| 2008 JASN IMPACT FACTOR 7.505 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
3(IV)NC1


*
Renal Section, Division of Medicine, Imperial College School of Medicine,
Hammersmith Hospital, London, United Kingdom.
Department of Immunology, Division of Medicine, Imperial College School of
Medicine, Hammersmith Hospital, London, United Kingdom.
Correspondence to Dr. Alan D. Salama, Renal Division, Laboratory of Immunogenetics and Transplantation, Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115. Phone: 617-732-5252; Fax: 617-732-5254; E-mail: asalama{at}rics.bwh.harvard.edu
| Abstract |
|---|
|
|
|---|
3 chain of type IV collagen [
3(IV)NC1] (known as
the Goodpasture antigen). Unlike many other autoimmune diseases, recurrences
are rare. In experimental models and human studies, both humoral and cellular
mechanisms have been demonstrated to be involved in disease pathogenesis.
However, there are few data on the characteristics of the autoreactive T cells
or the mechanisms of tolerance to the autoantigen in human patients. It was
demonstrated, using immunohistochemical analyses and reverse
transcription-PCR, that the Goodpasture antigen is expressed in normal human
thymus. Using limiting dilution analyses, the frequencies of circulating
autoreactive T cells in patients and control subjects were assessed. During
acute disease, there were increased frequencies of CD4+ T cells
reactive with
3(IV)NC1 (ranging from 1:6300 to 1:65,000), which
decreased with time. There was a significant difference between patients
during their acute disease phase and control subjects with respect to the
frequency index for
3(IV)NC1-specific CD4+ T cells
(P < 0.05, Mann Whitney U test). The decrease in
autoreactive CD4+ T-cell numbers during recovery may be the reason
why recurrences are infrequent and may explain the loss of pathogenic
autoantibodies with time, because of a lack of T-cell help. | Introduction |
|---|
|
|
|---|
3 chain of type IV collagen [
3(IV)NC1]
(1,2),
which has limited tissue distribution
(3) and to which the
autoantibody response is highly restricted
(4). Unlike other autoimmune
conditions, the disease rarely exhibits a relapsing-remitting course
(5). Without treatment,
autoantibody levels decrease to normal in a period of 2 to 3 yr
(6). Both humoral and cellular immune responses are implicated in disease pathogenesis. Several lines of evidence suggest the pathogenicity of antibodies. First, passive transfer of anti-GBM antibodies induces nephritis in monkeys, sheep, and rodents (7,8,9). Second, antibody levels are broadly correlated with disease activity in clinical studies (10,11). Third, disease recurrence has been documented when renal transplantation has been undertaken in the presence of circulating antibodies (11). However, data from experimental models indicate that cell-mediated immunity is both necessary (12) and sufficient (13) to induce disease and that antiT-cell therapy is effective in preventing disease (14). T cells are implicated in the pathogenesis of human disease by the presence of intraglomerular T cells in renal biopsy samples (15,16) and by the strong association of the disease with the HLA class II alleles DR15 and DR4 (17). Furthermore, the class-switched autoantibodies (predominantly IgG1 and IgG4) suggest that T-cell help is required for disease initiation (18). There are few published data on the nature of the autoreactive T cells. Our group previously reported proliferation of peripheral blood mononuclear cells (PBMC) from patients with Goodpasture's disease in response to affinity-purified human GBM. However, one-half of the control subjects also exhibited some proliferation in response to GBM (19). Another group generated GBM-specific T-cell clones from patients; however, the clones were CD8+ and HLA class I-restricted, making them less relevant to the study of the T cells involved in human disease (20).
Recent data indicated that a number of autoantigens, including
"sequestered antigens" and those with restricted tissue expression
(such as myelin basic protein, glutamic acid decarboxylase, and insulin), are
expressed in human thymic tissue
(21). These findings suggested
that central deletion of autoreactive T cells contributed to the T-cell
tolerance to tissue-specific autoantigens. They also suggested that
autoreactive T cells that escaped this selection would be of low avidity and
perhaps regulated in health by peripheral mechanisms of tolerance
(22). Alternatively, thymic
dysfunction in presenting these antigens might lead to loss of central
tolerance. We sought the presence of the Goodpasture antigen (GA) in human
thymic tissue using immunohistochemical analysis with a monoclonal antibody
(mAb) directed against the GA and using reverse transcription (RT)-PCR with
3(IV)NC1-specific primers. We proceeded to measure the frequency of
autoreactive T cells directed against
3(IV)NC1 in patients at different
disease time points and in control subjects. Our results suggest that central
tolerance may operate to eliminate autoreactive T cells against the GA but
some CD4+ T cells do escape this regulation and are observed at an
elevated frequency in acute disease.
| Materials and Methods |
|---|
|
|
|---|
3(IV)NC1, which was
produced as described previously
(23). The second-layer
antibody was rabbit anti-mouse Ig (Dako, Bucks, UK), and detection was
performed using the avidin-biotin complex immunoperoxidase technique (Dako).
Briefly, the sections were incubated with the primary antibody at 4°C
overnight, followed by incubation with the second-layer antibody at room
temperature for 1 h; development was performed with the avidin-biotin complex
counterstained with hematoxylin. Negative control experiments were performed
with isotype-matched mAb. The positive control was a section of renal tissue
from a patient with Goodpasture's disease.
RT-PCR for
3(IV)NC1
Whole thymus was homogenized, and RNA was extracted using RNAzol B
(Biogenesis, Poole, Dorset, UK). Thymic explants were used to obtain
epithelial cell cultures, from which RNA was also extracted. Briefly, thymic
fragments were treated with collagenase (Sigma, Poole, Dorset, UK) and plated
onto collagen-coated tissue culture flasks. Epithelial cell purity was
confirmed with cytokeratin staining.
Five micrograms of total RNA was reverse-transcribed with Superscript II
(Gibco-BRL, Paisley, Scotland), using oligo(dT) (Gibco-BRL) as a primer. For
amplification with a set of
3(IV)NC1-specific primers, 5% of the
reaction product was used. Primers were as follows: forward,
GCCCCGATCCATGGGATTGCCAGGTTTG; reverse, TCCCCTCGAGCCTCGAGTTCTGCTGTCT. The
following PCR conditions were used: 1 min at 94°C, 1 min at 60°C, and
1 min at 72°C for 35 cycles. A negative control experiment was performed
with no reverse transcriptase in the reaction mixture.
Antigen Production
Recombinant
3(IV)NC1 was produced in COS-7 cells by using
DEAE-dextran-mediated transfection, according to previously published methods
(24,25).
The
3(IV)NC1 plasmid DNA was cloned into a pFLAG CMV-1 expression
system (Kodak, Rochester, NY), and the secreted material was purified in a
single affinity step on an anti-FLAG-agarose column. Briefly, cells were grown
to subconfluence in Dulbecco's modified Eagle's medium (Gibco-BRL) with 5%
fetal calf serum (MBM, Bourne End, UK) and penicillin/streptomycin
(Gibco-BRL). Twenty micrograms of
3(IV)NC1 plasmid DNA in
phosphate-buffered saline (PBS) and 5% DEAE-dextran (Pharmacia, Uppsala,
Sweden) were added to the cells for 30 min. Whole medium containing 80 µM
chloroquine (Sigma) was then added for an additional 2.5 h. After this, the
supernatant was washed off and medium containing 10% DMSO was added for 2.5
min, aspirated, and replaced with fresh medium. Medium was collected every 72
h for a total of 10 d. The supernatant material was passed over a column
containing anti-FLAG antibody, eluted using glycine-HCl (pH 3.5), neutralized,
and dialyzed with PBS.
Collagenase-solubilized GBM (CS-GBM) was produced as described previously, by sieving cadaveric human kidneys obtained at autopsy and isolating glomeruli (26). These were disrupted by soni-cation and digested with collagenase I (Sigma). Tetanus toxoid was purchased from Evans Medical (Leatherhead, UK).
Limiting Dilution Analyses
Patients and Control Subjects. Patients presenting with
histologically and serologically confirmed Goodpasture's disease underwent
venesection as soon as the diagnosis was confirmed and before treatment, if
possible. However, only one patient (patient 3) had not received any
immunosuppressive therapy at the time of venesection. All other acutely
presenting patients had begun their treatment regimens within the previous 2
wk. The study received local research ethics committee approval.
Presentation of these patients was with acute renal failure in all cases and with pulmonary hemorrhage in two cases. All except two of the patients survived and renal recovery occurred for six patients, although three experienced residual renal impairment. Treatment varied according to the clinical situation but usually consisted of daily oral administration of prednisolone (starting at 60 mg and decreasing by 10 to 15 mg/wk until a dose of 20 mg was reached, after which decrements were of 2.5 mg/fortnight), daily oral administration of cyclophosphamide (2 mg/kg), and daily or near-daily plasma exchange (4-L exchanges for 14 d). For one patient (patient 1), additional pulsed methylprednisolone therapy (three daily pulses of 0.5 g) had been administered at the referring hospital. One patient (patient 3) who was dialysis-dependent at the time of presentation was not initially undergoing immunosuppressive therapy but subsequently developed pulmonary hemorrhage and received conventional treatment as described above. Immunosuppressive therapy was withdrawn during a period of 6 mo after presentation. Cyclophosphamide was withdrawn at 2 mo, and oral steroid treatment was discontinued by 6 mo for all except three patients. These three patients continued to receive low doses of steroids as follows: at 12 mo, to treat continued nephrotic-range proteinuria (patient 1, 15 mg of prednisolone); after delayed pulmonary hemorrhage (patient 3, 15 mg of prednisolone); and at 10 yr, to treat concurrent myasthenia gravis (patient 6, 5 mg of prednisolone). The patient characteristics, treatments, and outcomes are summarized in Table 1.
|
PBMC were isolated (see below) and stored in liquid nitrogen until required. Patients underwent tissue-typing using conventional DNA methods. Cells were also obtained from a number of patients after the acute disease, in some cases as long as 10 yr after the initial presentation. Control samples were from healthy volunteers.
Cell Isolation and Enrichment. PBMC were obtained by separating whole blood using Lymphoprep (Nycomed, Oslo, Norway). CD4+ T cells and antigen-presenting cells (APC) were purified by immunomagnetic depletion using Dynabeads (Dynal, Oslo, Norway). PBMC were incubated with primary antibody for 45 min at 4°C on a roller and then washed twice in PBS. Anti-mouse Ig-coupled Dyna-beads were washed in medium [RPMI 1640 medium (ICN Pharmaceuticals, Thame, UK) with 10% human AB serum] and added, according to the recommendations of the manufacturer, for two 45-min periods at 4°C, on a roller. Bound cells were removed after passage over a magnet, and the remaining cells were washed in whole medium. APC were obtained by depleting PBMC of T cells with anti-CD4 and anti-CD8 mAb (Serotec, Oxford, UK). CD4+ T cells were obtained by first performing a PBMC-adherence step at 37°C and then incubating the nonadherent cells with anti-CD33, -CD19, -CD16, -CD14, -CD56, and -CD8 mAb (all from Serotec), to deplete B cells, monocytes, macrophages, dendritic cells, natural killer cells, and CD8+ T cells, respectively. Cell purity was confirmed by staining with anti-CD4/CD8 and anti-CD3/DR mAb (Becton Dickinson, Mountain View, CA), and flow cytometry was performed with an EPICS XL flow cytometer (Coulter Electronics, Luton, UK).
T-Cell Proliferation. APC were pulsed overnight at 37°C with
medium alone, recombinant
3(IV)NC1 at 5 µg/ml, CS-GBM at 20
µg/ml, or tetanus toxoid (Evans Medical) at 1:1000 dilution. After being
washed in PBS, the cells were plated in complete medium [RPMI 1640 medium
containing 2 mM L-glutamine, 50 µg/ml penicillin, and 50 µg/ml
streptomycin (Gibco-BRL), with 10% human AB serum] in 96-well, round-bottomed
plates (Nunc, Roskilde, Denmark). CD4+ T cells were maintained at
4°C overnight, counted, and plated in doubling dilutions into the 96-well
plates; 24 replicates were plated for each T-cell dilution. The final 24 wells
contained only APC and served as negative controls. After 6 d, the wells were
pulsed with 1 µCi of [3H]thymidine for the last 16 h of
incubation. Plates were collected and counted in a ß-counter.
Calculation of Frequencies and Antigen/Autologous Mixed Lymphocyte
Reaction Ratios. The frequencies of CD4+ T cells reacting to
each APC preparation were calculated using the modified score function of the
maximal likelihood method, as described previously
(27). Calculations were
performed using a newtonian iterative method with Microsoft Excel version 5
(Microsoft, Redmond, WA). Only results with P values of >0.05
(
2 test) were used for further analysis. Because incubation of
CD4+ T cells with APC in the absence of antigen produces a
proliferative response, known as the autologous mixed lymphocyte reaction
(AMLR), all frequencies were then expressed as the ratio of the
antigen-specific response to the AMLR; this ratio was termed the frequency
index. Derivation of the frequency index is indicated by the following
equation: frequency index = frequency of CD4+ cells reacting to
antigen-pulsed APC/frequency of CD4+ cells reacting to unpulsed
APC. Assays were highly reproducible within subjects with respect to T-cell
frequencies, whether fresh or frozen cells were used.
| Results |
|---|
|
|
|---|
|
Because negative selection is thought to occur as a result of antigen
presentation to developing thymocytes by thymic epithelial cells and thymic
dendritic cells (28), we
sought to define whether these cells were also capable of synthesizing the GA.
RNA was extracted from whole thymus and from isolated thymic epithelial cells
grown as thymic explants. The latter were confirmed to be totally pure
epithelial cell cultures by positive staining with cytokeratin (100% of cells
positive for cytokeratin). In RT-PCR with
3(IV)NC1-specific primers, a
clear band was amplified from both whole-thymus RNA and thymic epithelial cell
RNA (Figure 2). The positive
control sample was
3(IV)NC1 cDNA. The DNA products were confirmed to be
3(IV)NC1 by their exhibiting a pattern of bands identical to that of
control
3(IV)NC1 cDNA after digestion with the appropriate restriction
enzymes.
|
Frequencies of GA-Specific T Cells Are Elevated in Acute Disease and
Decrease with Time
All patients and one-half of the healthy control subjects expressed DR15
and/or DR4 HLA class II alleles, with which the disease is strongly associated
(17). Three patients were
prospectively monitored for up to 1 yr. Cell isolation and enrichment from
blood samples or frozen PBMC were successfully performed in all cases. After
cell purification, flow cytometry demonstrated that CD4+ cells
represented 88 to 95% of all CD3+ cells. APC were enriched such
that the majority of the cells were positive for DR antigens, with <10% of
cells staining for CD3 (Figure
3).
|
The frequencies of T cells proliferating in response to CS-GBM, recombinant
3(IV)NC1, tetanus toxoid, and autologous APC alone were calculated (as
summarized in Table 2). The
frequencies for CS-GBM varied from 1:10,000 to 1:123,000 and those for
recombinant
3(IV)NC1 varied from 1:6289 to 1:65,359 during acute
disease. However, the AMLR also varied considerably in both control subjects
and patients (from 1:8475 to 1:79,000 and from 1:9346 to 1:159,000,
respectively). Therefore, to enable more meaningful comparisons between assays
and among individuals, an antigen-specific frequency/AMLR frequency ratio was
calculated and termed the frequency index
(Figure 4). All samples tested
exhibited a measurable AMLR, and there was no significant difference in the
AMLR between patients and control subjects. Not all patients exhibited a
measurable frequency for tetanus toxoid, whereas all control subjects did. For
patients, the CS-GBM frequency index varied from 1.26 to 3.96. There was a
similar CS-GBM frequency index range for control subjects. There was, however,
a significant difference between patients during their acute disease period
and control subjects with respect to the frequency index for
3(IV)NC1-specific CD4+ T cells (P < 0.05,
Mann-Whitney U test). All patients tested with
3(IV)NC1
exhibited a frequency index of >1, whereas the control subjects did
not.
|
|
For the patients who were tested during the acute disease phase and during
convalescence, up to 12 mo later (patients 1 and 3), there were decreases in
the frequency indices for both CS-GBM and
3(IV)NC1. The frequency index
for tetanus toxoid for patient 1 increased during the same period. For one of
the convalescent patients (patient 5), the frequency for CS-GBM was low but
the frequency for
3(IV)NC1 was elevated, despite the fact that the
patient was disease-free and without circulating anti-GBM antibodies. Patients
who had experienced disease >10 yr earlier (patients 6, 7, and 8) exhibited
no detectable frequencies for CS-GBM or
3(IV)NC1. Comparison of
3(IV)NC1-specific frequency indices at different disease time points
demonstrated a trend for reduction in
3(IV)NC1-specific T-cell
frequencies with time (Figure
5). These differences did not reach statistical significance,
however, because of the small numbers of patients evaluated at each time
point.
|
| Discussion |
|---|
|
|
|---|
3(IV)NC1 were
detected in patients at the time of acute Goodpasture's disease. Second, the
frequencies of autoreactive T cells steadily decreased with time. Third,
expression of
3(IV)NC1 was clearly detectable, by immunocytochemical
and PCR analyses, in the normal human thymus.
The autoantigen specificity of B cells in this disease is well established
and is highly conserved among patients
(4,23).
In contrast, definition of the antigen specificity of autoreactive T cells has
been elusive. This has led to uncertainty regarding whether the determinants
recognized by T cells are derived from the
3(IV)NC1 domain or whether
they are located on another protein that is internalized with
3(IV)NC1
by antigen-specific B cells. The results described here suggest that this
molecule is a relevant autoantigen in Goodpasture's disease. Clearly, these
findings do not exclude the possibility of there being T-cell epitopes in
other elements of the GBM. However, the demonstration of increased frequencies
of T cells that are reactive with this molecule justifies further
investigation of how the antigen is processed and presented, particularly by
the DR alleles that are associated with disease susceptibility.
Although significantly increased frequencies for
3(IV)NC1 were
detected during acute disease, in comparison with control values, the absolute
frequencies were low. Similar frequencies have been reported for autoreactive
T cells in other autoimmune diseases
(29). These frequencies can be
contrasted with the frequencies measured after immunization against typical
exogenous antigens, such as tetanus toxoid, which usually range from 1:1000 to
10,000 (30). There are several
possible explanations for the small numbers of T cells detectable in
peripheral blood. One possibility is that most of the autoreactive T cells are
sequestered in the diseased organs and the draining lymph nodes. This
possibility is difficult to address in patients. However, in mouse models of
allograft rejection, it seems that reactivity in circulating T cells reflects
events in the graft itself
(31,32).
A second possibility, which is favored by our data, is that most autoantigen-specific T cells are deleted in the thymus. It was recently demonstrated that a number of autoantigens are expressed in the thymus, and it is becoming clear that the thymus may present a vast array of self-proteins, including those that are sequestered or have limited tissue distribution (21,33,34,35). Levels of expression of these autoantigens were recently demonstrated to be inversely correlated with a predisposition to develop autoimmune diseases (33,36,37). Therefore, susceptibility to autoimmunity may be partly related to a capacity to centrally delete autoreactive T cells (38,39), and this capacity may be related to the level of thymic autoantigen expression. Despite the process of negative selection, there is evidence that, in certain autoimmune diseases, self-reactive T cells escape thymic deletion through low-avidity interactions with thymic cells expressing the autoantigen (22).
We have demonstrated, at the mRNA and protein levels, that the autoantigen is expressed in the thymus, specifically in thymic epithelial cells. These cells are known to be important in antigen presentation to developing thymocytes during negative selection (28). Therefore, an antigen with such distribution would be expected to be shed or packaged (in exosomes) and taken up by neighboring cells to be processed and presented in association with class II MHC on the cell surface. This process would enable central deletion of high-avidity autoreactive T cells during development of the immune repertoire (40,41). We have not been able to compare the levels of thymic GA expression in patients and control subjects, and there remains the possibility that patients may be deficient in this expression and may thus fail to delete autoreactive T cells.
The T-cell frequencies for CS-GBM, which contains many different potential
antigens, were the same for patients and control subjects. This finding is
reminiscent of the data from proliferation assays that we reported previously;
proliferation in response to affinity-purified GBM preparations was observed
in 50% of healthy control subjects
(19). It is also in keeping
with other reports of autoreactive cells in healthy individuals
(42). However, there was a
significantly increased frequency of T cells reactive with the specific
autoantigen
3 (IV) NC1 in patients at presentation, compared with
control subjects. The reduction in
3(IV)NC1-specific T-cell frequencies
among patients with time is not simply attributable to concurrent
immunosuppressive treatment, because the highest T-cell frequencies were
observed for patients undergoing heavy immunosuppressive regimens and lower
frequencies were observed for patients receiving minimal or no
immunosuppressive therapy and control subjects. Furthermore, for patient 1,
the frequency index for tetanus toxoid was markedly elevated during
convalescence, compared with presentation, whereas the frequency index for
3(IV)NC1 decreased during the same period. Finally, the T-cell
frequencies for recombinant
3(IV)NC1 are not simply related to the
expression system used to generate the antigen, because others have
demonstrated that it is only the specific
3 (and
4) chains
generated in such an expression system that are capable of inducing disease in
experimental models
(43,44,45).
Furthermore, control subjects exhibited no detectable frequencies for
recombinant
3(IV)NC1.
When these data are considered together, it seems that, despite the
presence of the GA in the thymus, autoreactive T cells do escape thymic
deletion in patients and are observed at increased frequency during periods of
active disease. With time, these cells decrease in number, possibly as a
result of regulation or deletion
(39). This may in part explain
the lack of disease recurrence and the decrease in antibody levels with time.
Interestingly, our patients all received immunosuppressive therapy, which may
have been sufficient to regulate T-cell autoreactivity. Disease recurrence has
been observed, albeit rarely
(5,46).
It is tempting to speculate that, for these patients experiencing relapses,
there was poor long-term regulation of autoreactive T cells and thus, after
immunosuppressant withdrawal or because of other triggers, disease recurred.
One such patient, who had successfully undergone transplantation, experienced
relapse only after withdrawal of immunosuppressive therapy
(46). Another patient
experienced relapse when his immunosuppressive therapy was reduced in
association with continued smoking
(5). Indeed, for one of our
current patients (patient 5), the frequency of
3(IV)NC1-autoreactive T
cells has remained high 1 yr after presentation, despite the fact that the
patient is free of disease, with undetectable autoantibody levels. Longer
follow-up periods will allow us to monitor whether the patient experiences
relapse or exhibits a decrease in the frequency of autoreactive T cells.
Further investigations into the mechanisms underlying the loss of regulation
of
3(IV)NC1-specific autoreactive T cells, their epitope specificity,
and the basis of HLA-DR-linked disease susceptibility are required before the
pathogenesis of this disease is sufficiently well understood for the design of
antigen-specific immunotherapy.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
3 chain of type IV
collagen. Am J Hum Genet 49:545
-554, 1991[Medline]
3 chain of type IV collagen. J Clin Invest89
: 592-601,1992
3 type IV
collagen. Kidney Int 49:1127
-1133, 1996[Medline]
-chains
of type IV collagen demonstrate that the amino terminal of the Goodpasture
autoantigen is crucial for antibody recognition. Clin Exp
Immunol 113:17
-27, 1998[Medline]
3(IV)NC1 and
4(IV)NC1 of type IV collagen. Kidney Int53
: 664-671,1998[Medline]
3(IV)NC1 and its use in induction
of experimental autoimmune glomerulonephritis. Nephrol Dial
Transplant 16:253
-263, 2001This article has been cited by other articles:
![]() |
Y. Zhang, S. C. Su, D. B. Hecox, G. F. Brady, K. M. Mackin, A. G. Clark, and M. H. Foster Central Tolerance Regulates B Cells Reactive with Goodpasture Antigen {alpha}3(IV)NC1 Collagen J. Immunol., November 1, 2008; 181(9): 6092 - 6100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zou, L. Henderson, V. Thomas, P. Swan, A. N. Turner, and Richard. G. Phelps Presentation of the Goodpasture Autoantigen Requires Proteolytic Unlocking Steps That Destroy Prominent T Cell Epitopes J. Am. Soc. Nephrol., March 1, 2007; 18(3): 771 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Reynolds, A. Albouainain, M. A. Duda, D. J. Evans, and C. D. Pusey Strain susceptibility to active induction and passive transfer of experimental autoimmune glomerulonephritis in the rat Nephrol. Dial. Transplant., December 1, 2006; 21(12): 3398 - 3408. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Tipping and S. R. Holdsworth T Cells in Crescentic Glomerulonephritis J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1253 - 1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-B. Borza, O. Bondar, S. Colon, P. Todd, Y. Sado, E. G. Neilson, and B. G. Hudson Goodpasture Autoantibodies Unmask Cryptic Epitopes by Selectively Dissociating Autoantigen Complexes Lacking Structural Reinforcement: NOVEL MECHANISMS FOR IMMUNE PRIVILEGE AND AUTOIMMUNE PATHOGENESIS J. Biol. Chem., July 22, 2005; 280(29): 27147 - 27154. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Cairns, R. G. Phelps, L. Bowie, A. M. Hall, W. W.M. Saweirs, A. J. Rees, and R. N. Barker The Fine Specificity and Cytokine Profile of T-Helper Cells Responsive to the {alpha}3 Chain of Type IV Collagen in Goodpasture's Disease J. Am. Soc. Nephrol., November 1, 2003; 14(11): 2801 - 2812. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Salama and J. B. Levy Tolerance and Autoimmunity in Anti-GBM Disease J. Am. Soc. Nephrol., November 1, 2003; 14(11): 2988 - 2989. [Full Text] [PDF] |
||||
![]() |
B. G. Hudson, K. Tryggvason, M. Sundaramoorthy, and E. G. Neilson Alport's Syndrome, Goodpasture's Syndrome, and Type IV Collagen N. Engl. J. Med., June 19, 2003; 348(25): 2543 - 2556. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |