Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SALAMA, A. D.
Right arrow Articles by LECHLER, R. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SALAMA, A. D.
Right arrow Articles by LECHLER, R. I.
J Am Soc Nephrol 12:1908-1915, 2001
© 2001 American Society of Nephrology

In Goodpasture's Disease, CD4+ T Cells Escape Thymic Deletion and Are Reactive with the Autoantigen {alpha}3(IV)NC1

ALAN D. SALAMA*, AFZAL N. CHAUDHRY*, JAMES J. RYAN*, EFRAM EREN{dagger}, JEREMY B. LEVY*, CHARLES D. PUSEY*, LIZ LIGHTSTONE* and ROBERT I. LECHLER{dagger}

* Renal Section, Division of Medicine, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom.
{dagger} Department of Immunology, Division of Medicine, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom.

Correspondence to Dr. Alan D. Salama, Renal Division, Laboratory of Immunogenetics and Transplantation, Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115. Phone: 617-732-5252; Fax: 617-732-5254; E-mail: asalama{at}rics.bwh.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abstract. Goodpasture's disease is characterized by rapidly progressive glomerulonephritis and pulmonary hemorrhage, in association with circulating and deposited anti-glomerular basement membrane antibodies that recognize the {alpha}3 chain of type IV collagen [{alpha}3(IV)NC1] (known as the Goodpasture antigen). Unlike many other autoimmune diseases, recurrences are rare. In experimental models and human studies, both humoral and cellular mechanisms have been demonstrated to be involved in disease pathogenesis. However, there are few data on the characteristics of the autoreactive T cells or the mechanisms of tolerance to the autoantigen in human patients. It was demonstrated, using immunohistochemical analyses and reverse transcription-PCR, that the Goodpasture antigen is expressed in normal human thymus. Using limiting dilution analyses, the frequencies of circulating autoreactive T cells in patients and control subjects were assessed. During acute disease, there were increased frequencies of CD4+ T cells reactive with {alpha}3(IV)NC1 (ranging from 1:6300 to 1:65,000), which decreased with time. There was a significant difference between patients during their acute disease phase and control subjects with respect to the frequency index for {alpha}3(IV)NC1-specific CD4+ T cells (P < 0.05, Mann Whitney U test). The decrease in autoreactive CD4+ T-cell numbers during recovery may be the reason why recurrences are infrequent and may explain the loss of pathogenic autoantibodies with time, because of a lack of T-cell help.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Goodpasture's disease is characterized by rapidly progressive glomerulonephritis, often accompanied by pulmonary hemorrhage. It is associated with circulating glomerular basement membrane (GBM)-specific antibodies, which deposit in a linear manner along the GBM and give rise to the characteristic renal biopsy findings. The autoantigen has been characterized as the {alpha}3 chain of type IV collagen [{alpha}3(IV)NC1] (1,2), which has limited tissue distribution (3) and to which the autoantibody response is highly restricted (4). Unlike other autoimmune conditions, the disease rarely exhibits a relapsing-remitting course (5). Without treatment, autoantibody levels decrease to normal in a period of 2 to 3 yr (6).

Both humoral and cellular immune responses are implicated in disease pathogenesis. Several lines of evidence suggest the pathogenicity of antibodies. First, passive transfer of anti-GBM antibodies induces nephritis in monkeys, sheep, and rodents (7,8,9). Second, antibody levels are broadly correlated with disease activity in clinical studies (10,11). Third, disease recurrence has been documented when renal transplantation has been undertaken in the presence of circulating antibodies (11). However, data from experimental models indicate that cell-mediated immunity is both necessary (12) and sufficient (13) to induce disease and that anti—T-cell therapy is effective in preventing disease (14). T cells are implicated in the pathogenesis of human disease by the presence of intraglomerular T cells in renal biopsy samples (15,16) and by the strong association of the disease with the HLA class II alleles DR15 and DR4 (17). Furthermore, the class-switched autoantibodies (predominantly IgG1 and IgG4) suggest that T-cell help is required for disease initiation (18). There are few published data on the nature of the autoreactive T cells. Our group previously reported proliferation of peripheral blood mononuclear cells (PBMC) from patients with Goodpasture's disease in response to affinity-purified human GBM. However, one-half of the control subjects also exhibited some proliferation in response to GBM (19). Another group generated GBM-specific T-cell clones from patients; however, the clones were CD8+ and HLA class I-restricted, making them less relevant to the study of the T cells involved in human disease (20).

Recent data indicated that a number of autoantigens, including "sequestered antigens" and those with restricted tissue expression (such as myelin basic protein, glutamic acid decarboxylase, and insulin), are expressed in human thymic tissue (21). These findings suggested that central deletion of autoreactive T cells contributed to the T-cell tolerance to tissue-specific autoantigens. They also suggested that autoreactive T cells that escaped this selection would be of low avidity and perhaps regulated in health by peripheral mechanisms of tolerance (22). Alternatively, thymic dysfunction in presenting these antigens might lead to loss of central tolerance. We sought the presence of the Goodpasture antigen (GA) in human thymic tissue using immunohistochemical analysis with a monoclonal antibody (mAb) directed against the GA and using reverse transcription (RT)-PCR with {alpha}3(IV)NC1-specific primers. We proceeded to measure the frequency of autoreactive T cells directed against {alpha}3(IV)NC1 in patients at different disease time points and in control subjects. Our results suggest that central tolerance may operate to eliminate autoreactive T cells against the GA but some CD4+ T cells do escape this regulation and are observed at an elevated frequency in acute disease.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of GA in Human Thymus
Human thymic tissue was obtained from children (age, 1 wk to 13 mo) undergoing routine cardiac surgery and was immediately snap-frozen in liquid nitrogen. Sections were cut and maintained at -20°C. Staining was performed using the P1 mAb directed against {alpha}3(IV)NC1, which was produced as described previously (23). The second-layer antibody was rabbit anti-mouse Ig (Dako, Bucks, UK), and detection was performed using the avidin-biotin complex immunoperoxidase technique (Dako). Briefly, the sections were incubated with the primary antibody at 4°C overnight, followed by incubation with the second-layer antibody at room temperature for 1 h; development was performed with the avidin-biotin complex counterstained with hematoxylin. Negative control experiments were performed with isotype-matched mAb. The positive control was a section of renal tissue from a patient with Goodpasture's disease.

RT-PCR for {alpha}3(IV)NC1
Whole thymus was homogenized, and RNA was extracted using RNAzol B (Biogenesis, Poole, Dorset, UK). Thymic explants were used to obtain epithelial cell cultures, from which RNA was also extracted. Briefly, thymic fragments were treated with collagenase (Sigma, Poole, Dorset, UK) and plated onto collagen-coated tissue culture flasks. Epithelial cell purity was confirmed with cytokeratin staining.

Five micrograms of total RNA was reverse-transcribed with Superscript II (Gibco-BRL, Paisley, Scotland), using oligo(dT) (Gibco-BRL) as a primer. For amplification with a set of {alpha}3(IV)NC1-specific primers, 5% of the reaction product was used. Primers were as follows: forward, GCCCCGATCCATGGGATTGCCAGGTTTG; reverse, TCCCCTCGAGCCTCGAGTTCTGCTGTCT. The following PCR conditions were used: 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C for 35 cycles. A negative control experiment was performed with no reverse transcriptase in the reaction mixture.

Antigen Production
Recombinant {alpha}3(IV)NC1 was produced in COS-7 cells by using DEAE-dextran-mediated transfection, according to previously published methods (24,25). The {alpha}3(IV)NC1 plasmid DNA was cloned into a pFLAG CMV-1 expression system (Kodak, Rochester, NY), and the secreted material was purified in a single affinity step on an anti-FLAG-agarose column. Briefly, cells were grown to subconfluence in Dulbecco's modified Eagle's medium (Gibco-BRL) with 5% fetal calf serum (MBM, Bourne End, UK) and penicillin/streptomycin (Gibco-BRL). Twenty micrograms of {alpha}3(IV)NC1 plasmid DNA in phosphate-buffered saline (PBS) and 5% DEAE-dextran (Pharmacia, Uppsala, Sweden) were added to the cells for 30 min. Whole medium containing 80 µM chloroquine (Sigma) was then added for an additional 2.5 h. After this, the supernatant was washed off and medium containing 10% DMSO was added for 2.5 min, aspirated, and replaced with fresh medium. Medium was collected every 72 h for a total of 10 d. The supernatant material was passed over a column containing anti-FLAG antibody, eluted using glycine-HCl (pH 3.5), neutralized, and dialyzed with PBS.

Collagenase-solubilized GBM (CS-GBM) was produced as described previously, by sieving cadaveric human kidneys obtained at autopsy and isolating glomeruli (26). These were disrupted by soni-cation and digested with collagenase I (Sigma). Tetanus toxoid was purchased from Evans Medical (Leatherhead, UK).

Limiting Dilution Analyses
Patients and Control Subjects. Patients presenting with histologically and serologically confirmed Goodpasture's disease underwent venesection as soon as the diagnosis was confirmed and before treatment, if possible. However, only one patient (patient 3) had not received any immunosuppressive therapy at the time of venesection. All other acutely presenting patients had begun their treatment regimens within the previous 2 wk. The study received local research ethics committee approval.

Presentation of these patients was with acute renal failure in all cases and with pulmonary hemorrhage in two cases. All except two of the patients survived and renal recovery occurred for six patients, although three experienced residual renal impairment. Treatment varied according to the clinical situation but usually consisted of daily oral administration of prednisolone (starting at 60 mg and decreasing by 10 to 15 mg/wk until a dose of 20 mg was reached, after which decrements were of 2.5 mg/fortnight), daily oral administration of cyclophosphamide (2 mg/kg), and daily or near-daily plasma exchange (4-L exchanges for 14 d). For one patient (patient 1), additional pulsed methylprednisolone therapy (three daily pulses of 0.5 g) had been administered at the referring hospital. One patient (patient 3) who was dialysis-dependent at the time of presentation was not initially undergoing immunosuppressive therapy but subsequently developed pulmonary hemorrhage and received conventional treatment as described above. Immunosuppressive therapy was withdrawn during a period of 6 mo after presentation. Cyclophosphamide was withdrawn at 2 mo, and oral steroid treatment was discontinued by 6 mo for all except three patients. These three patients continued to receive low doses of steroids as follows: at 12 mo, to treat continued nephrotic-range proteinuria (patient 1, 15 mg of prednisolone); after delayed pulmonary hemorrhage (patient 3, 15 mg of prednisolone); and at 10 yr, to treat concurrent myasthenia gravis (patient 6, 5 mg of prednisolone). The patient characteristics, treatments, and outcomes are summarized in Table 1.


View this table:
[in this window]
[in a new window]

 
Table 1. Characteristics of patients and their immunosuppressive treatment at the time of T cell isolationa
 

PBMC were isolated (see below) and stored in liquid nitrogen until required. Patients underwent tissue-typing using conventional DNA methods. Cells were also obtained from a number of patients after the acute disease, in some cases as long as 10 yr after the initial presentation. Control samples were from healthy volunteers.

Cell Isolation and Enrichment. PBMC were obtained by separating whole blood using Lymphoprep (Nycomed, Oslo, Norway). CD4+ T cells and antigen-presenting cells (APC) were purified by immunomagnetic depletion using Dynabeads (Dynal, Oslo, Norway). PBMC were incubated with primary antibody for 45 min at 4°C on a roller and then washed twice in PBS. Anti-mouse Ig-coupled Dyna-beads were washed in medium [RPMI 1640 medium (ICN Pharmaceuticals, Thame, UK) with 10% human AB serum] and added, according to the recommendations of the manufacturer, for two 45-min periods at 4°C, on a roller. Bound cells were removed after passage over a magnet, and the remaining cells were washed in whole medium. APC were obtained by depleting PBMC of T cells with anti-CD4 and anti-CD8 mAb (Serotec, Oxford, UK). CD4+ T cells were obtained by first performing a PBMC-adherence step at 37°C and then incubating the nonadherent cells with anti-CD33, -CD19, -CD16, -CD14, -CD56, and -CD8 mAb (all from Serotec), to deplete B cells, monocytes, macrophages, dendritic cells, natural killer cells, and CD8+ T cells, respectively. Cell purity was confirmed by staining with anti-CD4/CD8 and anti-CD3/DR mAb (Becton Dickinson, Mountain View, CA), and flow cytometry was performed with an EPICS XL flow cytometer (Coulter Electronics, Luton, UK).

T-Cell Proliferation. APC were pulsed overnight at 37°C with medium alone, recombinant {alpha}3(IV)NC1 at 5 µg/ml, CS-GBM at 20 µg/ml, or tetanus toxoid (Evans Medical) at 1:1000 dilution. After being washed in PBS, the cells were plated in complete medium [RPMI 1640 medium containing 2 mM L-glutamine, 50 µg/ml penicillin, and 50 µg/ml streptomycin (Gibco-BRL), with 10% human AB serum] in 96-well, round-bottomed plates (Nunc, Roskilde, Denmark). CD4+ T cells were maintained at 4°C overnight, counted, and plated in doubling dilutions into the 96-well plates; 24 replicates were plated for each T-cell dilution. The final 24 wells contained only APC and served as negative controls. After 6 d, the wells were pulsed with 1 µCi of [3H]thymidine for the last 16 h of incubation. Plates were collected and counted in a ß-counter.

Calculation of Frequencies and Antigen/Autologous Mixed Lymphocyte Reaction Ratios. The frequencies of CD4+ T cells reacting to each APC preparation were calculated using the modified score function of the maximal likelihood method, as described previously (27). Calculations were performed using a newtonian iterative method with Microsoft Excel version 5 (Microsoft, Redmond, WA). Only results with P values of >0.05 ({chi}2 test) were used for further analysis. Because incubation of CD4+ T cells with APC in the absence of antigen produces a proliferative response, known as the autologous mixed lymphocyte reaction (AMLR), all frequencies were then expressed as the ratio of the antigen-specific response to the AMLR; this ratio was termed the frequency index. Derivation of the frequency index is indicated by the following equation: frequency index = frequency of CD4+ cells reacting to antigen-pulsed APC/frequency of CD4+ cells reacting to unpulsed APC. Assays were highly reproducible within subjects with respect to T-cell frequencies, whether fresh or frozen cells were used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The GA Is Expressed in Normal Human Thymus
Samples of human thymus were obtained from children undergoing cardiothoracic surgery and were analyzed for the presence of the GA by immunohistochemical analyses and RT-PCR. Thymic sections stained with mAb P1 exhibited positive staining, confirming that the GA is expressed in the thymus (Figure 1, A and B). Intense staining was observed in the perivascular space throughout the thymus, delineating vascular structures. Furthermore, numerous discrete areas of staining, which appeared to represent isolated thymic cells, were observed throughout the medulla (Figure 1B). No cortical staining was observed in any section. Thymic sections stained with isotype-matched (IgG1) control Ig exhibited no staining in the cortex or medulla (Figure 1, C and D). Sections of renal tissue from patients with Goodpasture's disease demonstrated classic linear staining along the GBM (data not shown), as described previously (3).



View larger version (183K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. (A) Immunohistochemical analysis of human thymic tissue stained with monoclonal antibody (mAb) P1, showing staining in the perivascular spaces throughout the thymus, delineating vascular structures (white arrows). (B) High-power view of the thymic medulla stained with mAb P1, revealing numerous discrete areas of staining throughout the medulla, suggesting isolated thymic epithelial cells (white arrows). (C) Control section of thymus stained with an isotype-matched (IgG1) control antibody, revealing no positive staining. (D) High-power view of the thymic medulla stained with an isotype-matched (IgG1) control antibody, revealing no positive staining. Magnifications: x200 in A and C; x400 in B and D.

 

Because negative selection is thought to occur as a result of antigen presentation to developing thymocytes by thymic epithelial cells and thymic dendritic cells (28), we sought to define whether these cells were also capable of synthesizing the GA. RNA was extracted from whole thymus and from isolated thymic epithelial cells grown as thymic explants. The latter were confirmed to be totally pure epithelial cell cultures by positive staining with cytokeratin (100% of cells positive for cytokeratin). In RT-PCR with {alpha}3(IV)NC1-specific primers, a clear band was amplified from both whole-thymus RNA and thymic epithelial cell RNA (Figure 2). The positive control sample was {alpha}3(IV)NC1 cDNA. The DNA products were confirmed to be {alpha}3(IV)NC1 by their exhibiting a pattern of bands identical to that of control {alpha}3(IV)NC1 cDNA after digestion with the appropriate restriction enzymes.



View larger version (26K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Reverse transcription-PCR analyses of human thymic epithelial cells (TE) and whole thymus (WT), with negative control samples (NEG) and positive control samples (POS) consisting of {alpha}3 chain of type IV collagen [{alpha}3(IV)NC1] cDNA, after 35 cycles of amplification. M, DNA ladder markers. Arrow, 721-bp band.

 

Frequencies of GA-Specific T Cells Are Elevated in Acute Disease and Decrease with Time
All patients and one-half of the healthy control subjects expressed DR15 and/or DR4 HLA class II alleles, with which the disease is strongly associated (17). Three patients were prospectively monitored for up to 1 yr. Cell isolation and enrichment from blood samples or frozen PBMC were successfully performed in all cases. After cell purification, flow cytometry demonstrated that CD4+ cells represented 88 to 95% of all CD3+ cells. APC were enriched such that the majority of the cells were positive for DR antigens, with <10% of cells staining for CD3 (Figure 3).



View larger version (25K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. (a) Flow cytometric histogram of antigen-presenting cells, showing negative control cells (solid line) and HLA-DR-positive cells (filled profile). (b) Flow cytometric histogram of responder T cells, showing negative control cells (solid line, upper profile), CD8+ cells (solid line, lower profile), and CD4+ cells (filled profile).

 

The frequencies of T cells proliferating in response to CS-GBM, recombinant {alpha}3(IV)NC1, tetanus toxoid, and autologous APC alone were calculated (as summarized in Table 2). The frequencies for CS-GBM varied from 1:10,000 to 1:123,000 and those for recombinant {alpha}3(IV)NC1 varied from 1:6289 to 1:65,359 during acute disease. However, the AMLR also varied considerably in both control subjects and patients (from 1:8475 to 1:79,000 and from 1:9346 to 1:159,000, respectively). Therefore, to enable more meaningful comparisons between assays and among individuals, an antigen-specific frequency/AMLR frequency ratio was calculated and termed the frequency index (Figure 4). All samples tested exhibited a measurable AMLR, and there was no significant difference in the AMLR between patients and control subjects. Not all patients exhibited a measurable frequency for tetanus toxoid, whereas all control subjects did. For patients, the CS-GBM frequency index varied from 1.26 to 3.96. There was a similar CS-GBM frequency index range for control subjects. There was, however, a significant difference between patients during their acute disease period and control subjects with respect to the frequency index for {alpha}3(IV)NC1-specific CD4+ T cells (P < 0.05, Mann-Whitney U test). All patients tested with {alpha}3(IV)NC1 exhibited a frequency index of >1, whereas the control subjects did not.


View this table:
[in this window]
[in a new window]

 
Table 2. Frequencies of CD4+ T cells reacting in the AMLR and in response to CS-GBM, {alpha}3(IV)NC1, and tetanus toxoid and calculated frequency indices for CS-GBM-, {alpha}3(IV)NC1-, and tetanus toxoid-specific T cells in patients and control subjectsa
 


View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Graph comparing the frequency indices for collagenase-solubilized glomerular basement membrane (GBM) and {alpha}3(IV)NC1 for patients with acute disease and control subjects. Each point represents one subject tested. Bars show the mean ratio for each group. There was a significant difference between patients and control subjects only with respect to {alpha}3(IV)NC1 (P < 0.05, Mann Whitney-U test).

 

For the patients who were tested during the acute disease phase and during convalescence, up to 12 mo later (patients 1 and 3), there were decreases in the frequency indices for both CS-GBM and {alpha}3(IV)NC1. The frequency index for tetanus toxoid for patient 1 increased during the same period. For one of the convalescent patients (patient 5), the frequency for CS-GBM was low but the frequency for {alpha}3(IV)NC1 was elevated, despite the fact that the patient was disease-free and without circulating anti-GBM antibodies. Patients who had experienced disease >10 yr earlier (patients 6, 7, and 8) exhibited no detectable frequencies for CS-GBM or {alpha}3(IV)NC1. Comparison of {alpha}3(IV)NC1-specific frequency indices at different disease time points demonstrated a trend for reduction in {alpha}3(IV)NC1-specific T-cell frequencies with time (Figure 5). These differences did not reach statistical significance, however, because of the small numbers of patients evaluated at each time point.



View larger version (8K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Graph showing the differences in {alpha}3(IV)NC1 frequency indices for patients at presentation (Acute) and 12 mo and 10 yr after the initial presentation, compared with control subjects. There seems to be a decrease in the frequencies of autoreactive {alpha}3(IV)NC1-specific T cells with time after disease presentation.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Three novel observations are described here. First, significantly elevated frequencies of CD4+ T cells specific for {alpha}3(IV)NC1 were detected in patients at the time of acute Goodpasture's disease. Second, the frequencies of autoreactive T cells steadily decreased with time. Third, expression of {alpha}3(IV)NC1 was clearly detectable, by immunocytochemical and PCR analyses, in the normal human thymus.

The autoantigen specificity of B cells in this disease is well established and is highly conserved among patients (4,23). In contrast, definition of the antigen specificity of autoreactive T cells has been elusive. This has led to uncertainty regarding whether the determinants recognized by T cells are derived from the {alpha}3(IV)NC1 domain or whether they are located on another protein that is internalized with {alpha}3(IV)NC1 by antigen-specific B cells. The results described here suggest that this molecule is a relevant autoantigen in Goodpasture's disease. Clearly, these findings do not exclude the possibility of there being T-cell epitopes in other elements of the GBM. However, the demonstration of increased frequencies of T cells that are reactive with this molecule justifies further investigation of how the antigen is processed and presented, particularly by the DR alleles that are associated with disease susceptibility.

Although significantly increased frequencies for {alpha}3(IV)NC1 were detected during acute disease, in comparison with control values, the absolute frequencies were low. Similar frequencies have been reported for autoreactive T cells in other autoimmune diseases (29). These frequencies can be contrasted with the frequencies measured after immunization against typical exogenous antigens, such as tetanus toxoid, which usually range from 1:1000 to 10,000 (30). There are several possible explanations for the small numbers of T cells detectable in peripheral blood. One possibility is that most of the autoreactive T cells are sequestered in the diseased organs and the draining lymph nodes. This possibility is difficult to address in patients. However, in mouse models of allograft rejection, it seems that reactivity in circulating T cells reflects events in the graft itself (31,32).

A second possibility, which is favored by our data, is that most autoantigen-specific T cells are deleted in the thymus. It was recently demonstrated that a number of autoantigens are expressed in the thymus, and it is becoming clear that the thymus may present a vast array of self-proteins, including those that are sequestered or have limited tissue distribution (21,33,34,35). Levels of expression of these autoantigens were recently demonstrated to be inversely correlated with a predisposition to develop autoimmune diseases (33,36,37). Therefore, susceptibility to autoimmunity may be partly related to a capacity to centrally delete autoreactive T cells (38,39), and this capacity may be related to the level of thymic autoantigen expression. Despite the process of negative selection, there is evidence that, in certain autoimmune diseases, self-reactive T cells escape thymic deletion through low-avidity interactions with thymic cells expressing the autoantigen (22).

We have demonstrated, at the mRNA and protein levels, that the autoantigen is expressed in the thymus, specifically in thymic epithelial cells. These cells are known to be important in antigen presentation to developing thymocytes during negative selection (28). Therefore, an antigen with such distribution would be expected to be shed or packaged (in exosomes) and taken up by neighboring cells to be processed and presented in association with class II MHC on the cell surface. This process would enable central deletion of high-avidity autoreactive T cells during development of the immune repertoire (40,41). We have not been able to compare the levels of thymic GA expression in patients and control subjects, and there remains the possibility that patients may be deficient in this expression and may thus fail to delete autoreactive T cells.

The T-cell frequencies for CS-GBM, which contains many different potential antigens, were the same for patients and control subjects. This finding is reminiscent of the data from proliferation assays that we reported previously; proliferation in response to affinity-purified GBM preparations was observed in 50% of healthy control subjects (19). It is also in keeping with other reports of autoreactive cells in healthy individuals (42). However, there was a significantly increased frequency of T cells reactive with the specific autoantigen {alpha}3 (IV) NC1 in patients at presentation, compared with control subjects. The reduction in {alpha}3(IV)NC1-specific T-cell frequencies among patients with time is not simply attributable to concurrent immunosuppressive treatment, because the highest T-cell frequencies were observed for patients undergoing heavy immunosuppressive regimens and lower frequencies were observed for patients receiving minimal or no immunosuppressive therapy and control subjects. Furthermore, for patient 1, the frequency index for tetanus toxoid was markedly elevated during convalescence, compared with presentation, whereas the frequency index for {alpha}3(IV)NC1 decreased during the same period. Finally, the T-cell frequencies for recombinant {alpha}3(IV)NC1 are not simply related to the expression system used to generate the antigen, because others have demonstrated that it is only the specific {alpha}3 (and {alpha}4) chains generated in such an expression system that are capable of inducing disease in experimental models (43,44,45). Furthermore, control subjects exhibited no detectable frequencies for recombinant {alpha}3(IV)NC1.

When these data are considered together, it seems that, despite the presence of the GA in the thymus, autoreactive T cells do escape thymic deletion in patients and are observed at increased frequency during periods of active disease. With time, these cells decrease in number, possibly as a result of regulation or deletion (39). This may in part explain the lack of disease recurrence and the decrease in antibody levels with time. Interestingly, our patients all received immunosuppressive therapy, which may have been sufficient to regulate T-cell autoreactivity. Disease recurrence has been observed, albeit rarely (5,46). It is tempting to speculate that, for these patients experiencing relapses, there was poor long-term regulation of autoreactive T cells and thus, after immunosuppressant withdrawal or because of other triggers, disease recurred. One such patient, who had successfully undergone transplantation, experienced relapse only after withdrawal of immunosuppressive therapy (46). Another patient experienced relapse when his immunosuppressive therapy was reduced in association with continued smoking (5). Indeed, for one of our current patients (patient 5), the frequency of {alpha}3(IV)NC1-autoreactive T cells has remained high 1 yr after presentation, despite the fact that the patient is free of disease, with undetectable autoantibody levels. Longer follow-up periods will allow us to monitor whether the patient experiences relapse or exhibits a decrease in the frequency of autoreactive T cells. Further investigations into the mechanisms underlying the loss of regulation of {alpha}3(IV)NC1-specific autoreactive T cells, their epitope specificity, and the basis of HLA-DR-linked disease susceptibility are required before the pathogenesis of this disease is sufficiently well understood for the design of antigen-specific immunotherapy.


    Acknowledgments
 
Drs. Salama, Chaudhry, and Eren are Medical Research Council Clinical Training Fellows. Dr. Ryan was supported by a grant from the Viviann Philpott Research Fund. We are very grateful to Prof. Mary Ritter for critical review of the manuscript and subsequent discussions.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Morrison KE, Mariyama M, Yang-Feng TL, Reeders ST: Sequence and isolation of a partial cDNA encoding the human {alpha}3 chain of type IV collagen. Am J Hum Genet 49:545 -554, 1991[Medline]
  2. Turner AN, Mason PJ, Brown R, Fox M, Povey S, Rees AJ, Pusey CD: Molecular cloning of the human Goodpasture antigen demonstrates it to be the {alpha}3 chain of type IV collagen. J Clin Invest89 : 592-601,1992
  3. Cashman SJ, Pusey CD, Evans DJ: Extraglomerular distribution of immunoreactive Goodpasture antigen. J Pathol155 : 61-70,1988[Medline]
  4. Derry CJ, Dunn MJ. Rees AJ, Pusey CD: Restricted specificity of the autoantibody response in Goodpasture's syndrome demonstrated by two dimensional Western blotting. Clin Exp Immunol86 : 457-463,1991[Medline]
  5. Levy J, Lachmann RH, Pusey CD: Recurrent Goodpasture's disease. Am J Kidney Dis 27:573 -578, 1996[Medline]
  6. Turner AN, Rees AJ: Anti-glomerular basement membrane disease. In: Rapidly Progressive Glomerulonephritis, edited by Pusey CD, Rees AJ, Oxford, UK, Oxford University Press, 1997, pp108 -124
  7. Lerner RA, Glassock RJ, Dixon FJ: The role of anti-glomerular basement membrane antibody in the pathogenesis of human glomerulonephritis. J Exp Med 126:989 -1004, 1967[Abstract]
  8. Steblay RW: Anti-glomerular basement membrane glomerulonephritis. Am J Pathol 96:875 -878, 1979[Medline]
  9. Sado Y, Naito I, Ogigaki T: Transfer of anti-glomerular basement membrane antibody-induced glomerulonephritis in inbred rats with isologous antibodies from the urine of nephritic rats. J Pathol158 : 325-332,1989[Medline]
  10. Peters DK, Rees AJ, Lockwood CM, Pusey CD: Treatment and prognosis in antibasement membrane antibody-mediated nephritis. Transplant Proc 14: 513-521,1982[Medline]
  11. Wilson CB, Dixon FJ: Anti-glomerular basement membrane antibody-induced glomerulonephritis. Kidney Int3 : 74-89,1973[Medline]
  12. Kalluri R, Danoff TM, Okada H, Neilson EG: Susceptibility to antiglomerular basement membrane disease and Goodpasture syndrome is linked to MHC class II genes and the emergence of T cell-mediated immunity in mice. J Clin Invest 100:2263 -2275, 1997[Medline]
  13. Bolton WK, Tucker FL, Sturgill BC: New avian model of experimental glomerulonephritis consistent with mediation by cellular immunity: Nonhumorally mediated glomerulonephritis in chickens. J Clin Invest 73:1263 -1276, 1984
  14. Reynolds J, Tam FWK, Chandraker A, Smith J, Karkar AM, Cross J, Peach R, Sayegh MH, Pusey CD: CD28-B7 blockade prevents the development of experimental autoimmune glomerulonephritis. J Clin Invest 105:643 -651, 2000[Medline]
  15. Rocklin RE, Lewis EJ, David JR: In vitro evidence for cellular hypersensitivity to glomerular-basement-membrane antigens in human glomerulonephritis. N Engl J Med283 : 497-501,1970
  16. Nolasco FE, Cameron JS, Hartley B, Coelho A, Hildreth G, Reuben R: Intraglomerular T cells and monocytes in nephritis: Study with monoclonal antibodies. Kidney Int 31:1160 -1166, 1987[Medline]
  17. Fisher M, Pusey CD, Vaughan RW, Rees AJ: Susceptibility to anti-glomerular basement membrane disease is strongly associated with HLA-DRB1 genes. Kidney Int 51:222 -229, 1997[Medline]
  18. Segelmark M, Butkowski R, Weislander J: Antigen restriction and IgG subclasses among anti-GBM autoantibodies. Nephrol Dial Transplant 5:991 -996, 1990
  19. Derry CJ, Ross CN, Lombardi G, Mason PD, Rees AJ, Lechler RI, Pusey CD: Analysis of T cell responses to the autoantigen in Goodpasture's disease. Clin Exp Immunol 100:262 -268, 1995[Medline]
  20. Merkel F, Kalluri R, Marx M, Enders U, Stevanovic S, Giegerich G, Neilson EG, Rammensee HG, Hudson BG, Weber M: Autoreactive T-cells in Goodpasture's syndrome recognise the N-terminal NC1 domain on {alpha}3 type IV collagen. Kidney Int 49:1127 -1133, 1996[Medline]
  21. Sospedra M, Ferrer-Francesch X, Dominguez O, Juan M, Foz-Sala M, Pujol-Borrell R: Transcription of a broad range of self-antigens in human thymus suggests a role for central mechanisms in tolerance toward peripheral antigens. J Immunol 161:5918 -5929, 1998[Abstract/Free Full Text]
  22. Anderton S, Burkhart C, Metzler B, Wraith D: Mechanisms of central and peripheral tolerance: Lessons from experimental models of multiple sclerosis. Immunol Rev 169:123 -137, 1999[Medline]
  23. Pusey CD, Dash A, Kershaw MJ, Morgan A, Reilly A, Rees AJ, Lockwood CM: A single autoantigen in Goodpasture's syndrome identified by a monoclonal antibody to human glomerular basement membrane. Lab Invest 56: 23-31,1987[Medline]
  24. Chisholm V: High efficiency gene transfer into mammalian cells. In: DNA Cloning 4: Mammalian Systems, edited by Glover DM, Hames BD, Oxford, UK, IRL Press, 1995, pp16 -19
  25. Ryan JJ, Mason PJ, Pusey CD, Turner N: Recombinant {alpha}-chains of type IV collagen demonstrate that the amino terminal of the Goodpasture autoantigen is crucial for antibody recognition. Clin Exp Immunol 113:17 -27, 1998[Medline]
  26. Bowman C, Lockwood CM: Clinical application of a radioimmunoassay for autoantibodies to glomerular basement membrane. J Clin Lab Immunol 17:197 -202, 1985[Medline]
  27. Mehrabi Y, Matthews JNS: Likelihood based methods for bias reduction in limiting dilution assays. Biometrics51 : 1543-1549,1995
  28. Volkmann A, Zal T, Stockinger B: Antigen-presenting cells in the thymus that can negatively select MHC class II-restricted T cells recognizing a circulating self antigen. J Immunol158 : 693-706,1997[Abstract]
  29. Zhang J, Markovic-Plese S, Lacet B, Raus J, Weiner HL, Hafler DA: Increased frequency of interleukin 2- responsive T cells specific for myelin basic protein and proteolipid protein in peripheral blood and cerebrospinal fluid of patients with multiple sclerosis. J Exp Med179 : 973-984,1994[Abstract/Free Full Text]
  30. Adams PW, Opremack EM, Orosz CG: Limiting dilution analysis of human, tetanus-reactive helper T lymphocytes. J Immunol Methods 142:231 -241, 1991[Medline]
  31. Orosz CG, Bishop DK: Limiting dilution analysis of alloreactive T-cell status and distribution during allograft rejection. Hum Immunol 28:72 -81, 1990
  32. Bishop DK, Ferguson RM, Orosz CG: Differential distribution of antigen-specific helper T cells and cytotoxic T cells after antigenic stimulation in vivo. J Immunol144 : 1153-1160,1990[Abstract]
  33. Mathisen PM, Pease S, Garvey J, Hood L, Readhead C: Identification of an embryonic isoform of myelin basic protein that is expressed widely in the mouse embryo. Proc Natl Acad Sci USA90 : 10125-10129,1993[Abstract/Free Full Text]
  34. Vafiadis P, Bennett ST, Todd JA, Nadeau J, Grabs R, Goodyer CG, Wickramasinghe S, Colle E, Polychronakos C: Insulin expression in human thymus is modulated by INS UNTR alleles at the IDDM2 locus. Nat Genet 15:289 -292, 1997[Medline]
  35. Farr AG, Rudensky A: Medullary thymic epithelium: A mosaic of epithelial "self"? J Exp Med188 : 1-4,1998[Free Full Text]
  36. Degermann S, Surh CD, Glimcher LH, Sprent J, Lo D: B7 expression on thymic medullary epithelium correlates with epithelium-mediated deletion of vß5+ thymocytes. J Immunol152 : 3254-3263,1994[Abstract]
  37. Egwuagu CE, Charukamnoetkanok P, Gery I: Thymic expression of autoantigens correlates with resistance to autoimmune disease. J Immunol 159:3109 -3112, 1997[Abstract]
  38. Sprent J, Lo D, Er-Kai G, Ron Y: T cell selection in the thymus. Immunol Rev 101:172 -190, 1988
  39. Goodnow CG: Balancing immunity and tolerance: Deleting and tuning lymphocyte repertoires. Proc Natl Acad Sci USA93 : 2264-2271,1996[Abstract/Free Full Text]
  40. Hoffmann MW, Allison J, Miller JF: Tolerance induction by thymic medullary epithelium. Proc Natl Acad Sci USA89 : 2526-2530,1992[Abstract/Free Full Text]
  41. Oukka M, Colucci-Guyon E, Lan Tran P, Cohen-Tannoudji M, Babinet C, Lotteau V, Kosmatopoulos K: CD4 T cell tolerance to nuclear proteins induced by medullary thymic epithelium. Immunity4 : 545-553,1996[Medline]
  42. Hafler DA, Weiner HL: Immunologic mechanisms in multiple sclerosis. Immunol Rev 144:75 -107, 1995[Medline]
  43. Sado Y, Boutaud A, Kagawa M, Naito I, Ninomiya Y, Hudson BG: Induction of anti-GBM nephritis in rats by recombinant {alpha}3(IV)NC1 and {alpha}4(IV)NC1 of type IV collagen. Kidney Int53 : 664-671,1998[Medline]
  44. Bolton WK, Chen LL, Fox J: Importance of post-translational modification of protein structure on nephritogenicity of Goodpasture's (GP) epitope. J Am Soc Nephrol 10:543A , 1999
  45. Ryan JJ, Reynolds J, Norgan V, Pusey CD: Expression and characterization of recombinant rat {alpha}3(IV)NC1 and its use in induction of experimental autoimmune glomerulonephritis. Nephrol Dial Transplant 16:253 -263, 2001[Abstract/Free Full Text]
  46. Fonck C, Loute G, Cosyns JP, Pirson Y: Recurrent fulminant anti-glomerular basement membrane nephritis at a 7-year interval. Am J Kidney Dis 32:323 -327, 1998[Medline]
Received for publication October 12, 2000. Accepted for publication March 15, 2001.




This article has been cited by other articles:


Home page
J. Immunol.Home page
Y. Zhang, S. C. Su, D. B. Hecox, G. F. Brady, K. M. Mackin, A. G. Clark, and M. H. Foster
Central Tolerance Regulates B Cells Reactive with Goodpasture Antigen {alpha}3(IV)NC1 Collagen
J. Immunol., November 1, 2008; 181(9): 6092 - 6100.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Zou, L. Henderson, V. Thomas, P. Swan, A. N. Turner, and Richard. G. Phelps
Presentation of the Goodpasture Autoantigen Requires Proteolytic Unlocking Steps That Destroy Prominent T Cell Epitopes
J. Am. Soc. Nephrol., March 1, 2007; 18(3): 771 - 779.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Reynolds, A. Albouainain, M. A. Duda, D. J. Evans, and C. D. Pusey
Strain susceptibility to active induction and passive transfer of experimental autoimmune glomerulonephritis in the rat
Nephrol. Dial. Transplant., December 1, 2006; 21(12): 3398 - 3408.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. G. Tipping and S. R. Holdsworth
T Cells in Crescentic Glomerulonephritis
J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1253 - 1263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D.-B. Borza, O. Bondar, S. Colon, P. Todd, Y. Sado, E. G. Neilson, and B. G. Hudson
Goodpasture Autoantibodies Unmask Cryptic Epitopes by Selectively Dissociating Autoantigen Complexes Lacking Structural Reinforcement: NOVEL MECHANISMS FOR IMMUNE PRIVILEGE AND AUTOIMMUNE PATHOGENESIS
J. Biol. Chem., July 22, 2005; 280(29): 27147 - 27154.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
L. S. Cairns, R. G. Phelps, L. Bowie, A. M. Hall, W. W.M. Saweirs, A. J. Rees, and R. N. Barker
The Fine Specificity and Cytokine Profile of T-Helper Cells Responsive to the {alpha}3 Chain of Type IV Collagen in Goodpasture's Disease
J. Am. Soc. Nephrol., November 1, 2003; 14(11): 2801 - 2812.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. D. Salama and J. B. Levy
Tolerance and Autoimmunity in Anti-GBM Disease
J. Am. Soc. Nephrol., November 1, 2003; 14(11): 2988 - 2989.
[Full Text] [PDF]


Home page
NEJMHome page
B. G. Hudson, K. Tryggvason, M. Sundaramoorthy, and E. G. Neilson
Alport's Syndrome, Goodpasture's Syndrome, and Type IV Collagen
N. Engl. J. Med., June 19, 2003; 348(25): 2543 - 2556.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SALAMA, A. D.
Right arrow Articles by LECHLER, R. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SALAMA, A. D.
Right arrow Articles by LECHLER, R. I.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP