonucleotides were used for electrophoretic mobility shift analysis (EMSA) or mutagenesis as described in the Materials and Methods section.

 

Immunoblot Analysis
Mesangial cells were lysed in an ice-cold lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% sodium dodecyl sulfate, 1% Nonidet P-40, and protease inhibitor cocktail (Boehringer Mannheim, Mannheim, Germany). The cell lysates and nuclear extracts prepared as described below were subjected to sodium dodecyl sulfate—polyacrylamide gel electrophoresis (7.5% gel for NFAT or 10% gel for COX-2) and transferred to polyvinylidenedifluoride membranes (Millipore, Bedford, MA). The membranes were probed with specific antibodies for NFAT2 (7A6; Affinity Bioreagents Inc., Golden, CO), NFAT1 (G1-D10), NFAT3, NFAT4 (Santa Cruz Biotechnology, Santa Cruz, CA), or COX-2 (Cayman Chemical, Ann Arbor, MI). Immunoreactive bands were detected with an enhanced chemiluminescence detection system (New England Biolaboratories, Boston, MA).

Northern Blot Analysis
Total RNA (12 µg) of mesangial cells, which was isolated with TRIzo1 Reagent (Life Technologies-BRL), was electrophoresed through 1% formaldehyde-agarose gels and transferred onto nylon membranes (Nytran; Schleicher & Schwell, Dassel, Germany). The membranes were hybridized with [32P]-labeled rat COX-2 cDNA, which was labeled by use of a Bca BEST labeling kit (TAKARA, Otsu, Japan), and subjected to autoradiography as described elsewhere (24). The membranes were reprobed with 36B4 as an internal standard (25).

Immunocytochemical Analysis
Mesangial cells plated on round cover glasses in 12-well culture dishes were treated with indicated stimuli. The cells were washed twice with ice-cold phosphate-buffered saline and fixed with phosphate-buffered saline containing 3% paraformaldehyde and then with methanol at -20°C. The fixed cells were incubated with the primary antibody for NFAT2 (1:250 dilution) overnight at 4°C, washed, and then incubated with a biotinylated secondary antibody (1:500 dilution; Vector Laboratories, Burlingame, CA). Immunoreactive stains were developed with VECTASTAIN ABC kit (Vector Laboratories). For quantification of nuclear staining of NFAT2, the percentages of nuclear staining in total cells in two experiments were determined by three independent observers, and the mean percentages were calculated.

Nuclear Extraction and Electrophoretic Mobility Shift Analysis
Nuclear extracts were prepared as described by Mages et al. (26) with minor modifications. In brief, the cells were lysed with the addition of a hypotonic buffer (10 mM HEPES [pH 7.8], 0.1 mM ethylenediaminetetraacetate [EDTA], 15 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, and protease inhibitor cocktail) with 0.8% Nonidet P-40 and microcentrifuged at 6000 x g for 10 min. Pellets were resuspended with a high-salt buffer (20 mM HEPES [pH 7.8], 420 mM NaCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.2 mM EDTA, and 25% glycerol), rotated for 30 min at 4°C, and microcentrifuged at 13,000 x g for 30 min. Supernatants were used as nuclear proteins for nuclear extraction and electrophoretic mobility shift analysis (EMSA). The nuclear proteins (4 µg) were incubated with 1 µg of poly dI-dC in a binding buffer (10 mM Tris [pH 7.5], 50 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA, and 5% glycerol) for 30 min and then reacted with an annealed complementary NFAT consensus oligonucleotide (CGCCCAAAGAGGAAAATTTGTTTTCATA [Santa Cruz]) from mouse IL-2 promoter or annealed synthetic complementary oligonucleotides from the rat COX-2 promoter (Amersham) (see Figure 1B, below) at room temperature for 20 min; the oligonucleotides were labeled by reactions with {gamma}-32P-ATP and T4 oligonucleotide kinase (New England Biolaboratories). The reaction mixtures were electrophoresed through 4% polyacrylamide gels and were subjected to autoradiography. Competition experiments were performed after the addition of an excess amount of the indicated unlabeled doublestranded oligonucleotides to the reaction mixtures. For supershift analysis, the indicated antibodies were preincubated at 37°C for 30 min before the reactions with the radiolabeled probes.

Reporter Analysis
SV-40 transformed mouse mesangial cells were plated in 12-well dishes. After 24 h, the cells were transfected with 0.25 µg of the COX-2 promoter reporter vectors and 1.0 µg of the ET-A receptor expression vector with one of the NFAT2 expression vector, DN-NFAT, or a control vector (pcDNA3; Invitrogen), as indicated. A CMV-LacZ plasmid (0.1 µg) was co-transfected as an internal control for transfection efficiency and sample handling. Twenty-four h after transfection, the cells were starved in DMEM with 0.1% FBS for another 24 h, followed by stimulation with ET-1 (10-7 M; Peptide Institute, Suita, Japan) for 8 h, and lysed in 150 µl of a reporter lysis buffer (Promega) for 10 min. Ten-µl aliquots of extracts were used to measure luciferase activity by use of Luciferase Assay System (Promega) and a luminometer (Auto LUMIcounter Nu1422ES; Nition, Tokyo, Japan). Co-transfected ß-galactosidase activity was also determined (27) and used to normalize the luciferase activity.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NFAT2 Expressed in Cultured Rat Mesangial Cells and Activated by Ca Ionophore
To evaluate the physiologic role of NFAT in mesangial cells, we first determined which isoforms of NFAT were expressed in cultured rat mesangial cells by immunoblot analysis using specific antibodies for NFAT1 through NFAT4. We detected a protein that reacted with the monoclonal antibody (7A6) for NFAT2 in mesangial cells (Figure 2, A and B). This antibody specificity for NFAT2 was shown by immunoreactivity in extracts of COS cells transfected with NFAT2 cDNA but not in extracts transfected with an empty vector, NFAT1, or NFAT4 cDNA, as described elsewhere (28) (Figure 2A). In contrast, we detected no significant immunoreactive bands in extracts of rat mesangial cells with NFAT1, NFAT3, or NFAT4 antibodies (data not shown). As shown Figure 2B, multiple immunoreactive bands (molecular mass, 90 to 130 kD) were detected with the NFAT2 antibody. Molecular mass patterns similar to that of NFAT2, resulting from either alternative splicing or posttranslational modifications, such as phosphorylation, have been observed in other types of cells (28,29). The treatment of rat mesangial cells with Ca ionophore caused a noticeable increase in the intensity of faster-migrating bands (Figure 2B, lane 3). Pretreatment with CsA, an inhibitor of calcineurin, increased the intensity of the slower-migrating forms of NFAT2 (Figure 2B, lanes 2 and 4), which indicates that NFAT2 may be dephosphorylated by calcineurin in mesangial cells, as occurs in T lymphocytes.



