Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
J Am Soc Nephrol 13:80-85, 2002
© 2002 American Society of Nephrology

Association of a Sodium Channel {alpha} Subunit Promoter Variant with Blood Pressure

Naoharu Iwai*{dagger}, Shunroku Baba{ddagger}, Toshifumi Mannami{ddagger}, Toshio Ogihara§ and Jun Ogata{ddagger}

* Research Institute, {dagger}Department of Hypertension and Nephrology, {ddagger}Department of Preventive Medicine, National Cardiovascular Center, Osaka, Japan, §Department of Geriatric Medicine, Osaka University School of Medicine, Osaka, Japan.

Correspondence to Dr. Naoharu Iwai, Research Institute, National Cardiovascular Center, 5-7-1 Fujishirodai, Suita-city, Osaka 565-8565, Japan. Phone: +81-6-6833-5012, ext. 2630; Fax: +81-6-6872-8090; E-mail: niwai{at}res.ncvc go.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. The SCNNIA gene, which is located on human chromosome 12p13.3, encodes the {alpha} subunit of the amiloride-sensitive epithelial sodium channel, and mutations in SCNNIA can result in pseudohypoaldosteronism type I. It was postulated that genetic variations in SCNN1A could lead to an increased risk of hypertension. Sequence variations in SCNN1A were identified, and the association between these polymorphisms and BP was examined in a large cohort (n = 3898) representing the general population in Japan. Four polymorphisms in the promoter region, three polymorphisms in the exonic region, and one polymorphism in the first intron were identified. Because association studies with one-half of the study population indicated that the A(2139)G polymorphism, among others, significantly affected BP, this polymorphism was studied in the entire study population. Multiple logistic analyses indicated that the odds ratio for hypertension with the GA+GG genotype was 1.31 (P = 0.0154) in the total population and 1.77 (P = 0.0035) among subjects <60 yr of age. A significantly higher frequency of proteinuria was also observed among subjects with the GA+GG genotype. A transient transfection assay using MDCK cells indicated that the promoter activity of the G(2139) allele was higher than that of the A(2139) allele. Therefore, possession of the SCNN1A G(2139) allele significantly increased the risk of hypertension. A lower level of SCNN1A subunit expression among subjects with the AA genotype might lead to lower levels of sodium reabsorption in the kidney and might provide protection against the development of hypertension.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The amiloride-sensitive epithelial sodium channel is composed of three subunits, {alpha}, ß, and {gamma}, with similar structures (1). The {alpha} subunit supports sodium conductance when expressed alone, whereas the ß and {gamma} subunits, which by themselves do not support sodium conductance, greatly enhance channel activity when expressed in conjunction with the {alpha} subunit (2). The {alpha} subunit gene (SCNN1A) is located on human chromosome 12p13, between the tumor necrosis factor receptor (member 1A) and lymphotoxin ß receptor (member 3) genes (3). Mutations in SCNNIA can result in pseudohypoaldosteronism type I (4). Therefore, SCNN1A is a candidate gene for human essential hypertension. To assess the significance of this gene in human essential hypertension, we screened for sequence variations in SCNNIA and conducted an association study, using these polymorphisms, in a large cohort (3989 subjects) representing the general Japanese population.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects
The selection criteria and design of the Suita study were previously described (5). The sample consisted of 14,200 men and women (30 to 79 yr of age), stratified by gender and 10-yr age groups, who had been randomly selected from the municipal population registry. They were all invited, by letter, to attend regular cycles of follow-up examinations (every 2 yr). DNA from leukocytes was collected from participants who visited the National Cardiovascular Center between May 1996 and February 1998. All of the participants were Japanese, and only those who gave their written informed consent for genetic analyses of the amiloride-sensitive sodium channel genes were included in this study. In this study, the genotypes of 3989 samples were determined.

BP was measured after at least 10 min of rest in a sitting position. Systolic and diastolic BP values were the means of two physician-obtained measurements (recorded >3 min apart). Urinalyses were performed with test strips. The detection limit for urinary protein was 30 mg/dl.

Hypertension was defined as systolic BP of >=140 mmHg, diastolic BP of >=90 mmHg, or the current use of antihypertensive medication. Diabetes mellitus was defined as fasting blood glucose levels of >=140 mg/dl or the current use of hypoglycemic medication.

DNA Studies
Genomic DNA samples from 24 subjects with hypertension and eight subjects without hypertension were used as templates in PCR. The promoter and exon regions of SCNN1A were amplified by using the primers listed in Table 1.


View this table:
[in this window]
[in a new window]

 
Table 1. Primers for sequence screening
 
The PCR products were gel-purified and directly sequenced, using automated protocols for the fluorescence detection of dideoxy-termination products, with a model ABI 3700 genetic analyzer (PE Applied Biosystems, Foster City, CA). The polymorphisms were genotyped by using a TaqMan system (PE Applied Biosystems); 10 ng of sample DNA were amplified by PCR according to the recommendations of the manufacturer. PCR primers and probes are presented in Table 2.


View this table:
[in this window]
[in a new window]

 
Table 2. TaqMan analyses of SCNN1A variations
 

View this table:
[in this window]
[in a new window]

 
Table 3. Polymorphisms in SCNN1Aa
 
Reporter Assay
To explore the regulatory effects of G(2139)A and G(3091)A polymorphisms in the promoter region of SCNN1A, we constructed SCNN1A gene promoter/luciferase fusion genes. The promoter region was amplified with the following primers: sense, catgagtctgtctcaggaagtaaatgg (positions 1168 to 1254; accession number AF060910); antisense, ctgacaggtgcagcggcctggctg (positions 3129 to 3106; GenBank accession number AF060910).

The polymorphisms in this region were G(2139)A, G(2765)C, and G(3091)A. The G2139 allele completely corresponded to the G2765 allele. The haplotypes examined were G/G, G/A, A/G, and A/A, as determined by the G(2139)A and G(3091)A genotypes. The PCR products were purified, blunt-ended, and ligated to the SmaI-digested luciferase reporter vector pGL2-Basic (Promega, Madison, WI), which does not contain any promoter sequence or enhancer. The sequences of the recombinant genes with different alleles were confirmed by sequencing.

Transfection with the SCNN1A gene promoter/luciferase fusion genes was performed with LipofectAmine Plus reagent, according to the recommendations of the manufacturer. DNA-LipofectAmine (Gibco BQL, Gaithersburg, MD) complex was mixed with cells in OptiMEM (GibcoBRL) medium without serum, and the transfection medium was replaced with culture medium 3 h later. MDCK cells were cultured in {alpha}-minimal essential medium with 10% fetal bovine serum. PRL-CMV vector (Promega), in which Renilla luciferase is under the control of the cytomegalovirus promoter, was included in the transfection mixture as an internal standard. Dexamethasone (100 nM) was added to the medium 6 h before collection. Cells were collected 30 h after transfection. Photinus and Renilla luciferase activities were measured using a kit (PG-DUAL-SP; Toyo Ink, Co., Tokyo, Japan), according to the recommendations of the manufacturer. Photinus luciferase activity, which indicated the promoter activity of the SCNN1A gene, was divided by Renilla luciferase activity and expressed as relative luciferase units.

Statistical Analyses
Values are expressed as mean ± SEM. All statistical analyses were performed by using the JMP statistical software package (SAS Institute Inc., Cary, NC). Multiple logistic analyses were performed with other covariates [gender, age, body mass index (BMI), and alcohol consumption]. BP value residuals were calculated by adjusting for age and BMI. Residuals represent the difference between the actual BP value for each observation and the value predicted on the basis of age and BMI. Differences in numerical data among the groups were analyzed by using ANOVA. Differences in frequency among the groups were tested by using a contingency table analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of Genetic Variants
The genetic variants observed in this study are summarized in Table 3. We observed four polymorphisms in the promoter region. The G2139 allele completely corresponded to the G2765 allele in the 32 cases sequenced. The G(2139)A polymorphism was in tight-linkage disequilibrium with the G(3091)A polymorphism. The G(3091)A polymorphism in exon 1 is in the 5' noncoding region of the mRNA. The G(3134)C polymorphism in intron 1 is 5 bp distal to the exon 1 splice donor site. The polymorphisms in exons 6 and 13 are both associated with amino acid changes. The linkage disequilibrium between the variations is summarized in Table 4. Only one polymorphism (in intron 3) has been reported in the single nucleotide polymorphism database of the National Center for Biotechnology Information, which does not include any of the polymorphisms presented here.


View this table:
[in this window]
[in a new window]

 
Table 4. Linkage disequilibrium between the variationsa
 
Association Study
Multiple logistic analyses of data for 1609 to 2061 subjects (depending on the genotype), in which BMI, age, and alcohol consumption were included as independent variables, indicated that the G(1144)A, G(3134)C, G(1193)A, and G(1529)A polymorphisms had no significant effects on BP status (hypertension or not) (data not shown). In these preliminary analyses, the G(2139)A and G(3091)A polymorphisms significantly affected BP. Considering the results of the promoter reporter assay presented below, we speculated that the association between BP status and the G(3091)A polymorphism was probably attributable to the tight-linkage disequilibrium between the G(2139)A and G(3091)A polymorphisms. Therefore, we determined the G(2139)A polymorphism for all of the subjects in the study population. Table 5 presents clinical characteristics according to G(2139)A genotype.


View this table:
[in this window]
[in a new window]

 
Table 5. Characteristics of the total study populationa
 
BP value residuals were calculated by adjusting for age and BMI. The G(2139)A polymorphism significantly affected systolic BP (residuals of systolic BP, P = 0.0127). The BP values presented in Table 5 include those for subjects receiving antihypertensive treatment. Therefore, we analyzed the effects of the genotype on BP status in multiple logistic analyses. Hypertension was defined as systolic BP of >=140 mmHg, diastolic BP of >=90 mmHg, or the current use of antihypertensive medication. Multiple logistic analyses in which age, BMI, alcohol consumption, and the genotype of the G(2139)A polymorphism (AA = 1, GA+GG = 2) were included as independent variables indicated that the GA+GG genotype was a risk factor for hypertension (odds ratio, 1.32; 95% confidence interval, 1.06 to 1.65; P = 0.0157). Remarkably, a strong association was observed between this polymorphism and proteinuria (Table 5). It is generally accepted that genetic effects are more evident among younger subjects, whereas the phenotypes of older subjects are more strongly influenced by environmental factors. Therefore, we analyzed the effects of genotype on BP status among younger subjects.

As demonstrated in Table 6, the effect of the G(2139)A polymorphism on BP was more evident among subjects <60 yr of age. Multiple logistic analyses in which age, BMI, alcohol consumption, and the genotype of the G(2139)A polymorphism (AA = 1, GA+GG = 2) were included as independent variables indicated that the GA+GG genotype was a risk factor for hypertension (odds ratio, 1.78; 95% confidence interval, 1.22 to 2.65; P = 0.0035) in this younger subpopulation. In this younger subpopulation, a strong association was also observed between this polymorphism and proteinuria (Table 6). Similarly, the GA+GG genotype was a risk factor for hypertension among subjects <65 yr of age (odds ratio, 1.41; 95% confidence interval, 1.05 to 1.92; P = 0.0251) and among subjects <55 yr of age (odds ratio, 2.15; 95% confidence interval, 1.32 to 3.67; P = 0.0032). Therefore, the effects of this genotype on BP status were more evident in younger subpopulations.


View this table:
[in this window]
[in a new window]

 
Table 6. Characteristics of the study population <60 yr of agea
 
There was a strong association between the G(2139)A polymorphism and proteinuria in this study population. Multiple logistic analyses indicated that the presence of proteinuria could be explained by age (P = 0.0227), the presence of diabetes mellitus (P < 0.0001), serum creatinine levels (P = 0.0016), the presence of hypertension (P < 0.0001), and the G(2139)A polymorphism (AA = 1, GA+GG = 2) (P = 0.0008). The inclusion of the presence of hypertension in the analysis as an independent variable did not reduce the importance of the G(2139)A polymorphism, suggesting that the effects of this genotype on proteinuria are largely independent of its effects on BP.

Functional Significance of the G(2139)A Polymorphism
We examined the functional significance of the G(2139)A and G(3091)A polymorphisms in vitro using MDCK cells (Figure 1). Three-way ANOVA indicated that G(2139)A polymorphism (P < 0.0001) but not the G(3091)A polymorphism affected promoter activity. No significant interaction between the genotypes was observed. Dexamethasone increased the promoter activity of both genotypes (P < 0.0001). A significant interaction was observed between the G(2139)A genotype and the effects of dexamethasone (P < 0.0001), which indicated that the induction of transcription by dexamethasone was more pronounced with the G(2139) allele than with the A(2139) allele. The G(2319) allele was associated with approximately 1.4- and 1.6-fold greater promoter activity, compared with the A(2139) allele, in MDCK cells without and with dexamethasone treatment, respectively. .



View larger version (51K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Assessment of promoter activity. To explore the regulatory effects of the G(2139)A and G(3091)A polymorphisms in the promoter region of SCNN1A, we constructed SCNN1A gene promoter/luciferase fusion genes. The haplotypes determined were G/G, G/A, A/G, and A/A. Transient transfection with the SCNN1A gene promoter/luciferase fusion genes was performed in MDCK cells (n = 6). Photinus luciferase activity, which indicated the promoter activity of the SCNN1G gene, was divided by Renilla luciferase activity and expressed as relative luciferase units. The G(3091)A polymorphism had no significant effect on promoter activity. Dexamethasone (DEX) increased promoter activity (P < 0.0001). The promoter activity of the G(2139) allele was 1.4 and 1.6 times higher than that of the A(2139) allele in MDCK cells (P < 0.0001) without and with dexamethasone, respectively. A significant interaction was observed between the G(2139)A genotype and the effects of dexamethasone (P < 0.0001), which indicated that the induction of transcription by dexamethasone was more pronounced for the G(2139) allele than for the A(2139) allele. CMV, cytomegalovirus.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we observed sequence variations in SCNNIA on chromosome 12p13. We then evaluated the significance of these polymorphisms in BP regulation, using a large cohort consisting of approximately 4000 subjects. The G(2139)A genotype was found to be associated with BP status. The stronger association of this polymorphism with BP status in younger subpopulations strongly supports the concept that this genotype is indeed a risk factor for hypertension.

Reporter analyses of promoter activity suggest that the AA genotype of SCNNIG is associated with lower promoter activity in vivo. The guanine to adenine transition at this site G(2139)A confers a consensus sequence for {delta}EF1, a repressor of E2 box-mediated gene activation (6). However, determination of the precise mechanism by which this variation influences promoter activity awaits further investigation. Lower levels of expression of the SCNN1A subunit may lead to lower levels of sodium reabsorption in the kidney, and this may protect against the development of hypertension. The difference in promoter activity between the two genotypes in vitro was only 1.4-fold under basal conditions and 1.6-fold with dexamethasone treatment. There is presently no evidence to support the concept that this difference is sufficient to account for a significant effect of this genotype on BP. The promoter activity assessed in vitro may not necessarily indicate that in vivo, because our promoter/luciferase construct covered only up to -2 kb from the initiation site. Indeed, Chow et al. (7) reported that up to -6 kb from the initiation site might be necessary for full promoter activity and that intron 1 has a negative regulatory element. Combination with other unidentified variations might affect the promoter activity or expression level. More-thorough sequence screening covering the entire SCNN1A gene, including further upstream and intronic sequences, might be required for determination of the mechanism for the observed association between the SCNN1A genotype and hypertension. Moreover, further study is necessary for assessment of SCNN1A mRNA levels in tubular cells in vivo according to the genotype.

A remarkable association was observed between the presence of proteinuria and the G(2139)A polymorphism. The effects of this genotype on proteinuria seemed to be largely independent of its effects on BP. It has been suggested that salt-sensitive individuals, such as black subjects and those with diabetes mellitus, are more likely to develop renal failure as a consequence of hypertension (8). Glomerular capillary pressure is thought to increase more in response to salt loading in salt-sensitive hypertensive patients, compared with salt-resistant hypertensive patients (9,10). The higher frequency of proteinuria among subjects with the GA and GG genotypes may support the concept that these genotypes are associated with salt sensitivity. The possibility that this genotype might influence the progression of various renal diseases, such as chronic glomerulonephritis and diabetic nephropathy, awaits further investigation.

To our knowledge, this is the first report demonstrating that a common polymorphism of SCNN1A influences BP in the general population. Because the allelic frequency associated with hypertension is high (frequency, 0.66), the effect of this genotype on BP status in the general population is also considered to be high. One of the genes responsible for pseudohypoaldosteronism type II, WNK1, is mapped to the most telomeric 2-cM segment of chromosome 12p and is >5 Mb from SCNN1A (11). Hypertension with brachydactyly has also been mapped to chromosome 12p, but at a site distinct from the SCNN1A locus (12). The genes adjacent to SCNN1A are TNFRSF1A and LTBR, which are merely 30 and 10 kb away, respectively. However, it may be difficult to associate these adjacent genes with the pathogenesis of hypertension, on the basis of our current understanding of these genes. This study strongly suggests that a common polymorphism of SCNN1A is indeed involved in BP regulation. Whether assessment of this polymorphism may help to identify diuretic-responders awaits further investigation.


    Acknowledgments
 
We express our highest gratitude to the following people for the continuous support of our population survey in this area: Dr. Otosaburo Hishikawa, President; Dr. Katsuyuki Kawanishi, committee in chief for the city health check-up service; other members of the Suita City Medical Association; and Mr. Shigeru Kobayashi, Director of the City Health Center. We also express our greatest thanks to the members of our attendants’ society (Satsuki-Junyu-kai) for their cooperation and assistance to our survey of risk factors and preventive activity on cardiovascular diseases. We also express our highest gratitude to Dr. Soichiro Kitamura, President of the National Cardiovascular Center, for considerations to our research work.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Canessa CM, Schild L, Thorens B, Gautschi I, Horisberger JD, Rossier BC: Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature (Lond) 367: 463–467, 1994[CrossRef][Medline]
  2. McDonald FJ, Price MP, Snyder PM, Welsh MJ: Cloning and expression of the ß- and {gamma}-subunits of the human epithelial sodium channel. Am J Physiol 268: C1157–C1163, 1995[Abstract/Free Full Text]
  3. International Human Genome Sequencing Consortium: Initial sequencing and analysis of the human genome. Nature (Lond) 409: 860–921, 2001[CrossRef][Medline]
  4. Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, Lifton RP: Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nat Genet 12: 248–253, 1996[CrossRef][Medline]
  5. Ishikawa K, Baba S, Katsuya T, Iwai N, Asai T, Fukuda M, Takiuchi S, Fu Y, Mannami T, Ogata J, Higaki J, Ogihara T: T+31C polymorphism of angiotensinogen gene and essential hypertension. Hypertension 37: 281–285, 2001[Abstract/Free Full Text]
  6. Sekido R, Murai K, Funahashi J, Kamachi Y, Fujisawa-Sehara A, Nabeshima Y, Kondoh H: The {delta}-crystallin enhancer-binding protein {delta}EF1 is a repressor of E2-box-mediated gene activation. Mol Cell Biol 14: 5692–5700, 1994[Abstract/Free Full Text]
  7. Chow YH, Wang Y, Plumb J, O’Brodovich H, Hu J: Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel subunit gene. Pediatr Res 46: 208–214, 1999[Medline]
  8. Campese VM: Salt sensitivity in hypertension: Renal and cardiovascular implications. Hypertension 23: 531–550, 1994[Abstract/Free Full Text]
  9. Campese VM, Parise M, Karubian F, Bigazzi R: Abnormal renal hemodynamics in black salt-sensitive patients with hypertension. Hypertension 18: 805–812, 1991[Abstract/Free Full Text]
  10. Sanai T, Kimura G: Renal function reserve and salt sensitivity in essential hypertension. J Lab Clin Med 128: 89–97, 1996[CrossRef][Medline]
  11. Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard J-M, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, Lifton RP: Human hypertension caused by mutations in WNK kinases. Science (Washington DC) 293: 1107–1111, 2001[Abstract/Free Full Text]
  12. Scuster H, Wienker TE, Bahring S, Bilginturan N, Toka HR, Neitzel H, Jeschke E, Toka O, Gilbert D, Lowe A, Ott J, Haller H, Luft FC: Severe autosomal dominant hypertension and brachydactyly in a unique Turkish kindred maps to human chromosome 12. Nat Genet 13: 98–100, 1996[CrossRef][Medline]
Received for publication April 27, 2001. Accepted for publication September 11, 2001.




This article has been cited by other articles:


Home page
HypertensionHome page
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart
Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney
Hypertension, October 1, 2005; 46(4): 787 - 798.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Meneton, X. Jeunemaitre, H. E. de Wardener, and G. A. Macgregor
Links Between Dietary Salt Intake, Renal Salt Handling, Blood Pressure, and Cardiovascular Diseases
Physiol Rev, April 1, 2005; 85(2): 679 - 715.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Marissal-Arvy, M. Lombes, J. Petterson, M.-P. Moisan, and P. Mormede
Gain of Function Mutation in the Mineralocorticoid Receptor of the Brown Norway Rat
J. Biol. Chem., September 17, 2004; 279(38): 39232 - 39239.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H. Endoh, S. Tomida, Y. Yatabe, H. Konishi, H. Osada, K. Tajima, H. Kuwano, T. Takahashi, and T. Mitsudomi
Prognostic Model of Pulmonary Adenocarcinoma by Expression Profiling of Eight Genes As Determined by Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction
J. Clin. Oncol., March 1, 2004; 22(5): 811 - 819.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwai, N.
Right arrow Articles by Ogata, J.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP