Association of a Sodium Channel Subunit Promoter Variant with Blood Pressure
Naoharu Iwai*,
Shunroku Baba,
Toshifumi Mannami,
Toshio Ogihara and
Jun Ogata
* Research Institute, Department of Hypertension and Nephrology, Department of Preventive Medicine, National Cardiovascular Center, Osaka, Japan, Department of Geriatric Medicine, Osaka University School of Medicine, Osaka, Japan.
Correspondence to Dr. Naoharu Iwai, Research Institute, National Cardiovascular Center, 5-7-1 Fujishirodai, Suita-city, Osaka 565-8565, Japan. Phone: +81-6-6833-5012, ext. 2630; Fax: +81-6-6872-8090; E-mail: niwai{at}res.ncvc go.jp
ABSTRACT. The SCNNIA gene, which is located on human chromosome12p13.3, encodes the subunit of the amiloride-sensitive epithelialsodium channel, and mutations in SCNNIA can result in pseudohypoaldosteronismtype I. It was postulated that genetic variations in SCNN1Acould lead to an increased risk of hypertension. Sequence variationsin SCNN1A were identified, and the association between thesepolymorphisms and BP was examined in a large cohort (n = 3898)representing the general population in Japan. Four polymorphismsin the promoter region, three polymorphisms in the exonic region,and one polymorphism in the first intron were identified. Becauseassociation studies with one-half of the study population indicatedthat the A(2139)G polymorphism, among others, significantlyaffected BP, this polymorphism was studied in the entire studypopulation. Multiple logistic analyses indicated that the oddsratio for hypertension with the GA+GG genotype was 1.31 (P =0.0154) in the total population and 1.77 (P = 0.0035) amongsubjects <60 yr of age. A significantly higher frequencyof proteinuria was also observed among subjects with the GA+GGgenotype. A transient transfection assay using MDCK cells indicatedthat the promoter activity of the G(2139) allele was higherthan that of the A(2139) allele. Therefore, possession of theSCNN1A G(2139) allele significantly increased the risk of hypertension.A lower level of SCNN1A subunit expression among subjects withthe AA genotype might lead to lower levels of sodium reabsorptionin the kidney and might provide protection against the developmentof hypertension.
The amiloride-sensitive epithelial sodium channel is composedof three subunits, , ß, and , with similar structures(1). The subunit supports sodium conductance when expressedalone, whereas the ß and subunits, which by themselvesdo not support sodium conductance, greatly enhance channel activitywhen expressed in conjunction with the subunit (2). The subunitgene (SCNN1A) is located on human chromosome 12p13, betweenthe tumor necrosis factor receptor (member 1A) and lymphotoxinß receptor (member 3) genes (3). Mutations in SCNNIAcan result in pseudohypoaldosteronism type I (4). Therefore,SCNN1A is a candidate gene for human essential hypertension.To assess the significance of this gene in human essential hypertension,we screened for sequence variations in SCNNIA and conductedan association study, using these polymorphisms, in a largecohort (3989 subjects) representing the general Japanese population.
Subjects
The selection criteria and design of the Suita study were previouslydescribed (5). The sample consisted of 14,200 men and women(30 to 79 yr of age), stratified by gender and 10-yr age groups,who had been randomly selected from the municipal populationregistry. They were all invited, by letter, to attend regularcycles of follow-up examinations (every 2 yr). DNA from leukocyteswas collected from participants who visited the National CardiovascularCenter between May 1996 and February 1998. All of the participantswere Japanese, and only those who gave their written informedconsent for genetic analyses of the amiloride-sensitive sodiumchannel genes were included in this study. In this study, thegenotypes of 3989 samples were determined.
BP was measured after at least 10 min of rest in a sitting position.Systolic and diastolic BP values were the means of two physician-obtainedmeasurements (recorded >3 min apart). Urinalyses were performedwith test strips. The detection limit for urinary protein was30 mg/dl.
Hypertension was defined as systolic BP of 140 mmHg, diastolicBP of 90 mmHg, or the current use of antihypertensive medication.Diabetes mellitus was defined as fasting blood glucose levelsof 140 mg/dl or the current use of hypoglycemic medication.
DNA Studies
Genomic DNA samples from 24 subjects with hypertension and eightsubjects without hypertension were used as templates in PCR.The promoter and exon regions of SCNN1A were amplified by usingthe primers listed in Table 1.
The PCR products were gel-purified and directly sequenced, usingautomated protocols for the fluorescence detection of dideoxy-terminationproducts, with a model ABI 3700 genetic analyzer (PE AppliedBiosystems, Foster City, CA). The polymorphisms were genotypedby using a TaqMan system (PE Applied Biosystems); 10 ng of sampleDNA were amplified by PCR according to the recommendations ofthe manufacturer. PCR primers and probes are presented in Table 2.
Reporter Assay
To explore the regulatory effects of G(2139)A and G(3091)A polymorphismsin the promoter region of SCNN1A, we constructed SCNN1A genepromoter/luciferase fusion genes. The promoter region was amplifiedwith the following primers: sense, catgagtctgtctcaggaagtaaatgg(positions 1168 to 1254; accession number AF060910); antisense,ctgacaggtgcagcggcctggctg (positions 3129 to 3106; GenBank accessionnumber AF060910).
The polymorphisms in this region were G(2139)A, G(2765)C, andG(3091)A. The G2139 allele completely corresponded to the G2765allele. The haplotypes examined were G/G, G/A, A/G, and A/A,as determined by the G(2139)A and G(3091)A genotypes. The PCRproducts were purified, blunt-ended, and ligated to the SmaI-digestedluciferase reporter vector pGL2-Basic (Promega, Madison, WI),which does not contain any promoter sequence or enhancer. Thesequences of the recombinant genes with different alleles wereconfirmed by sequencing.
Transfection with the SCNN1A gene promoter/luciferase fusiongenes was performed with LipofectAmine Plus reagent, accordingto the recommendations of the manufacturer. DNA-LipofectAmine(Gibco BQL, Gaithersburg, MD) complex was mixed with cells inOptiMEM (GibcoBRL) medium without serum, and the transfectionmedium was replaced with culture medium 3 h later. MDCK cellswere cultured in -minimal essential medium with 10% fetal bovineserum. PRL-CMV vector (Promega), in which Renilla luciferaseis under the control of the cytomegalovirus promoter, was includedin the transfection mixture as an internal standard. Dexamethasone(100 nM) was added to the medium 6 h before collection. Cellswere collected 30 h after transfection. Photinus and Renillaluciferase activities were measured using a kit (PG-DUAL-SP;Toyo Ink, Co., Tokyo, Japan), according to the recommendationsof the manufacturer. Photinus luciferase activity, which indicatedthe promoter activity of the SCNN1A gene, was divided by Renillaluciferase activity and expressed as relative luciferase units.
Statistical Analyses
Values are expressed as mean ± SEM. All statistical analyseswere performed by using the JMP statistical software package(SAS Institute Inc., Cary, NC). Multiple logistic analyses wereperformed with other covariates [gender, age, body mass index(BMI), and alcohol consumption]. BP value residuals were calculatedby adjusting for age and BMI. Residuals represent the differencebetween the actual BP value for each observation and the valuepredicted on the basis of age and BMI. Differences in numericaldata among the groups were analyzed by using ANOVA. Differencesin frequency among the groups were tested by using a contingencytable analysis.
Detection of Genetic Variants
The genetic variants observed in this study are summarized inTable 3. We observed four polymorphisms in the promoter region.The G2139 allele completely corresponded to the G2765 allelein the 32 cases sequenced. The G(2139)A polymorphism was intight-linkage disequilibrium with the G(3091)A polymorphism.The G(3091)A polymorphism in exon 1 is in the 5' noncoding regionof the mRNA. The G(3134)C polymorphism in intron 1 is 5 bp distalto the exon 1 splice donor site. The polymorphisms in exons6 and 13 are both associated with amino acid changes. The linkagedisequilibrium between the variations is summarized in Table 4.Only one polymorphism (in intron 3) has been reported inthe single nucleotide polymorphism database of the NationalCenter for Biotechnology Information, which does not includeany of the polymorphisms presented here.
Table 4. Linkage disequilibrium between the variationsa
Association Study
Multiple logistic analyses of data for 1609 to 2061 subjects(depending on the genotype), in which BMI, age, and alcoholconsumption were included as independent variables, indicatedthat the G(1144)A, G(3134)C, G(1193)A, and G(1529)A polymorphismshad no significant effects on BP status (hypertension or not)(data not shown). In these preliminary analyses, the G(2139)Aand G(3091)A polymorphisms significantly affected BP. Consideringthe results of the promoter reporter assay presented below,we speculated that the association between BP status and theG(3091)A polymorphism was probably attributable to the tight-linkagedisequilibrium between the G(2139)A and G(3091)A polymorphisms.Therefore, we determined the G(2139)A polymorphism for all ofthe subjects in the study population. Table 5 presents clinicalcharacteristics according to G(2139)A genotype.
Table 5. Characteristics of the total study populationa
BP value residuals were calculated by adjusting for age andBMI. The G(2139)A polymorphism significantly affected systolicBP (residuals of systolic BP, P = 0.0127). The BP values presentedin Table 5 include those for subjects receiving antihypertensivetreatment. Therefore, we analyzed the effects of the genotypeon BP status in multiple logistic analyses. Hypertension wasdefined as systolic BP of 140 mmHg, diastolic BP of 90 mmHg,or the current use of antihypertensive medication. Multiplelogistic analyses in which age, BMI, alcohol consumption, andthe genotype of the G(2139)A polymorphism (AA = 1, GA+GG = 2)were included as independent variables indicated that the GA+GGgenotype was a risk factor for hypertension (odds ratio, 1.32;95% confidence interval, 1.06 to 1.65; P = 0.0157). Remarkably,a strong association was observed between this polymorphismand proteinuria (Table 5). It is generally accepted that geneticeffects are more evident among younger subjects, whereas thephenotypes of older subjects are more strongly influenced byenvironmental factors. Therefore, we analyzed the effects ofgenotype on BP status among younger subjects.
As demonstrated in Table 6, the effect of the G(2139)A polymorphismon BP was more evident among subjects <60 yr of age. Multiplelogistic analyses in which age, BMI, alcohol consumption, andthe genotype of the G(2139)A polymorphism (AA = 1, GA+GG = 2)were included as independent variables indicated that the GA+GGgenotype was a risk factor for hypertension (odds ratio, 1.78;95% confidence interval, 1.22 to 2.65; P = 0.0035) in this youngersubpopulation. In this younger subpopulation, a strong associationwas also observed between this polymorphism and proteinuria(Table 6). Similarly, the GA+GG genotype was a risk factor forhypertension among subjects <65 yr of age (odds ratio, 1.41;95% confidence interval, 1.05 to 1.92; P = 0.0251) and amongsubjects <55 yr of age (odds ratio, 2.15; 95% confidenceinterval, 1.32 to 3.67; P = 0.0032). Therefore, the effectsof this genotype on BP status were more evident in younger subpopulations.
Table 6. Characteristics of the study population <60 yr of agea
There was a strong association between the G(2139)A polymorphismand proteinuria in this study population. Multiple logisticanalyses indicated that the presence of proteinuria could beexplained by age (P = 0.0227), the presence of diabetes mellitus(P < 0.0001), serum creatinine levels (P = 0.0016), the presenceof hypertension (P < 0.0001), and the G(2139)A polymorphism(AA = 1, GA+GG = 2) (P = 0.0008). The inclusion of the presenceof hypertension in the analysis as an independent variable didnot reduce the importance of the G(2139)A polymorphism, suggestingthat the effects of this genotype on proteinuria are largelyindependent of its effects on BP.
Functional Significance of the G(2139)A Polymorphism
We examined the functional significance of the G(2139)A andG(3091)A polymorphisms in vitro using MDCK cells (Figure 1).Three-way ANOVA indicated that G(2139)A polymorphism (P <0.0001) but not the G(3091)A polymorphism affected promoteractivity. No significant interaction between the genotypes wasobserved. Dexamethasone increased the promoter activity of bothgenotypes (P < 0.0001). A significant interaction was observedbetween the G(2139)A genotype and the effects of dexamethasone(P < 0.0001), which indicated that the induction of transcriptionby dexamethasone was more pronounced with the G(2139) allelethan with the A(2139) allele. The G(2319) allele was associatedwith approximately 1.4- and 1.6-fold greater promoter activity,compared with the A(2139) allele, in MDCK cells without andwith dexamethasone treatment, respectively. .
Figure 1. Assessment of promoter activity. To explore the regulatory effects of the G(2139)A and G(3091)A polymorphisms in the promoter region of SCNN1A, we constructed SCNN1A gene promoter/luciferase fusion genes. The haplotypes determined were G/G, G/A, A/G, and A/A. Transient transfection with the SCNN1A gene promoter/luciferase fusion genes was performed in MDCK cells (n = 6). Photinus luciferase activity, which indicated the promoter activity of the SCNN1G gene, was divided by Renilla luciferase activity and expressed as relative luciferase units. The G(3091)A polymorphism had no significant effect on promoter activity. Dexamethasone (DEX) increased promoter activity (P < 0.0001). The promoter activity of the G(2139) allele was 1.4 and 1.6 times higher than that of the A(2139) allele in MDCK cells (P < 0.0001) without and with dexamethasone, respectively. A significant interaction was observed between the G(2139)A genotype and the effects of dexamethasone (P < 0.0001), which indicated that the induction of transcription by dexamethasone was more pronounced for the G(2139) allele than for the A(2139) allele. CMV, cytomegalovirus.
In this study, we observed sequence variations in SCNNIA onchromosome 12p13. We then evaluated the significance of thesepolymorphisms in BP regulation, using a large cohort consistingof approximately 4000 subjects. The G(2139)A genotype was foundto be associated with BP status. The stronger association ofthis polymorphism with BP status in younger subpopulations stronglysupports the concept that this genotype is indeed a risk factorfor hypertension.
Reporter analyses of promoter activity suggest that the AA genotypeof SCNNIG is associated with lower promoter activity in vivo.The guanine to adenine transition at this site G(2139)A confersa consensus sequence for EF1, a repressor of E2 box-mediatedgene activation (6). However, determination of the precise mechanismby which this variation influences promoter activity awaitsfurther investigation. Lower levels of expression of the SCNN1Asubunit may lead to lower levels of sodium reabsorption in thekidney, and this may protect against the development of hypertension.The difference in promoter activity between the two genotypesin vitro was only 1.4-fold under basal conditions and 1.6-foldwith dexamethasone treatment. There is presently no evidenceto support the concept that this difference is sufficient toaccount for a significant effect of this genotype on BP. Thepromoter activity assessed in vitro may not necessarily indicatethat in vivo, because our promoter/luciferase construct coveredonly up to -2 kb from the initiation site. Indeed, Chow et al.(7) reported that up to -6 kb from the initiation site mightbe necessary for full promoter activity and that intron 1 hasa negative regulatory element. Combination with other unidentifiedvariations might affect the promoter activity or expressionlevel. More-thorough sequence screening covering the entireSCNN1A gene, including further upstream and intronic sequences,might be required for determination of the mechanism for theobserved association between the SCNN1A genotype and hypertension.Moreover, further study is necessary for assessment of SCNN1AmRNA levels in tubular cells in vivo according to the genotype.
A remarkable association was observed between the presence ofproteinuria and the G(2139)A polymorphism. The effects of thisgenotype on proteinuria seemed to be largely independent ofits effects on BP. It has been suggested that salt-sensitiveindividuals, such as black subjects and those with diabetesmellitus, are more likely to develop renal failure as a consequenceof hypertension (8). Glomerular capillary pressure is thoughtto increase more in response to salt loading in salt-sensitivehypertensive patients, compared with salt-resistant hypertensivepatients (9,10). The higher frequency of proteinuria among subjectswith the GA and GG genotypes may support the concept that thesegenotypes are associated with salt sensitivity. The possibilitythat this genotype might influence the progression of variousrenal diseases, such as chronic glomerulonephritis and diabeticnephropathy, awaits further investigation.
To our knowledge, this is the first report demonstrating thata common polymorphism of SCNN1A influences BP in the generalpopulation. Because the allelic frequency associated with hypertensionis high (frequency, 0.66), the effect of this genotype on BPstatus in the general population is also considered to be high.One of the genes responsible for pseudohypoaldosteronism typeII, WNK1, is mapped to the most telomeric 2-cM segment of chromosome12p and is >5 Mb from SCNN1A (11). Hypertension with brachydactylyhas also been mapped to chromosome 12p, but at a site distinctfrom the SCNN1A locus (12). The genes adjacent to SCNN1A areTNFRSF1A and LTBR, which are merely 30 and 10 kb away, respectively.However, it may be difficult to associate these adjacent geneswith the pathogenesis of hypertension, on the basis of our currentunderstanding of these genes. This study strongly suggests thata common polymorphism of SCNN1A is indeed involved in BP regulation.Whether assessment of this polymorphism may help to identifydiuretic-responders awaits further investigation.
Acknowledgments
We express our highest gratitude to the following people forthe continuous support of our population survey in this area:Dr. Otosaburo Hishikawa, President; Dr. Katsuyuki Kawanishi,committee in chief for the city health check-up service; othermembers of the Suita City Medical Association; and Mr. ShigeruKobayashi, Director of the City Health Center. We also expressour greatest thanks to the members of our attendantssociety (Satsuki-Junyu-kai) for their cooperation and assistanceto our survey of risk factors and preventive activity on cardiovasculardiseases. We also express our highest gratitude to Dr. SoichiroKitamura, President of the National Cardiovascular Center, forconsiderations to our research work.
Canessa CM, Schild L, Thorens B, Gautschi I, Horisberger JD, Rossier BC: Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature (Lond) 367: 463467, 1994[CrossRef][Medline]
McDonald FJ, Price MP, Snyder PM, Welsh MJ: Cloning and expression of the ß- and -subunits of the human epithelial sodium channel. Am J Physiol 268: C1157C1163, 1995[Abstract/Free Full Text]
International Human Genome Sequencing Consortium: Initial sequencing and analysis of the human genome. Nature (Lond) 409: 860921, 2001[CrossRef][Medline]
Chang SS, Grunder S, Hanukoglu A, Rosler A, Mathew PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, Lifton RP: Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nat Genet 12: 248253, 1996[CrossRef][Medline]
Ishikawa K, Baba S, Katsuya T, Iwai N, Asai T, Fukuda M, Takiuchi S, Fu Y, Mannami T, Ogata J, Higaki J, Ogihara T: T+31C polymorphism of angiotensinogen gene and essential hypertension. Hypertension 37: 281285, 2001[Abstract/Free Full Text]
Sekido R, Murai K, Funahashi J, Kamachi Y, Fujisawa-Sehara A, Nabeshima Y, Kondoh H: The -crystallin enhancer-binding protein EF1 is a repressor of E2-box-mediated gene activation. Mol Cell Biol 14: 56925700, 1994[Abstract/Free Full Text]
Chow YH, Wang Y, Plumb J, OBrodovich H, Hu J: Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel subunit gene. Pediatr Res 46: 208214, 1999[Medline]
Campese VM: Salt sensitivity in hypertension: Renal and cardiovascular implications. Hypertension 23: 531550, 1994[Abstract/Free Full Text]
Campese VM, Parise M, Karubian F, Bigazzi R: Abnormal renal hemodynamics in black salt-sensitive patients with hypertension. Hypertension 18: 805812, 1991[Abstract/Free Full Text]
Sanai T, Kimura G: Renal function reserve and salt sensitivity in essential hypertension. J Lab Clin Med 128: 8997, 1996[CrossRef][Medline]
Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard J-M, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, Lifton RP: Human hypertension caused by mutations in WNK kinases. Science (Washington DC) 293: 11071111, 2001[Abstract/Free Full Text]
Scuster H, Wienker TE, Bahring S, Bilginturan N, Toka HR, Neitzel H, Jeschke E, Toka O, Gilbert D, Lowe A, Ott J, Haller H, Luft FC: Severe autosomal dominant hypertension and brachydactyly in a unique Turkish kindred maps to human chromosome 12. Nat Genet 13: 98100, 1996[CrossRef][Medline]
Received for publication April 27, 2001.
Accepted for publication September 11, 2001.
This article has been cited by other articles:
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney
Hypertension,
October 1, 2005;
46(4):
787 - 798.
[Abstract][Full Text][PDF]
P. Meneton, X. Jeunemaitre, H. E. de Wardener, and G. A. Macgregor Links Between Dietary Salt Intake, Renal Salt Handling, Blood Pressure, and Cardiovascular Diseases
Physiol Rev,
April 1, 2005;
85(2):
679 - 715.
[Abstract][Full Text][PDF]
N. Marissal-Arvy, M. Lombes, J. Petterson, M.-P. Moisan, and P. Mormede Gain of Function Mutation in the Mineralocorticoid Receptor of the Brown Norway Rat
J. Biol. Chem.,
September 17, 2004;
279(38):
39232 - 39239.
[Abstract][Full Text][PDF]
H. Endoh, S. Tomida, Y. Yatabe, H. Konishi, H. Osada, K. Tajima, H. Kuwano, T. Takahashi, and T. Mitsudomi Prognostic Model of Pulmonary Adenocarcinoma by Expression Profiling of Eight Genes As Determined by Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction
J. Clin. Oncol.,
March 1, 2004;
22(5):
811 - 819.
[Abstract][Full Text][PDF]