View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Ca ionophore activates NFAT2 in rat mesangial cells. (A) The specificity of the monoclonal antibody (7A6) to NFAT2. Cell extracts of COS cells transfected with an empty vector (pcDNA3, lane 1) or expression vectors of NFAT2 (lane 2), NFAT1 (lane 3), or NFAT4 (lane 4) or extracts of rat mesangial cells (lane 5) were subjected to immunoblot analysis. Extracts in lanes 1 through 5 were incubated with the monoclonal antibody to NFAT2 (7A6). (B) The effect of Ca ionophore on the migration of NFAT2 protein on sodium dodecyl sulfate—polyacrylamide gel electrophoresis. Rat mesangial cells were incubated in the presence or absence of cyclosporin A (CsA) (10-6 M) for 30 min and stimulated with ionomycin (Io) (10-6 M) for 30 min as indicated. Total cell lysates were subjected to immunoblot analysis with the NFAT2 antibody. (C) The effect of Ca ionophore on cellular localization of NFAT2 in mesangial cells. The cells were treated as described above and stained with the NFAT2 antibody. Shown are representative examples from at least two independent experiments.

 

After dephosphorylation by calcineurin, nuclear localization sequences of NFAT are unmasked and NFAT translocates into the nucleus, where it regulates target gene expression (1,3). Therefore, we next examined the nuclear translocation of NFAT2 in mesangial cells treated with Ca ionophore. Immunocytochemical analysis with the NFAT2 antibody revealed that NFAT2 translocated into the nucleus at 30 min after stimulation with Ca ionophore (Figure 2C). In addition, the nuclear translocation of NFAT2 in mesangial cells in response to Ca ionophore was completely suppressed by CsA (Figure 2C). These data indicate that NFAT2 was expressed in rat mesangial cells and translocated into the nucleus after Ca ionophore stimulation.

ET-1 and Activation of NFAT2 in Mesangial Cells
Because we have already reported that ET-1, a potent vasoactive substance, can activate signal transduction cascades in mesangial cells that culminate in an increase in intracellular calcium levels (15), we used ET-1 as a physiologic stimulus. Treatment of mesangial cells with ET-1 (10-8 M) induced the nuclear translocation of NFAT2 at 15 to 60 min, and this nuclear staining returned to the basal level at 120 min (Figure 3A). Similarly to the nuclear translocation of NFAT2 induced by Ca ionophore, pretreatment with CsA prevented ET-1—induced nuclear staining with NFAT2 (Figure 3A). The means of percentages of the nuclear staining in total cells in two experiments were 1.1% (0 min), 76.6% (15 min), 52.5% (30 min), 53.8% (60 min), 2.5% (120 min), and 2.1% (CsA+, 30 min). We also examined the expression of NFAT2 in the nuclear fractions by immunoblot analysis. As shown in Figure 3B, ET-1 increased the amount of NFAT2 in the nucleus, which was inhibited by CsA.



View larger version (57K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Endothelin-1 (ET-1) causes nuclear translocation of NFAT2 and increases its DNA binding activity in rat mesangial cells. (A) Immunocytochemical staining of NFAT2 in mesangial cells treated with ET-1. The effect of ET-1 on nuclear translocation of NFAT2 in mesangial cells is shown. Mesangial cells were incubated in the presence or absence of CsA (10-6 M) for 30 min and stimulated with ET-1 (10-8 M) for the indicated time periods. Immunocytochemistry was performed with the NFAT2 antibody. (B) The expression of NFAT2 in the nuclei of mesangial cells treated with ET-1. Mesangial cells were incubated in the presence or absence of CsA (10-6 M) for 30 min and stimulated with ET-1 (10-8 M) for 30 min. The nuclear fractions from these cells were subjected to immunoblot analysis with the NFAT2 antibody. (C) The time course of ET-1—induced DNA binding of NFAT2. Nuclear extracts from mesangial cells treated with 10-8 M ET-1 for the indicated time periods were subjected to EMSA with the NFAT consensus oligonucleotide. (D) The effect of ET-1 concentration on NFAT2 DNA binding activity. Mesangial cells were treated with ET-1 at the indicated concentrations for 30 min and subjected to EMSA with the NFAT consensus oligonucleotide. (E) The effect of CsA on NFAT2 DNA binding activity in ET-1—stimulated mesangial cells. Mesangial cells were incubated in the presence (lanes 2 and 4) or absence (lanes 1 and 3) of CsA (10-6 M) for 30 min, stimulated with ET-1 (10-8 M) for 30 min (lanes 3 and 4), and subjected to EMSA with the NFAT consensus oligonucleotide. (F) Supershift analysis with the NFAT2 antibody revealed that the complex inducible by ET-1 was composed of NFAT2 protein. The NFAT2 complex bands are indicated with bars (C through F), and the supershifted band is indicated by the open arrow (F). Shown are representative examples from at least two independent experiments.

 

We next examined the effects of ET-1 on the DNA binding activity of NFAT2 using EMSA with the NFAT consensus binding sequence from the mouse IL-2 promoter in mesangial cells. ET-1 increased the NFAT-DNA complex formation with a time course similar to that of NFAT2 nuclear translocation (Figure 3C) and in an ET-1 concentration-dependent manner (Figure 3D). CsA also inhibited the ET-1—induced increase in NFAT DNA binding activity (Figure 3C, lane 6, and E, lane 4). Furthermore, this ET-1—stimulated DNA-protein complex was completely supershifted by the NFAT2 antibody (Figure 3F), which indicates that the complex induced by ET-1 was composed of NFAT2. Together, these data demonstrate that a physiologic agonist, such as ET-1, can cause the nuclear translocation and increase the DNA binding activity of NFAT2 in cultured rat mesangial cells.

CsA Inhibition of ET-1—Induced COX-2 Gene Expression in Mesangial Cells
We next examined the expression of the COX-2 gene as a candidate NFAT2-regulated gene, because various stimuli have been shown to induce COX-2 expression (30) and CsA has been shown to inhibit its expression stimulated by IL-1 or serotonin in mesangial cells (31,32). As reported elsewhere (33,34), ET-1 induced the expression of COX-2 mRNA maximally at 2 h and of COX-2 protein at 8 h (data not shown). Pretreatment with CsA suppressed this ET-1—induced expression of COX-2 mRNA in a concentration-dependent manner, with maximal suppression at 10-7 M (Figure 4A), and it also inhibited the expression of COX-2 protein stimulated by ET-1 (Figure 4B). These data indicate that calcineurin may play an important role in the regulation of ET-1—induced COX-2 expression in mesangial cells.



View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. CsA inhibits ET-1—induced cyclooxygenase-2 (COX-2) expression in rat mesangial cells. (A) The effect of CsA on ET-1—induced mRNA expression in mesangial cells. Rat mesangial cells were incubated in the presence or absence of various concentrations of CsA for 30 min and stimulated with ET-1 (10-8 M) for 2 h. Total RNA (12 µg) extracted from these cells was transferred onto nylon filters and probed with [32P]-labeled COX-2 cDNA fragment (COX-2). The same blots were reprobed with 36B4 cDNA as an internal control (36B4). (B) The inhibitory effect of CsA on ET-1—induced COX-2 protein expression in mesangial cells. Mesangial cells were stimulated with ET-1 (10-8 M) for 8 h. Where indicated, CsA (10-6 M) was added 30 min before the stimulation. The total cell lysates extracted from these cells were subjected to immunoblot analysis by probing with the specific antibody for COX-2. Results shown are representative of at least three independent experiments.

 

NFAT2 Enhancing of ET-1—Stimulated COX-2 Promoter Activity in Mesangial Cells
The sequence extending 500 bases upstream from the transcription start site in rat COX-2 promoter, where several cis-acting regulatory sites exist (Figure 1A (20,35)), contains four putative NFAT binding sites (the sequences are GGAAA or TTTCC) (3). The locations and sequences of these sites are shown in Figure 1. Thus, we speculated that NFAT2 might bind directly to these sequences and regulate the rat COX-2 promoter activity. To test this, we transfected the NFAT2 expression vector into COS cells, prepared nuclear extracts from the transfected cells, and carried out EMSA with four double-stranded oligonucleotides containing the candidate NFAT binding sequences in the rat COX-2 promoter (Figure 1B). A recombinant NFAT2 protein, prepared from the NFAT2 cDNA-transfected cells, showed strong binding activity to the NFAT consensus oligonucleotide from mouse IL-2 promoter (Figure 5A, lane 3). This NFAT2 binding activity was potentiated further by treatment of the cells with 12-O-tetradecanoylphorbol 13-acetate (TPA) plus ionomycin (TPA/Io) for 30 min (Figure 5A, lane 4), as described elsewhere (22). Furthermore, NFAT2 from the transfected cells stimulated with TPA/Io produced a DNA-protein complex with the D oligonucleotide at sequences located between -81 and -46 in the rat COX-2 promoter (Figure 1B); this complex is indicated by the closed arrow in Figure 5B (lane 4). This binding band was completely competed out with an excess amount of the unlabeled oligonucleotide containing the NFAT binding site in the mouse IL-2 promoter (NFAT con, Figure 5B, lane 6), and it was supershifted by coincubation with the NFAT2 antibody (Figure 5B, lane 7) but not by coincubation with a preimmune serum (data not shown). This binding activity was absent from cells transfected with a control vector (Figure 5B, lanes 1 and 2). Moreover, NFAT2 could not bind to a mutated D oligonucleotide (Figure 5C), whose putative NFAT binding site (GGAAA) was changed to TCTAA as Holtz-Hoppelmann et al. (2) described Figure 1B), which indicates that NFAT2 can bind directly to this putative NFAT site in the D oligonucleotide. NFAT2 did not bind to the A, B, or C oligonucleotides shown in Figure 1B (data not shown).



View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. NFAT2 binds directly to the rat COX-2 promoter region. (A) Recombinant NFAT2 binds the NFAT consensus oligonucleotide. COS cells were seeded on 10-cm-diameter dishes and transfected with 5 µg of the NFAT2 expression vector (lanes 3 and 4) or a control vector (pcDNA3, lanes 1 and 2). Forty-eight h after transfection, the cells were either left untreated (lanes 1 and 3) or treated with 12-O-tetradecanoylphorbol 13-acetate (10-7 M) plus ionomycin (10-6 M) (TPA/Io) for 30 min (lanes 2 and 4). The nuclear extracts prepared from these cells were subjected to EMSA by use of the oligonucleotide that contains the NFAT site in mouse interleukin-2 promoter (NFAT consensus oligonucleotide). (B) NFAT2 binds directly to the D oligonucleotide that contains the putative NFAT binding site in rat COX-2 promoter. EMSA was performed by use of nuclear extracts prepared as described above and the radiolabeled D oligonucleotide with the sequence shown in Figure 1B. Competition experiments were done with 100-fold excess amount of the cold D oligonucleotide (wild, lane 5) and the NFAT consensus oligonucleotide (NFAT con, lane 6). Supershift analysis was performed with preincubation with the NFAT2 antibody (NFAT2 Ab, lane 7). The NFAT2 binding complex is indicated by the closed arrow, and the supershifted band induced by the NFAT2 antibody is indicated by the open arrow. (C) NFAT2 does not bind to a mutant of the D oligonucleotide. Nuclear extracts prepared as described above were subjected to EMSA by use of labeled mutant D oligonucleotide that lacked the putative NFAT site with the sequence shown in Figure 1B. Results presented here are representative of at least two independent experiments.

 

To determine whether NFAT2 can regulate COX-2 promoter activity, we next cloned the rat COX-2 promoter sequences into a luciferase reporter plasmid, PGL2 basic. Because transfection efficiency in primary culture of rat mesangial cells is low, we used SV-40 transformed mouse mesangial cells for reporter analysis. These mouse mesangial cells expressed NFAT2, and CsA inhibited COX-2 gene expression induced by FBS or TPA/Io in these cells (data not shown), which suggests that regulatory pathways similar to those in rat mesangial cells were conserved in the transformed mouse mesangial cells. We therefore transfected a reporter plasmid containing bases extending from -374 to +24 of the rat COX-2 promoter with ET-A receptor cDNA into the mouse mesangial cells and stimulated the transfected cells with ET-1 for 8 h. ET-1 enhanced COX-2 promoter activity by approximately 1.5-fold (Figure 6, A and B). Overexpression of NFAT2 expression plasmid significantly enhanced ET-1—stimulated reporter activity in a manner dependent on the amount of NFAT2 cDNA (Figure 6A). In contrast, an amino-terminal domain of NFAT1c, which functions as DN-NFAT (36), reduced basal and ET-1—stimulated reporter expression (Figure 6A). NFAT2 expression had no effect on the activity of the control reporter, PGL2 basic (data not shown). Furthermore, NFAT2 did not enhance the expression of a reporter (Figure 6B) that was mutated at the putative NFAT binding site (GGAAA to TCTAA) identified by EMSA as described above, which indicates that NFAT2 regulates COX-2 promoter activity through this putative NFAT binding site in mesangial cells.



View larger version (19K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. NFAT2 enhances the ET-1—induced COX-2 promoter activation in SV-40 transformed mouse mesangial cells. (A) The effect of co-transfection with the NFAT2 cDNA on the rat COX-2 promoter activity in mouse mesangial cells. Mouse mesangial cells seeded on 12-well dishes were co-transfected with the indicated amounts (µg) of the NFAT2 expression vector, the dominant negative—NFAT (DN-NFAT) expression vector, or the control vector together with 0.25 µg of the COX-2 promoter reporter plasmid (-373/+24) and 1.0 µg of ET-A receptor expression vector. The ß-galactosidase expression vector also was co-transfected as an internal control for variations in transfection efficiency. Twenty-four h after transfection, these cells were starved for an additional 24 h by incubation with a low-serum medium. The transfected cells were left untreated ({square}) or treated with ET-1 (10-7 M; {blacksquare}) for 8 h. Luciferase activity was measured and normalized against ß-galactosidase activity expressed as relative light units (103 RLU). (B) The effect of mutation of the NFAT binding site on the rat COX-2 promoter activity. Mouse mesangial cells were transfected with 0.25 µg of the wild-type reporter (-373/+24) or a mutant promoter reporter that lacked the NFAT binding site (Mt -374/+24), as described above. Error bars indicate SD from experiments performed in triplicate. Shown are representative examples from at least three independent experiments.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The experiments described here revealed that NFAT2 is expressed in primary rat mesangial cells. Stimulation of mesangial cells with ET-1 induced the nuclear translocation of NFAT2 and enhanced its DNA binding activity. An NFAT binding site is present in the rat COX-2 promoter region, and NFAT2 is involved in ET-1—induced COX-2 promoter activation. This is the first report of a physiologic function of NFAT in mesangial cells. Moreover, we propose a novel mechanism of the regulation of COX-2 gene expression.

The NFAT family has been reported to include five isoforms (NFAT1 through NFAT5). Although they have similar DNA binding specificities, they are distributed in different tissues and show different patterns of inducibility by various stimuli (1), which suggests that individual isoforms may serve specific cell functions. The activities of NFAT1 through NFAT4 are regulated by calcineurin, which can dephosphorylate these NFAT isoforms and cause their nuclear translocation (1,3), whereas NFAT5 is consistently present in the nucleus and has activity that is independent of calcineurin (5). In the present study, the immunoblot analysis, probing with antibodies that specifically recognize each isoform, revealed that rat mesangial cells expressed mainly the NFAT2 isoform. Previous reports have shown that NFAT1 and NFAT3 are constitutively expressed in most tissues and cell lines, whereas NFAT2 is not present ubiquitously and has expression that is induced after T-cell activation (6,22). However, we did not detect the presence of NFAT1 and NFAT3 in rat mesangial cells by immunoblot analysis. Furthermore, EMSA demonstrated that the protein complex with the NFAT consensus oligonucleotide was completely supershifted by the addition of the specific antibody for NFAT2, and it also demonstrated that NFAT2 was the main isoform in rat mesangial cells. An expression pattern similar to that in mesangial cells was observed in a study in rat glioma cells (29). We also revealed that Ca ionophore and a physiologic agonist, ET-1, could induce the nuclear translocation of NFAT2 and enhance its DNA binding activity in mesangial cells and that both of these events were suppressed by the treatment with CsA, an inhibitor of calcineurin. These data suggest that calcineurin is a major regulator of NFAT2 activity in mesangial cells and that the mechanism of regulation is similar to that in other types of cells. To our knowledge, this is the first report to show that physiologic stimuli like ET-1 can regulate NFAT activity in mesangial cells.

We also found several indications that NFAT2 is involved in the ET-1—stimulated COX-2 expression in mesangial cells. First, ET-1 activates NFAT2 in mesangial cells, and ET-1-induced COX-2 expression is inhibited by CsA, which prevents NFAT2 activation. Second, the NFAT binding site is located in the promoter region of rat COX-2 gene, as determined by EMSA. Third, the overexpression of NFAT2 increases the ET-1—induced COX-2 promoter activation, whereas DN-NFAT decreases COX-2 promoter activity. Finally, the mutation of NFAT binding site completely abolishes the COX-2 promoter activation induced by NFAT2. The promoter regions of rat, mouse, and human COX2 have been isolated, sequenced, and shown to contain several consensus cis-acting regulatory sequences, including NF-{kappa}B, Sp-1, C/EBP, ATF/CRE, and E box (Figure 1A). These sequences were shown to be critical for COX-2 induction produced by various stimuli in different species and cell types (20,30,35,37,38,39). However, there is no report indicating that the GGAAA sequences in the rat COX-2 promoter function as NFAT binding sites and regulate the promoter activity. The GGAAA sequence present in the rat COX-2 promoter, which was the site of NFAT2 binding, is conserved in the mouse and human COX-2 promoters (38), which suggests that NFAT might also regulate mouse or human COX-2 promoter activity. Indeed, in human Jurkat T cells, CsA was shown to inhibit expression of COX-2 gene after T-cell activation (40). NFAT has been found to bind to promoters and regulate their activities in cooperation with other transcription factors, such as AP1 and GATA-4 (1,7,41). In the rat COX-2 promoter, there is no putative binding site for transcription factors near the NFAT2 binding site except for E box (25,35,38). The E box sequence (CACGTG) has been shown to be a binding site for upstream stimulatory factor and a critical site for the regulation of the rat COX-2 promoter activity (38). However, NFAT2 bound to this GGAAA sequence in the oligonucleotides, which did not contain the E box sequence (Sawano H, Sugimoto T, unpublished observations), which indicates that upstream stimulatory factor might not be necessary for NFAT2 binding to rat COX-2 promoter. Indeed, Holtz-Hoppelmann et al. (2) reported that NFAT1 directly binds the GGAAA sequence in FASL promoter without combination with other transcription factors. Further study is required to determine whether NFAT2 can regulate the rat COX-2 promoter activity cooperatively with other transcription factors.

ET-1 is a potent vasoconstrictor and has various effects on mesangial cell functions including cell growth, production of extracellular matrix, and secretion of cytokines and autocoids (42). ET-1 antagonists prevent progression of glomerular dysfunction in experimental animals (43), which suggests that ET-1 plays an important role in the pathogenesis of glomerular diseases. We have already reported that ET-1 increases intracellular Ca concentrations and activates various protein kinase cascades, including those of protein kinase C, tyrosine kinases, and mitogen-activated protein kinases in mesangial cells (15,44,45,46). In the present study, we demonstrated clearly that ET-1 activates another signaling pathway, calcineurin/NFAT signaling, in mesangial cells and that this pathway is necessary for ET-1—induced COX-2 expression. The COX-2 induction stimulated by ET-1 is thought to act as a negative feedback mechanism on mesangial cell contraction and growth through the release of vasodilatory prostaglandins, such as PGE2, which activate the cAMP-protein kinase A pathway (33,47). We have already reported that the cAMP—protein kinase A pathway has growth-inhibitory effects via a decrease in the activities of mitogen-activated protein kinases in mesangial cells (48,49). In this study, we showed that NFAT2 regulates ET-1—induced COX-2 expression in mesangial cells, which suggests that the calcineurin-NFAT cascade may participate in one of the negative feedback pathways regulated by ET-1 signaling in mesangial cells. Thus, treatment with CsA may potentiate mesangial cell contraction and growth by suppression of this negative feedback pathway. Indeed, CsA has been reported to induce glomerular contraction (50). Therefore, we speculate that the inhibition of COX-2 expression by CsA in mesangial cells, which we demonstrated here, is one of the causes of various CsA-induced glomerular dysfunctions such as decreased GFR or glomerular sclerosis (12), through potentiation of the action of ET-1 on glomeruli.

In this study, we provide the first experimental evidence that NFAT2 is involved in the regulation of COX-2 expression in mesangial cells. Our results may contribute to evaluation of the precise roles of the calcineurin/NFAT cascade in glomerular functions, the pathogenesis of glomerular diseases, and CsA-induced nephrotoxicity.


    Acknowledgments
 
We thank Drs. A. Rao, N. Arai, and M. Yanagisawa for plasmids; Drs. K.-L. Guan and S.J. Stewart for critical comments on the manuscript; and the Central Research Laboratory of Shiga University of Medical Science for technical assistance. T.S. and H.S. contributed equally to this work.


    Footnotes
 
Note Added In Proofs

After submission of the manuscript for this article, Iniguez et al. reported that NFAT1 is essential for COX-2 expression in human T lymphocytes (J Biol Chem 275: 23627-23635, 2000).


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rao A, Luo C, Hogan PG: Transcription factors of the NFAT family: Regulation and function. Annu Rev Immunol15 : 707-747,1997[Medline]
  2. Holtz-Hoppelmann CJ, Algeciras CA, Badley AD, Paya CV: Transcriptional regulation of the human FasL promoter-enhancer region. J Biol Chem 273:4416 -4423, 1998[Abstract/Free Full Text]
  3. Masuda E, Imamura R, Amasaki Y, Arai K, Arai N: Signalling into the T-cell nucleus: NFAT regulation. Cell Signal10 : 599-611,1998[Medline]
  4. Klee CB, Ren H, Wang X: Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J Biol Chem273 : 13367-13370,1998[Free Full Text]
  5. Lopez-Rodriguez C, Aramburu J, Rakeman AS, and Rao A: NFAT5, a constitutive nuclear NFAT protein that does not co-operative with Fos and Jun. Proc Natl Acad Sci USA 96:7214 -7219, 1999[Abstract/Free Full Text]
  6. Hoey T, Sun Y-L, Williamson K, Xu X: Isolation of two new members of the NFAT gene family and functional characterization of the NFAT proteins. Immunity 2:461 -472, 1995[Medline]
  7. Molkentin JD, Lu J-R, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN: A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93:215 -228, 1998[Medline]
  8. de la Pompa JL, Timmermann LA, Takimoto H, Yoshida H, Elia AJ, Samper E, Pottrer J, Wakeham L, Marengere L, Langille BL, Crabtree GR, Mak TW: Role of the NFATc transcription factor in morphogenesis of cardiac valves and septum. Nature 392:182 -186, 1998[Medline]
  9. Ranger AM, Grusby MJ, Hodge MR, Gravallese EM, de la Brousse FC, Hoey T, Mickanin C, Baldwin HS, Glimcher LH: The transcription factor NF-ATc is essential for cardiac valve formation. Nature392 : 186-190,1998[Medline]
  10. Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, Wu H, Zhu W, Bassel-Duby R, Williams RS: A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev 12:2499 -2509, 1998[Abstract/Free Full Text]
  11. Ho IC, Kim HH, Rooney JW, Spiegelman BM, Grimcher LH: A potential role for the nuclear factor of activated T cells family of transcriptional regulatory proteins in adipogenesis. Proc Natl Acad Sci USA 95:15537 -15541, 1998[Abstract/Free Full Text]
  12. Myers BD, Ross J, Newton L, Luetscher J, Perlroth M: Cyclosporine-associated chronic nephropathy. N Engl J Med 311: 699-705,1984[Abstract]
  13. Schlondroff D: Roles of the mesangium in glomerular function. Kidney Int 49:1583 -1585, 1996[Medline]
  14. Akai Y, Homma T, Burns KD, Yasuda T, Badr KF, Harris RC: Mechanical stretch/relaxation of cultured rat mesangial cells induces protooncogenes and cyclooxygenase. Am J Physiol267 : C482-C490,1994[Abstract/Free Full Text]
  15. Isono M, Haneda M, Maeda S, Omatsu-Kanbe M, Kikkawa R: Atrial natriuretic peptide inhibits endothelin-1-induced activation of JNK in glomerular mesangial cells. Kidney Int53 : 1133-1142,1998[Medline]
  16. Kikkawa R, Umemura K, Haneda M, Arimura T, Ebata K, Shigeta Y: Evidence for existence of polyol pathway in cultured rat mesangial cells. Diabetes 36:240 -243, 1987[Abstract]
  17. Sugimoto T, Stewart S, Guan KL: The calcium/calmodulin-dependent protein phosphatase, Calcineurin, is the major Elk-1 phosphatase. J Biol Chem 272:29415 -29418, 1997[Abstract/Free Full Text]
  18. Sugimoto T, Stewart S, Han M, Guan KL: The kinase suppresser of Ras (KSR) modulates growth factor and Ras signaling by uncoupling Elk-1 phosphorylation from MAP kinase activation. EMBO J17 : 1717-1727,1998[Medline]
  19. Yang T, Singh I, Pham H, Sun D, Smart A, Schnermann JB, Briggs JP: Regulation of cyclooxygenase expression in the kidney by dietary salt intake. Am J Physiol 274:F481 -F489, 1998
  20. Sirios J, Levy LO, Simmons D, Richards JA: Characterization and hormonal regulation of the promoter of the rat prostaglandin endoperoxide synthase 2 gene in granulosa cells. J Biol Chem268 : 12199-12206,1993[Abstract/Free Full Text]
  21. Luo C, Burgeon E, Carew JA, McCaffery PG, Badalian TM, Lane WS, Hogen PG, Rao A: Recombinant NFAT1 (NFATp) is regulated by calcineurin in T cells and mediates transcription of several cytokine genes. Mol Cell Biol 16:3955 -3966, 1996[Abstract]
  22. Masuda E, Naito Y, Tokumitsu H, Campbell D, Saito F, Hannum C, Arai K, Arai N: NFATx, a novel member of the NFAT family that is expressed predominantly in the thymus. Mol Cell Biol15 : 2697-2706,1995[Abstract]
  23. Sakamoto A, Yanagisawa M, Sawamura T, Enoki T, Ohtani T, Sakurai T, Nakao K, Toyo-oka T, Masaki T: Distinct subdomains of human endothelin receptors determine their selectivity to endothelin A-selective antagonist and endothelin B-selective agonists. J Biol Chem268 : 8547-8553,1993[Abstract/Free Full Text]
  24. Sugimoto T, Haneda M, Togawa M, Isono M, Shikano T, Araki S, Nakagawa T, Kashiwagi A, Guan KL, Kikkawa R: Atrial natriuretic peptide induces the expression of MKP-1, a mitogen-activated protein kinase phosphatase, in glomerular mesangial cells. J Biol Chem 271:544 -547, 1996[Abstract/Free Full Text]
  25. Krowczynska AM, Coutts M, Makrides S, Brawerman G: The mouse homologue of the human acidic ribosomal phosphoprotein PO: A highly conserved polypeptide that is under translational control. Nucleic Acids Res 17: 6408,1989[Free Full Text]
  26. Mages HW, Baag R, Steiner B, Kroczek RA: Utilization of an NF-ATp binding promoter element for EGR3 expression in T cells but not fibroblasts provides a molecular model for the lymphoid cell-specific effect of cyclosporin A. Mol Cell Biol18 : 7157-7165,1998[Abstract/Free Full Text]
  27. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning, 2nd Ed., Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 1989, pp16.66 -16.67
  28. Boss V, Abbott KL, Wang X-F, Pavlath GK, Murphy TJ: The cyclosporin A-sensitive nuclear factor of activated T cells (NFAT) proteins are expressed in vascular smooth muscle cells. J Biol Chem273 : 19664-19671,1998[Abstract/Free Full Text]
  29. Mosieniak G, Pyrzynska B, Kaminska B: Nuclear factor of activated T cells (NFAT) as a new component of the signal transduction pathway in glioma cells. J Neurochem 71:134 -141, 1998[Medline]
  30. Herschman HR: Prostaglandin synthase. Biochim Biophys Acta 1299:125 -140, 1996[Medline]
  31. Martin M, Neumann D, Hoff T, Resch K, Dewitt DL, Goppelt-Struebe M: Interleukin-1-induced cyclooxygenase 2 expression is suppressed by cyclosporin A in rat mesangial cells. Kidney Int45 : 150-158,1994[Medline]
  32. Stroebel M, Goppelt-Struebe M: Signal transduction pathways responsible for serotonin-mediated prostaglandin G/H synthase expression in rat mesangial cells. J Biol Chem269 : 22952-22957,1994[Abstract/Free Full Text]
  33. Hughes AK, Padilla E, Kutchera W, Michael JR, Kohan DE: Endothelin-1 induction of cyclooxygenase-2 expression in rat mesangial cells. Kidney Int 47:53 -61, 1995[Medline]
  34. Kester M, Coroneos E, Thomas PJ, Dunn MJ: Endothelin stimulates prostaglandin endoperoxide synthase 2 mRNA and protein synthesis through a tyrosine kinase-signaling pathway in rat mesangial cells. J Biol Chem 269:22574 -22580, 1994[Abstract/Free Full Text]
  35. Sirios J, Richards JS: Transcriptional regulation of the rat prostaglandin endoperoxide synthase 2 gene in granulosa cells. J Biol Chem 268:21931 -21938, 1993[Abstract/Free Full Text]
  36. Chow C-W, Rincon M, Davis RJ: Requirement for transcription factor NFAT in interleukin-2 expression. Mol Cell Biol19 : 2300-2307,1999[Abstract/Free Full Text]
  37. Inoue H, Yokoyama C, Hara S, Tone Y, Tanabe T: Transcriptional regulation of human prostaglandin-endoperoxide synthase-2 gene by lipopolysaccharide and phorbol ester in vascular endothelial cells. J Biol Chem 270:24965 -24971, 1995[Abstract/Free Full Text]
  38. Morris JK, Richards JS: An E-box region within the prostaglandin endoperoxide synthase-2 (PGS-2) promoter is required for transcription in rat ovarian granulosa cells. J Biol Chem271 : 16633-16643,1996[Abstract/Free Full Text]
  39. Yamamoto K, Arakawa T, Ueda N, Yamamoto S: Transcriptional roles of nuclear factor {kappa}B and nuclear factor-interleukin-6 in the tumor necrosis factor {alpha}-dependent induction of cyclooxygenase-2 in MC3T3-E1 cells. J Biol Chem 270:31315 -31320, 1995[Abstract/Free Full Text]
  40. Ingiuez MA, Punzon C, Fresno M: Induction of cyclooxygenase-2 on activated T lymphocytes: Regulation of T cell activation by cyclooxygenase-2 inhibitors. J Immunol 163:111 -119, 1999[Abstract/Free Full Text]
  41. Crabtree GR: Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell96 : 611-614,1999[Medline]
  42. Simonson MS: Endothelin: Multifunctional renal peptides. Physiol Rev 73:375 -411, 1993[Free Full Text]
  43. Matthias B, Luscher TF: Endothelin antagonists for hypertension and renal disease. Curr Opin Nephrol8 : 549-556,1999
  44. Araki S, Haneda M, Togawa M, Kikkawa R: Endothelin-1 activates c-jun NH2-terminal kinase in mesangial cells. Kidney Int 51: 631-639,1997[Medline]
  45. Haneda M, Kikkawa R, Koya D, Shikano T, Sugimoto T, Togawa M, Shigeta Y: Endothelin-1 stimulates tyrosine phosphorylation of p125 focal adhesion kinase in mesangial cells. J Am Soc Nephrol6 : 1504-1510,1995[Abstract]
  46. Sugimoto T, Kikkawa R, Haneda M, Shigeta Y: Atrial natriuretic peptide inhibits endothelin-1-induced activation of mitogen-activated protein kinase in cultured rat mesangial cells. Biochem Biophys Res Commun 195:72 -78, 1993[Medline]
  47. Bornfeldt KB, Campbell JS, Koyama H, Argast GM, Leslie CC, Raines EW, Krebs EG, Ross R: The mitogen-activated protein kinase pathway can mediate growth inhibition and proliferation in smooth muscle cells. J Clin Invest 100:875 -885, 1997[Medline]
  48. Haneda M, Araki S, Sugimoto T, Togawa M, Koya D, Kikkawa R: Differential inhibition of mesangial MAP kinase cascade by cyclic nucleotides. Kidney Int 50:384 -391, 1996[Medline]
  49. Togawa M, Haneda M, Araki S, Sugimoto T, Isono M, Hidaka H, Yasuda H, Kashiwagi A, Kikkawa R: Bearprost sodium, an analogue of prostacyclin, induces the expression of mitogen-activated protein kinase phosphatase and inhibits the proliferation of cultured mesangial cells. Eur J Pharmacol 336:291 -294, 1997[Medline]
  50. L'Azou B, Medina J, Frieauff W, Cordier A, Cambar J, Wolf A: In vitro models to study mechanisms involved in cyclosporin A-mediated glomerular contraction. Arch Toxicol 73:337 -345, 1999[Medline]
Received for publication August 9, 2000. Accepted for publication January 10, 2001.




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
A. Chahdi and A. Sorokin
Endothelin-1 Couples {beta}Pix to p66Shc: Role of {beta}Pix in Cell Proliferation through FOXO3a Phosphorylation and p27kip1 Down-Regulation Independently of Akt
Mol. Biol. Cell, June 1, 2008; 19(6): 2609 - 2619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S.-Y. Kim, R. Gul, S.-Y. Rah, S. H. Kim, S. K. Park, M.-J. Im, H. J. Kwon, and U.-H. Kim
Molecular mechanism of ADP-ribosyl cyclase activation in angiotensin II signaling in murine mesangial cells
Am J Physiol Renal Physiol, April 1, 2008; 294(4): F982 - F989.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Doller, E.-S. Akool, R. Muller, P. Gutwein, C. Kurowski, J. Pfeilschifter, and W. Eberhardt
Molecular Mechanisms of Cyclosporin A Inhibition of the Cytokine-Induced Matrix Metalloproteinase-9 in Glomerular Mesangial Cells
J. Am. Soc. Nephrol., February 1, 2007; 18(2): 581 - 592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ding, J. Li, C. Xue, K. Wu, W. Ouyang, D. Zhang, Y. Yan, and C. Huang
Cyclooxygenase-2 Induction by Arsenite Is through a Nuclear Factor of Activated T-cell-dependent Pathway and Plays an Antiapoptotic Role in Beas-2B Cells
J. Biol. Chem., August 25, 2006; 281(34): 24405 - 24413.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Yan, J. Li, W. Ouyang, Q. Ma, Y. Hu, D. Zhang, J. Ding, Q. Qu, K. Subbaramaiah, and C. Huang
NFAT3 is specifically required for TNF-{alpha}-induced cyclooxygenase-2 (COX-2) expression and transformation of Cl41 cells
J. Cell Sci., July 15, 2006; 119(14): 2985 - 2994.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X.-R. Yang, M.-J. Lin, K.-P. Yip, L. H. Jeyakumar, S. Fleischer, G. P. H. Leung, and J. S. K. Sham
Multiple ryanodine receptor subtypes and heterogeneous ryanodine receptor-gated Ca2+ stores in pulmonary arterial smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L338 - L348.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Liu, C. Zhang, N. Dronadula, Q. Li, and G. N. Rao
Blockade of Nuclear Factor of Activated T Cells Activation Signaling Suppresses Balloon Injury-induced Neointima Formation in a Rat Carotid Artery Model
J. Biol. Chem., April 15, 2005; 280(15): 14700 - 14708.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Duque, M. Fresno, and M. A. Iniguez
Expression and Function of the Nuclear Factor of Activated T Cells in Colon Carcinoma Cells: INVOLVEMENT IN THE REGULATION OF CYCLOOXYGENASE-2
J. Biol. Chem., March 11, 2005; 280(10): 8686 - 8693.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
C.-C. Lin, J.-L. Lin, C.-S. Lin, M.-C. Tsai, M.-J. Su, L.-P. Lai, and S. K. S. Huang
Activation of the Calcineurin-Nuclear Factor of Activated T-Cell Signal Transduction Pathway in Atrial Fibrillation
Chest, December 1, 2004; 126(6): 1926 - 1932.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. F. Pratt, D. Bokemeyer, M. Foschi, A. Sorokin, and M. J. Dunn
Alterations in Subcellular Localization of p38 MAPK Potentiates Endothelin-stimulated COX-2 Expression in Glomerular Mesangial Cells
J. Biol. Chem., December 19, 2003; 278(51): 51928 - 51936.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. Sorokin and D. E. Kohan
Physiology and pathology of endothelin-1 in renal mesangium
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F579 - F589.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. Molero, J. Farre, A. Garcia-Mendez, P. Jimenez Mateos-Caceres, C. Carrasco Martin, I. Millas, F. Navarro, M. Cordoba, S. Casado, and A. Lopez-Farre
Endothelin-1 induced proinflammatory markers in the myocardium and leukocytes of guinea-pigs: Role of glycoprotein IIB/IIIA receptors
Cardiovasc Res, January 1, 2003; 57(1): 109 - 118.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Suzuki, C. Gomez-Guerrero, I. Shirato, O. Lopez-Franco, P. Hernandez-Vargas, G. Sanjuan, M. Ruiz-Ortega, T. Sugaya, K. Okumura, Y. Tomino, et al.
Susceptibility to T Cell-Mediated Injury in Immune Complex Disease Is Linked to Local Activation of Renin-Angiotensin System: The Role of NF-AT Pathway
J. Immunol., October 15, 2002; 169(8): 4136 - 4146.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Hocherl, F. Dreher, H. Vitzthum, J. Kohler, and A. Kurtz
Cyclosporine A Suppresses Cyclooxygenase-2 Expression in the Rat Kidney
J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2427 - 2436.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow