 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*Inserm U 423, Université René Descartes, Hôpital Necker-Enfants Malades, Paris, France; Service de Néphrologie, Hôpital Necker, Paris, France.
Correspondence to Dr. Corinne Antignac, INSERM U423- Tour Lavoisier 6eme étage, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France. Phone: 33-1-44-49-50-98; Fax: 33-1-44-49-02-90; E-mail: antignac{at}necker.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3, 4, and 5(IV). For this reason, the kidney disease associated with MTCP is usually described as an Alport-like nephropathy. However, GBM alterations in Fechtner and Epstein syndromes have mostly a focal distribution and, except in rare cases (5), are not specific to Alport syndrome. Recently, the May-Hegglin anomaly and Sebastian and Fechtner syndromes have been shown to be genetically linked to the same locus at 22q12.3-13.1 (6–8), which suggests that these three dominant MTCP were allelic. Indeed, mutations in the MYH9 gene, which encodes the nonmuscle myosin heavy chain IIA, were subsequently identified in patients affected with these diseases (9–11). Epstein syndrome was shown to be genetically linked to 22q11-13 as well (12), but no mutations have been reported in this syndrome so far.
MYH9 encodes a nonmuscle myosin II heavy chain, chain IIA. Myosins II (or conventional myosins) are hexameric two-headed motor proteins composed of two heavy chains and two pairs of light chains. Each heavy chain contains a motor domain (or head) that interacts with actin and binds ATP and a two-helix coiled-coil-forming sequence that homodimerizes to form a long rod (or tail). Multiple myosin II molecules associate through their tail domain to form bipolar filaments (13). In nonmigrating cells in vertebrates, nonmuscle myosins II are mainly expressed in the cell cortex and in stress fibers (13). Vertebrates have two nonmuscle myosin heavy chains, IIA and IIB, that are encoded by two distinct genes, MYH9 and MYH10, respectively (14). Most cells express both isoforms, with a few exceptions, such as platelets, which only express nonmuscle myosin IIA (12). Kidney contains relatively large amounts of both mRNAs (14). However, little is known about the cellular expression of nonmuscle myosins within the kidney and their potential function. As a first step in the understanding of the nephropathy associated with MTCP, we studied MYH9 expression in the human kidney and screened 12 families affected with MTCP and progressive nephropathy for MYH9 mutations.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Methods
Riboprobes Transcription and In Situ Hybridization.
Two MYH9 cDNA fragments were amplified by reverse transcriptase-PCR that used human mature kidney total RNA and subcloned into PGMT-easy II (Promega, Charbonnières, France). Reverse transcriptase was performed as in reference (15. The primers used for PCR were 5'CCATGTGGAGCTGGTGGAGA3' and 5'AGCGGTATTTGTTGTACGGCTC 3' for probe 1, which covered nucleotides 181 to 1013 (14) and included exons 1 to 7 and part of exon 8; and 5' CAAAGGAGCCCTGGCGTTAGAG 3' and 5' CCCCATCCGCTTTGCCATCTAC 3' for probe 2, which covered nucleotides 3007 to 3722 (16) and included exons 35 to 40. Restriction enzymes for linearization and RNA polymerases used for in vitro transcription were as follows: probe 1 antisense, NcoI/Sp6 RNA polymerase; probe 1 sense, SalI/T7 RNA polymerase; probe 2 antisense, NsiI/T7 RNA polymerase; and probe 2 sense, SacII/Sp6 RNA polymerase. Labeled RNA probes were synthesized with 35S-UTP (Amersham, Brauschweig, UK) or with digoxigenin-11-UTP (Roche, Meylan, France), according to the manufacturer’s instructions. In situ hybridization was carried out as described elsewhere (17,18). Antisense and sense strands were synthesized for all riboprobes.
Immunohistology
Antibodies.
Immunofluorescence labeling was performed with the use of rabbit polyclonal antibodies against human platelet myosin, diluted to 1/10. These antibodies, from Biomedical Technologies (Stoughton, MA), recognize the nonmuscle myosin heavy chain IIA and are not reactive with any other protein (19). For double labeling, the following antibodies were used: monoclonal antibodies M3F7, which recognizes the type IV collagen [1(IV)2,2(IV)], extracted from human placenta (Developmental Hybridoma Bank, the University of Iowa, Iowa City, IA); MAB5 against the NC1 domain of the 5 chain of type IV collagen (Wieslab, Lund, Sweden); or G1D4 against synaptopodin (Progen Biotechnik GMBH, Heidelberg, Germany). Cyanin2 or fluorescein isothiocyanate-conjugated AffiniPure goat or donkey anti-rabbit IgG (H+L) and cyanin3-conjugated affiniPure donkey anti-mouse IgG (H+L) antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA).
Immunofluorescence.
Immunofluorescence labeling was performed on 3-µm-thick cryostat sections fixed in acetone for 10 min and incubated for 20 min with 10% normal goat serum, 1% bovine serum albumin in PBS-Tween (0.01 M PBS containing 0.1% Tween-20) for blocking nonspecific binding. After incubation for 1 h at room temperature in a moist chamber with primary antibodies diluted in the same buffer, sections were rinsed three times in PBS and incubated for 30 min with fluorescein isothiocyanate-conjugated anti-rabbit antibodies diluted 1/200 in PBS. A mounting medium that contained polyvinyl alcohol, glycerol, and tris buffer (Fluoprep, BioMerieux, Lyon, France) was used to delay fluorescence quenching. Labeling was examined with an orthoplan microscope equipped for light, fluorescence, and phase-contrast microscopy (Leica Microscopic Systems, Heezbrugg, Switzerland). Phase-contrast microscopy allows the visualization of cell structure.
For dual labeling, the slides were simultaneously incubated with rabbit anti-myosin and mouse anti-[1(IV)2,2(IV)] collagen, anti-5(IV) collagen, or anti-synaptopodin antibodies as described elsewhere (20). Sections to be stained with anti-5(IV) antibodies were pretreated with 0.1 mM glycine and 6 mM urea (pH 3.5) for 10 min, then rinsed in distilled water for 5 min. Then, after they were washed with PBS, tissue sections were simultaneously incubated with Cy2-conjugated goat anti-rabbit IgG and Cy3-conjugated donkey anti-mouse IgG. They were examined with an orthoplan microscope (Leica Microscopic Systems) equipped with appropriate filters and with a Zeiss confocal microscope (Carl Zeiss Microscopy, Jena, Germany). Tissue sections directly incubated with the secondary antibodies or serially incubated with normal rabbit or mouse serum instead of the primary antibodies, followed by incubation with the corresponding secondary antibodies, served as controls.
Mutation Detection by Single-Strand Conformation Polymorphism Analysis and Direct Sequencing and Mutation Analysis
DNA was extracted by use of standard procedures, and PCR was performed with 50 ng of genomic DNA. The 40 MYH9 coding exons were amplified by use of flanking intronic primers selected with the OLIGO 5.1 program (National Bioscience, Inc., Plymouth, MN). Oligonucleotide sequences and location, as well as PCR conditions and PCR product sizes, are summarized in Table 1. Large exons were amplified into two fragments. PCR products were screened by single-strand conformation polymorphism (SSCP) analysis as in reference (21 by use of Genephor electrophoresis unit and silver staining (Amersham Pharmacia Biotech, Orsay, France). Sequence variation, which gave rise to mobility shift, was determined by direct automated sequencing (Applied Biosystems). Mutation mapping onto the chicken smooth-muscle heavy-chain crystal structure backbone (22) was performed by use of the Swiss-Pdb (23) and Rasmol (24) programs.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
1(IV)2,2(IV)] collagen molecule (Figure 3A), the 5 chain of type IV collagen (Figure 3B), or synaptopodin (Figure 3, D and E). Within the glomerulus, MHY9 was widely expressed (Figure 3C). Strong labeling was observed within cells regarded as podocytes because of their location at the periphery of the glomerular tuft on the outer face of the GBM labeled with anti-type IV collagen antibodies (Figure 3A). It was colocalized with that of synaptopodin in the podocyte foot processes, as evidenced by the orange color seen on double immunolabeling (Figure 3E). In addition, it was also detected in the podocyte body, at distance from the GBM and synaptopodin labelings. Glomerular endocapillary cells also stained for MYH9 antibodies (Figure 3A).
|
|
helices. DNA was available for patients II-1 and III-1, who both carried the heterozygous mutation. This G
A mutation at position 4270 was not found in 48 control chromosomes.
|
A mutation observed at position 5521 of the coding region of the cDNA in family 2, which predicts a change from glutamic acid to lysine at amino acid 1841, has already been reported in seven unrelated families with MTCP (9,10). It affects a conserved acidic residue in the rod repeat 37 of the -helical coiled-coil domain. This residue is conserved in the majority of myosins. In four smooth-muscle myosins as well as in drosophila nonmuscle myosin II, another negatively charged hydrophilic amino acid (an aspartic acid) fits that position (Figure 4). In family 2, patients II-3 and III-2 carried the mutation, whereas DNA from the mother of III-2 was not mutated. DNA from patients II-1, II-2, and III-1 were not available. This mutation was not found in 48 control chromosomes.
Family 5 carried an R1165L mutation due to a GT transition at position 3494 in the cDNA. A missense mutation affecting the same arginine (R1165C) was reported elsewhere in a family with Sebastian syndrome (9). This arginine is highly conserved in the coiled-coil domain of nonmuscle and muscle myosins (Figure 4). Its substitution by a leucine would change a positively charged residue with a neutral amino acid within the coiled-coil domain, probably resulting in modification of polar interactions. We were not able to study the segregation of the mutation in that family, because DNA was available only for patient III-3. This mutation was not found in 48 control chromosomes.
We found the CT mutation in exon 1 at position 287 of the cDNA (Figure 5), predicting a change from serine to leucine at amino acid 96 (S96L), in two families (families 3 and 4) that originated from South America and France, respectively. In family 4, patient III-1 and her mother, II-5, carried the mutation, whereas neither of the mother’s brothers nor her parents carried this mutation. In family 3, the unaffected parents of individual II-2 did not carry the mutation. This mutation occurred in a CpG pair, which suggests that its recurrence in families that originate from different parts of the world is due to methylation-mediated deamination. In addition, this mutation is a de novo mutation in both individual II-2 in family 3 and in individual II-5 in family 4, which rules out the possibility of a founder effect responsible for the occurrence of the same mutation in these two families. This mutation occurs in the globular head of the myosin heavy chain, downstream from the SH3 domain. The serine at position 96 is located at the extremity of the 96 to 107 helix (which correspondes to 99 to 110 in Gallus gallus smooth-muscle myosin [(22]). As shown in Figure 4, this amino acid is conserved in nonmuscle and smooth muscle myosins in all species. In human skeletal and cardiac myosins, either a glycine or an alanine fits that position. These two amino acids are also quite small. Figure 6 shows a space-filling representation of the region with any of the three amino acids from the wild-type myosins (Figure 6, A through C) or with the leucine substitution (Figure 6D). The bulkier side chain of leucine may be predicted to collide with cysteine 91 and, in doing so, to disturb the organization of the region. Furthermore, the leucine substitution results in the loss of the hydrogen bound normally linking S96 to N93 (not shown). This mutation was not found in 48 control chromosomes. Surprisingly, another mutation located in exon 30, which substitutes an arginine to a tryptophan in the coiled-coil domain (R1400W), was found in individuals II-2 and I-1 in family 3. This mutation was not found in 140 control chromosomes.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we studied MYH9 expression in human kidney by in situ hybridization and immunohistology. We found that MYH9 is expressed in both fetal and mature renal tissues. During development, it is mainly expressed in the lower part of the late S-shaped body, in both the endothelial cells and the future podocytes. Later, MYH9 is widely expressed in the kidney, mainly in glomeruli and arteriolar and peritubular capillary endothelial cells. Within the glomerulus, MHY9 mRNA and protein are mostly expressed by the podocyte cells, although endocapillary cells show some level of expression. It has been shown elsewhere (27) by immunoelectron microscopy that, within the podocyte, "platelet myosin" was colocalized with actin and -actinin. They are mainly located in the foot processes but are also present in a continuous narrow layer located underneath the entire plasma membrane. Taken together, these data suggest that, in the kidney, nonmuscle heavy chain IIA is a major component of the actin-myosin contractile apparatus in the podocyte foot process. It could play a role in maintaining capillary wall integrity against hydraulic pressure in physiological conditions and/or contribute to the foot process retraction in pathological conditions. This expression in glomerular epithelial cells is in agreement with the clinical and pathological features observed in Fechtner nephropathy.
Ultrastructural alterations of the GBM close to those observed in Alport syndrome have been reported in some patients (5). It will be interesting to study whether basement membrane proteins that are normally synthesized by the glomerular epithelial cells are downregulated in these patients. However, the expression of the 3, 4, and 5 chains of type IV collagen in the GBM was shown to be normal in some patients affected with nephropathy and MTCP (28).
Because mutations in MYH9 were found in different syndromes with MTCP and leukocyte inclusions, with or without associated kidney disease, we looked for mutations in this gene in families with progressive nephropathy associated with MTCP, regardless of the presence of polynuclear inclusions. Indeed, many patients were not examined for leukocyte morphology. In addition, the characterization of leukocyte inclusions, which is the central point for a correct differentiation between Fechtner and Epstein syndromes, may be missed if only a few cells are screened. Therefore, the distinction between Fechtner and Epstein syndromes may be not definitive. None of the patients had congenital cataracts. Using SSCP, we screened the 40 coding exons of the MYH9 gene in 12 unrelated families, including 3 with Epstein syndrome, as determined by leukocyte morphology that used Giemsa-stained smears. Epstein syndrome was previously shown to be genetically linked to 22q11-13 (12), but no mutations have been reported in this syndrome so far. We found four mutations that are thought to be pathogenic in five families, including two with Epstein syndrome. Three are located in the coiled-coil rod, and one affects the motor domain of the protein.
In families with several affected individuals, the various symptoms (nephritis, deafness, and MTCP) are frequently present in various combinations in different individuals (Figure 1). Such variability in penetrance and expressivity, already reported for many families in the literature, suggests that other genes and/or environmental events might influence the phenotypic expression of the mutation. The D1424N mutation is not always associated with kidney disease in family 1 and has been reported elsewhere in a family with MTCP without renal involvement (11). The E1841K mutation that we found in family 2, in which all affected individuals have kidney disease, has been reported elsewhere in seven families without renal involvement, six with May-Hegglin anomaly, and one with either May-Hegglin or Sebastian syndrome (9,10). In family 5, which carries the R1165L mutation, several patients suffer from isolated MTCP, whereas others show the association of MTCP, deafness, and nephropathy. R1165L affects a codon found elsewhere to be mutated in Sebastian syndrome (R1165C) (9). Finally, the S96L mutation identified in two unrelated families has not been reported before. In one family (family 4), the mother is affected with MTCP, deafness, and nephropathy, whereas her daughter suffers from MTCP and hearing loss but has not developed proteinuria or hematuria at age 6 yr. In family 3, the female affected with the same mutation does not suffer from deafness.
The affected patient in family 3 carries, in addition to the S96L de novo mutation, a R1400W mutation that was inherited from her father, who is not affected with MTCP or nephropathy. We were not able to determine whether these two mutations are located on one or on two different alleles in the patient. We believe that the S96L mutation is pathogenic, because it affects a conserved amino acid, it is predicted to perturb the helical region, and it segregates with the disease in family 4. Conversely, the arginine at position 1400 is less conserved, and its substitution is not responsible for any phenotype in the father in family 3. However, the R1400W was not found in 140 control chromosomes. Thus, we cannot rule out a pathogenic role for that variant that would not be expressed in the father. In addition it might influence the phenotypic expression of the S96L mutation. More generally, polymorphisms or rare variants in MYH9 itself or within other genes interacting with MYH9 might play a role in the renal expressivity of MYH9 mutations. Whether MYH9 variants might play a role in the course of other glomerular nephropathies remains another open question.
We did not find any mutation in MYH9 in seven other families. From a clinical point of view, these families are not distinguishable from the five families that were found to carry a mutation, apart from family 10, in which one affected individual was found to have abnormal liver enzymes and hypercholesterolemia. Elevation of transaminases and alkaline phosphatase with hypercholesterolemia have been reported elsewhere in several members of a family with Fechtner syndrome (29). In that family, the liver defect seemed to be inherited with an incomplete penetrance. The case we report here suggests that liver involvement is part of the Fechtner syndrome and that liver enzymes and cholesterol levels should be investigated in those families.
The mutation rate we report here is lower than that detected for other genes when we used SSCP in our laboratory. It is possible that some mutations have been missed because of the presence of polymorphism (which makes additional band shifts difficult to detect) or because of a large rearrangement, such as a deletion, that would not be detected by SSCP. Another possibility is that the association of MTCP and glomerular nephropathy is a genetically heterogeneous syndrome, although data from linkage analysis (6–8,12) do not favor this hypothesis.
In conclusion, we describe here the wide expression of MYH9 in fetal and mature kidneys and show that nonmuscle myosin heavy chain IIA is mainly expressed in podocytes. We report four MYH9 mutations associated with MTCP and progressive nephropathy. Two are new mutations, and two had been reported elsewhere in families with the May-Hegglin anomaly. Furthermore, we show for the first time that MYH9 mutations are associated with Epstein syndrome. These results, along with recent articles that have shown the involvement of MYH9 in isolated inherited deafness (25), as well as in MTCP with leukocyte abnormalities (9–11), illustrate the broad range of phenotypes associated with MYH9 mutations. It does also demonstrate the variable penetrance and expressivity of the different symptoms within a given family and between families that carry the same mutation. This study will contribute to unraveling a complex classification of diseases including MTCP that until now was based on leukocyte morphology and on the presence or absence of symptoms that are actually due to incomplete penetrance and variable expressivity. The next step is now to characterize the genetic and epigenetic factors implicated in the phenotypic expression of the glomerular disease associated with MYH9 mutations.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. I. Freedman and J. R. Sedor Hypertension-Associated Kidney Disease: Perhaps no More J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2047 - 2051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Pecci, A. Granata, C. E. Fiore, and C. L. Balduini Renin-angiotensin system blockade is effective in reducing proteinuria of patients with progressive nephropathy caused by MYH9 mutations (Fechtner-Epstein syndrome) Nephrol. Dial. Transplant., August 1, 2008; 23(8): 2690 - 2692. [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Nurden and P. Nurden Inherited thrombocytopenias Haematologica, September 1, 2007; 92(9): 1158 - 1164. [Full Text] [PDF]
|
|
|
|
 |
|
 P. K. K. Leong, A. Devillez, M. B. Sandberg, L. E. Yang, D. K. P. Yip, J. B. Klein, and A. A. McDonough Effects of ACE inhibition on proximal tubule sodium transport Am J Physiol Renal Physiol, April 1, 2006; 290(4): F854 - F863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Perry, S. Tam, K. Zheng, Y. Sado, H. Dobson, B. Jefferson, R. Jacobs, and P. S. Thorner Type IV Collagen Induces Podocytic Features in Bone Marrow Stromal Stem Cells In Vitro J. Am. Soc. Nephrol., January 1, 2006; 17(1): 66 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Pecci, I. Canobbio, A. Balduini, L. Stefanini, B. Cisterna, C. Marseglia, P. Noris, A. Savoia, C. L. Balduini, and M. Torti Pathogenetic mechanisms of hematological abnormalities of patients with MYH9 mutations Hum. Mol. Genet., November 1, 2005; 14(21): 3169 - 3178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Deutsch, A. Rideau, M.-L. Bochaton-Piallat, G. Merla, A. Geinoz, G. Gabbiani, T. Schwede, T. Matthes, S. E. Antonarakis, and P. Beris Asp1424Asn MYH9 mutation results in an unstable protein responsible for the phenotypes in May-Hegglin anomaly/Fechtner syndrome Blood, July 15, 2003; 102(2): 529 - 534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-C. Gubler Podocyte Differentiation and Hereditary Proteinuria/Nephrotic Syndromes J. Am. Soc. Nephrol., June 1, 2003; 14(90001): S22 - 26. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Kashtan Animal models of Alport syndrome Nephrol. Dial. Transplant., August 1, 2002; 17(8): 1359 - 1362. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
; Nephropathy: 
; Hearing loss: 
; Leukocyte inclusions: 
. For individuals having reached end-stage renal failure (ESRF), the age at ESRF is indicated below the pedigree symbols.
