Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugenoya, Y.
Right arrow Articles by Takahashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugenoya, Y.
Right arrow Articles by Takahashi, K.
J Am Soc Nephrol 13:322-331, 2002
© 2002 American Society of Nephrology

Smooth-Muscle Calponin in Mesangial Cells: Regulation of Expression and a Role in Suppressing Glomerulonephritis

Youichi Sugenoya*{dagger}, Ashio Yoshimura*, Hisako Yamamura{dagger}, Kiyoko Inui*, Hiroyuki Morita*, Hideaki Yamabe{ddagger}, Noboru Ueki§, Terukuni Ideura* and Katsuhito Takahashi{dagger}

*Department of Medicine and Pathophysiology, Division of Nephrology, Showa University Fujigaoka Hospital, Aoba-ku, Yokohama, Japan; {dagger}Department of Molecular Medicine and Pathophysiology, Osaka Medical Center for Cancer and Cardiovascular Diseases, The Graduate School of Pharmaceutical Science, Osaka University, SORST, Japan Science and Technology Corporation, Higashinari-ku, Osaka City, Japan; {ddagger}Second Department of Internal Medicine, Hirosaki University School of Medicine, Hirosaki, Japan; §Third Department of Internal Medicine, Hyogo College of Medicine, Nishinomiya, Hyogo, Japan.

Correspondence to Dr. Katsuhite Takahashi, Department of Molecular Medicine and Pathophysiology, Osaka Medical Center for Cancer and Cardiovascular Diseases, 1-3-3 Nakamichi, Higashinari-Ku, Osaka City, Osaka 537-8511 Japan. Phone: 81-6-6972-1181; Fax: 81-6-6972-7749; E-mail:takhashi-ka{at}mc.pref.osaka.jp


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. The basic or h1 calponin gene, which encodes an actin-binding protein involved in the regulation of smooth-muscle shortening velocity, is known to be a smooth-muscle differentiation-specific gene. It was found that basic calponin was expressed by cultured mesangial cells and localized along the actin filaments. Among the growth factors involved in the mesangial cell pathophysiology, including platelet-derived growth factor-BB (PDGF-BB), tumor necrosis factor–{alpha} (TNF-{alpha}), and transforming growth factor–ß1 (TGF-ß1), TNF-{alpha} potently downregulates basic calponin expression in both the mRNA and protein levels, whereas TGF-ß1 upregulates the calponin expression. PDGF-BB also reduced its mRNA expression. The half-life of basic calponin mRNA was determined to be similar between TNF-{alpha}–treated and –untreated mesangial cells, whereas cell transfection assays that used a luciferase reporter gene construct containing the functional basic calponin promoter showed that TNF-{alpha} and PDGF-BB reduced the transcriptional activity. Because stimulation with TNF-{alpha} and PDGF-BB was associated with mesangial cell proliferation, basic calponin may play a role in the suppression of mesangial cell proliferation. Treatment with anti–glomerular basement membrane antibody in calponin knockout mice induced more severe nephritis than in wild type mice, as judged from an increase in the urinary protein excretion, glomerular cellularity, and number of proliferating cell nuclear antigen–positive cells in glomerulus. These results suggest that basic calponin expression may serve as one of the intrinsic regulators of glomerular nephritis. Elucidation of the molecular mechanisms for regulation of the basic calponin expression in mesangial cells may improve the understanding of the molecular basis and pathogenesis of the glomerular response to injury.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Induction of smooth-muscle differentiation features in mesenchymal cells has been documented in many pathologic settings characterized by tissue remodeling and fibrosis (1). The glomerular mesangial cells are mesenchyme-derived multipotential cells that display a smooth-muscle–like phenotype during glomerular inflammation (2). However, relatively little is known about the regulation of smooth muscle–associated genes in mesangial cells. Critical to the understanding of the phenotypic modulation of mesangial cells associated with renal diseases is the identification of the specific genes that distinguish one cell phenotype to another and the determination of the key environmental signals and ligands that regulate their expression.

Calponin was originally isolated as an actin-binding protein involved in the regulation of smooth-muscle contraction (3–5). Three distinct mammalian calponin genes have been identified: basic calponin/calponin h1, neutral calponin/calponin h2, and acidic calponin (6–8). Expression of the basic calponin gene marks smooth-muscle cell differentiation (4,9–12), whereas neutral and acidic calponins are expressed in both smooth-muscle and non–smooth-muscle cells (7,8). The biochemical characterization of basic calponin demonstrates that it is capable of inhibiting actomyosin ATPase activity (13,14). Calponin induces actin polymerization at low ionic strength and inhibits depolymerization of the actin filaments (15). Overexpression of basic calponin in cultured smooth-muscle cells, fibroblasts, and tumor cells suppresses their proliferation (16,17). These observations suggest that, in addition to the regulation of smooth-muscle contractility, basic calponin may influence cytokinesis, proliferation, and cell differentiation.

In this study, we demonstrate that mesangial cells express basic calponin. We show that tumor necrosis factor–{alpha} (TNF-{alpha}) and platelet-derived growth factor-BB (PDGF-BB), potent mediators of glomerular disease, downregulate basic calponin gene expression and enhance mesangial cell proliferation. Furthermore, we demonstrate that calponin-deficient (-/-) mice develop more severe mesangial proliferation than wild type (+/+) mice.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Antibodies and Growth Factors
A monoclonal antibody to smooth-muscle calponin (clone hCP) was purchased from Sigma (St. Louis, MO). A polyclonal antibody to synthetic carboxyl-terminal peptides (Leu-281~Ala-297) of human basic calponin was generated in rabbits (18). The specificity of the antibodies to the basic calponin isoform was verified by immunoblot analysis that used recombinant calponin isoforms (7,18). Human recombinant PDGF-BB was purchased from Life Technologies (Gaithersburg, MD) and transforming growth factor–ß1 (TGF-ß1) from R&D Systems (Minneapolis, MN). Human recombinant TNF-{alpha} (PT-050, 3.0 x 106 U/mg protein) was kindly provided by Dainippon Pharmaceutical Co. (Osaka, Japan).

Cell Culture
Human mesangial cells (HMC) originating from fetal kidney of 16 and 18 wk of gestation were kindly provided by Dr. M. R. Daha (University Hospital of Leiden, The Netherlands) (19). Another human mesangial cell line, NHMC-2845, prepared from adult kidney, was purchased from Clonetics (Walkersville, MD). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies, Grand Island, NY) supplemented with 10% (vol/vol) fetal calf serum (FCS), 100 IU/ml penicillin, and 100 µg/ml streptomycin (Life Technologies). A rat mesangial cell line was prepared from the kidneys of 7-wk-old male Sprague-Dawley rats and was grown in culture as described elsewhere (20). HMC lines between the sixth and ninth passages and rat mesangial cell lines between the 10th and 20th passages were used for experiments. When cells were subjected to growth arrest, the cells were incubated in DMEM that contained 0.5% FCS for 24 h.

Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis and Immunoblot Analysis
Mesangial cells in 6-well dishes (Becton Dickinson Labware, Franklin Lakes, NJ) were washed twice with phosphate-buffered saline (PBS), dissolved by scraping with a Teflon policeman in 200 µl of Laemmli’s sample buffer that contained 8 M urea, 10 µg/ml leupeptin, and 0.5 mM phenylmethylsulphonyl fluoride, and then boiled for 3 min. The samples that contained equal amounts of proteins were loaded on sodium dodecyl sulfate–polyacrylamide gradient gels (10% to 15%) by use of an automated electrophoresis system (PhastSystem, Amersham Pharmacia LKB Biotechnology, Buckinghamshire, UK). The quantitation of proteins on gels was carried out with the use of Ultroscan XL lazer densitometry (Amersham Pharmacia LKB Biotechnology). The gels were blotted on nitrocellulose membranes (Bio-Rad, Hercules, CA) with the use of the PhastTransfer semidry electrotransfer kit (Amersham Pharmacia LKB Biotechnology), according to the manufacturer’s instructions. The membranes were incubated with blocking solution containing 0.9% (wt/vol) NaCl, 10 mM Tris-HCl (pH 7.5), and 1% (wt/vol) bovine serum albumin (BSA) for 2 h at room temperature, followed by incubation with the anti-calponin antibody at 37°C for 1 h and an alkaline phosphatase-conjugated secondary antibody (Promega, Madison, WI) at room temperature for 30 min, followed by an alkaline phosphatase-conjugated substrate detection Kit (Bio-Rad).

Immunofluorescence Microscopy
HMC cells were plated on four-well Lab-Tek chamber slides (Nunc, Naperville, IL) and grown to 50% confluence in 10% FCS/DMEM. The cells were rinsed twice in PBS and then fixed in 4% (vol/vol) paraformaldehyde/PBS at room temperature for 10 min. The chamber slides were rinsed twice in PBS, and cells were made permeable in 0.2% (vol/vol) Triton-X100/PBS at room temperature for 10 min. After being rinsed two times in PBS, they were incubated with 5% (vol/vol) goat serum/PBS at room temperature for 30 min. After being washed with PBS, the slides were incubated with a monoclonal antibody to calponin (clone hCP) in 2% (vol/vol) goat serum/PBS at 4°C overnight. A slide without incubation with the first antibody was used as a negative control. They were then washed six times with 0.05% (vol/vol) Tween 20/PBS, followed by incubation with the FITC-conjugated anti-mouse IgG (Silenus, Victoria, Australia) in 2% (vol/vol) goat serum/PBS for 60 min at room temperature. To visualize actin filaments, the cells were rinsed and then incubated with rhodamine-conjugated phalloidin (Molecular Probes, Eugene, CA) for 30 min at room temperature. After being washed in 0.05% (vol/vol) Tween 20/PBS, slides were examined with a BX-50 fluorescence microscope (Olympus, Tokyo, Japan).

RNA Preparation and Reverse Transcriptase–PCR Analysis
Total RNA was extracted from cultured cells by use of the Isogen RNA extraction kit (Nippon Gene, Toyama, Japan). Reverse transcription (RT) of 2 µg of total RNA was carried out by use of the reaction mixture of Ready-To-Go You-Prime First-Strand Beads (Amersham Pharmacia LKB Biotechnology) in the presence of 0.2 µg of the random hexamer primer. After 60 min incubation at 37°C, 0.5 µM each of the forward and reverse primers, 200 µM dNTP mixture, and 2.5 U of Taq DNA polymerase (Life Technologies) were added to 8 µl of the first-strand reaction mixture, and then the total volume was adjusted to 50 µl with water. The parameters used for the PCR amplification were 30 cycles of denaturation (94°C, 40 s), annealing (60°C, 30 s), and polymerization (72°C, 90 s). Sequences of the forward and reverse primers used and the product size were as follows: basic calponin, GAGTGTGCAGCAGAAACTTCAGCC (forward), GTC TGTGCCCAACTTGGGGTC (reverse), 671 bp; neutral calponin, CTGCAGAGCGGGG TGGACATTGGC (forward), GCCGGCCTCCTCCT GGTAAGG (reverse), 519 bp; acidic calponin, GGAAGCGAAGTGCGAGAGACC (forward), CTGTGTGGATCTAATAATC AATGC (reverse), 1061 bp; SM22{alpha}, CGCGAAGTGCAGTCCAAAATCG (forward), G GGCTGGTTCTTCTTCAATGGGG (reverse), 928 bp; caldesmon, GTCACCAAGTCCTA CCAGAAGA (forward), GCTGCTTGATGGGTCGATTTGA (reverse), 744 bp for low and 1508 bp for high molecular isoform; {alpha}-smooth muscle actin ({alpha}SMA), CCAGCTATG TGAAGAAGAAGAGG (forward), GTGATCTCCTTCTGCATTCGGT (reverse), 965 bp; and glyceraldehyde 3-phosphate dehydrogenase, CCCATCACCATCTTCCAGGA (forward), TTGTCATACCAGGAAATGAGC (reverse), 731 bp. The primers for the caldesmon gene were designed to amplify cDNAs encoding both low-molecular-weight and high-molecular-weight isoforms (21). The linearity of PCR products for calponins, SM22{alpha}, and caldesmon was obtained between 25 and 30 cycles and that for {alpha}SMA and glyceraldehyde 3-phosphate dehydrogenase between 20 and 30 cycles. After 1% agarose gel electrophoresis in the presence of 0.5 µg/ml of ethidium bromide, the PCR products were revealed by ultraviolet irradiation and the image was captured by Eagle Eye II Still Video System (Stratagene, La Jolla, CA). Variations in signal intensities between different agarose gels were corrected by use of those of the molecular-weight markers in every gel analyzed. Negative controls, including the PCR reagents without the RT reaction mixture, showed no specific signals.

Construction of Basic Calponin Promoter–Luciferase Expression Plasmids
The cloning, determination of the transcription start site, and nucleotide sequence (~1.2 kb) of the human basic calponin promoter have been reported elsewhere (22). The nucleotide (nt) number was designated as the position relative to the translation start site. A 421-bp human basic calponin promoter (nt -385 to +36) was generated by PCR and subcloned into the KpnI/HindIII sites of the pGL2-Basic vector (Promega). The construct designated as "pGL2-421CN" contains an essential region involved in the basal transcriptional activity of the human basic calponin gene (unpublished data). A 189-bp promoter segment (nt -153 to +36) was generated by PCR and subcloned into the KpnI/HindIII sites of pGL2-Basic vector (pGL2-189bCN). In HMC cells, the transcriptional activity of the pGL2-189CN was ~5% that of pGL2-421CN. Thus, the activity of the pGL2-189CN construct was used for indicator of baseline luciferase activity. The sequences of these plasmids were verified on both strands by use of a DSQ2000L automated sequencer (Shimazu, Kyoto, Japan). All restriction and DNA modifying enzymes were purchased from New England Biolabs (Beverly, MA) and Roche Diagnostics GmbH Roche Molecular Biochemicals (Mannheim, Germany).

Transfections, Luciferase, and ß-Galactosidase Assays
HMC cells were plated at a density of 5 x 105 per well in 6-well dish and were grown to confluence in 10% FCS/DMEM. The cells were transiently transfected with 1 µg of the pGL2-421CN or pGL2-189CN, 1.5 µg of pCAGGS/lacZ reference plasmid (23), 10 µl of PLUS reagent (Life Technologies), and 1.0 µg of LIPOFECT AMINE reagent (Life Technologies) in the serum-free DMEM medium, according to the manufacturer’s instructions. After incubation for 3 h, the medium was replaced with 10% FCS/DMEM, and TNF-{alpha} and PDGF-BB were added to the medium at the final concentration of 100 and 20 ng/ml, respectively. Twenty-four hours after transfection, cells in each well were harvested in 100 µl of the cell lysis buffer (PicaGene Luciferase Assay System; Toyo Inc., Tokyo, Japan). After centrifugation at 12,000 x g for 10 min at 4°C, 20- and 30-µl aliquots of the supernatants were used for the luciferase and ß-galactosidase assays, respectively. Luciferase and ß-galactosidase activities were measured as described elsewhere (24). Luciferase activities (light unit) were corrected for variations in transfection efficiencies as determined by the ß-galactosidase activity and also corrected for variations in the baseline activity of pGL2-189CN. There were no significant differences in the protein concentrations among the cell lysates as measured by BCA Protein Assay Reagent Kit (Pierce, Rockford, IL). All experiments were repeated three times, to confirm reproducibility.

Cell Proliferation Assay
HMC were plated at 2 x 103 cells/well in 96-well tissue culture plate (Becton Dickinson Labware). After 24 h, the cells on 96-well tissue culture plates were subjected to cell growth assay by measurement of MTS [3-(4,5-dimethyl-thiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt] conversion by use of the CellTiter 96 AQueous assay kit (Promega).

In Situ RT-PCR Analysis of Basic Calponin mRNA Expression in the Glomerulus
In situ detection of RT-PCR–amplified murine basic calponin mRNA was done according to the methods of Novoet al. (25). To detect calponin mRNA in glomeruli, mouse kidney was fixed in 10% neutral buffered formalin and embedded in paraffin. Sections of 6-µm thickness were digested in 1 mg/ml pepsin solution for 10 min at 37°C and then digested with DNase overnight. RT solution was applied to the tissue sections and incubated for 1 h at 60°C. The PCR solution that contained digoxigenin dUTP (Roche Diagnostics GmbH Roche Molecular Biochemicals) was applied to the tissue sections, and amplification was done with the use of the following parameters: 94°C for 120 s and 60°C for 90 s, 1 cycle; 95°C for 45 s and 60°C for 90 s, 20 cycles with the GeneAmp In situ thermal cycler1000 (Perkin Elmer, Jersey City, New Jersey). The primers for mouse basic calponin were prepared as described elsewhere (18). The digoxigenin-labeled cDNA segments were detected by anti-digoxigenin-AP(alkaline phosphatase) Fab fragments (Roche Diagnostics GmbH Roche Molecular Biochemicals). Expression of mRNA was visualized by an enzyme-catalyzed color reaction with 5-bromo-4-chloro-3-indolyl phosphate (X-phosphate) and nitroblue tetrazolium salt (Roche Diagnostics GmbH Roche Molecular Biochemicals). Negative controls without the RT reaction mixture showed no specific signals.

Accelerated Anti–Glomerular Basement Membrane Nephritis in Calponin Knockout Mice
Mice with a homozygous mutation in basic calponin allele were generated as described elsewhere (18). There are no renal histologic abnormalities by light and electron microscopy and no abnormalities in renal function in calponin knockout (-/-) mice, compared with wild type (+/+) mice. To investigate a role for basic calponin in the pathogenesis of glomerulonephritis in vivo, accelerated anti–glomerular basement membrane (GBM) nephritis was induced. Mice were preimmunized with 1 mg of rabbit gamma globulin (Cappel, West Chester, PA) and complete Freund’s adjuvant (DIFCO Laboratories, Detroit, Michigan). Five days later, the rabbit anti-mouse GBM antibody (0.2 ml/30 g body weight) was intravenously injected (day 0). Urinary protein excretion and histology of kidney tissues were analyzed at day 0, 5, and 12 in (-/-) and (+/+) mice (n = 4, respectively). Urinary protein excretion was semiquantitatively graded from 0 to 4 by use of test paper (Uristix, Bayer Medical Co., Tokyo, Japan). Anti-GBM antibody was made in New Zealand white rabbits (Nihon Ikagaku Doubutsu, Tokyo, Japan), according to methods published elsewhere (26).

Renal Morphology and Immunohistochemistry
Tissues were fixed in methyl Carnoy solution (27) and embedded in paraffin. For evaluation of cellularity per glomerular cross section, tissue sections (4 µm in thickness) were stained with periodic acid–Schiff reagent, and 10 randomly selected glomeruli were counted for each animal. For evaluation of glomerular cell proliferation, tissue sections (4 µm in thickness) were stained with a monoclonal antibody against human PCNA (clone 19A2) (Coulter Immunology, Hialeah, FL) by the indirect immunoperoxidase method (28). Quantification of proliferating cells was performed by examining the number of proliferating cell nuclear antigen (PCNA)–positive cells per glomerular cross section in a blinded manner.

Statistical Analyses
Values are expressed as the mean ± SEM. Two groups were compared by t test. ANOVA followed by the Fisher’s protected least significant difference test was used for multiple comparison. Differences were considered statistically significant with P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression and Intracellular Localization of Calponin in Cultured Mesangial Cells
As shown in Figure 1A, a monoclonal antibody (clone hCP) specific for basic isoform of calponin recognized a protein with the molecular weight of 36,000 in both the human (lane 1, HMC and lane 2, NHMC-2845 cells) and rat (lane 3) mesangial cell lines. On immunofluorescence microscopy, as in the case with smooth-muscle cells (29,30), the calponin-specific monoclonal antibody stained the microfilament structures, which indicates that basic calponin is localized along the actin filaments in mesangial cells (Figure 1B).



View larger version (49K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. (A) Immunoblot analysis with monoclonal antibody (clone hCP) to basic calponin in mesangial cells. Lane 1, human mesangial cells from fetal kidney (HMC); lane 2, another cell line of human mesangial cells from adult kidney (NHMC-2845); and lane 3, rat mesangial cells. Lane M, prestained sodium dodecyl sulfate–polyacrylamide gel electrophoresis standards: ovalbumin (50,600), carbonic anhydrase (35,500), and soybean trypsin (29,100). (B) Immunofluorescence microscopy for basic calponin and {alpha}-actin in HMC. HMC were stained first with the monoclonal antibody to basic calponin (clone hCP) and the FITC-conjugated second antibody, and then actin filaments were visualized with rhodamine-conjugated phalloidin. Top panel, calponin staining and bottom panel, {alpha}-actin staining of the same field as the upper one. Basic calponin is localized along the actin-containing stress fibers. Bar, 10 µm. (C) The staining of basic calponin was eliminated by omission of the first antibody).

 
Effects of Growth Factors on the Calponin Expression in Mesangial Cells
In various glomerular diseases, phenotypic modulation of mesangial cells is induced by a wide variety of cytokines and growth factors. Among those, PDGF-BB, TGF-ß1, and TNF-{alpha} have been considered to be particularly relevant to the pathogenesis (31). HMC were grown to confluence, growth-arrested, and then treated with 20 ng/ml PDGF-BB in the presence of 10% FCS/DMEM for 48 h or 2 ng/ml TGF-ß1 in the presence of 0.5% FCS/DMEM for up to 24 h. Total RNA was extracted from these cultures at the indicated times and subjected to RT-PCR analysis for the basic calponin expression (Figure 2A). The expression of basic calponin mRNA was downregulated to 60% of the control level at 48 h after addition of PDGF-BB. In contrast, TGF-ß1 increased the basic calponin mRNA expression to 150% of the control level at 8 h after stimulation. We next examined the effect of TNF-{alpha} on the basic calponin expression in HMC. The concentrations of TNF-{alpha} used did not cause significant cytotoxicity, as evidenced by light-microscopic examination as well as a cell proliferation assay that used an MTS conversion assay kit (CellTiter 96 Aqueous, Promega) (data not shown). As shown in the top panel of Figure 2B, treatment of the serum-starved HMC with TNF-{alpha} for 24 h caused a dramatic decrease in the steady-state levels of basic calponin mRNA, with complete inhibition at a concentration of 10 ng/ml. A decrease in basic calponin expression was detected as early as 4 h after stimulation with 100 ng/ml TNF-{alpha}, reaching ~20% at 8 h and with no basic calponin mRNA detected at 24 h. Similar results were obtained in NHMC-2845 cells (Figure 2C). The bottom panel of Figure 2B shows an immunoblot analysis of HMC with the polyclonal antibody specific for the basic isoform of calponin. Compared with the control, treatment with 100 ng/ml TNF-{alpha} progressively downregulated the calponin protein expression.



View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. (A) Reverse transcriptase (RT)–PCR analysis of basic calponin expression. Serum-starved cultures of HMC were incubated with platelet-derived growth factor-BB (PDGF-BB; 20 ng/ml) for 48 h in the presence of 10% fetal calf serum (FCS) or transforming growth factor–ß1 (TGF-ß1; 2 ng/ml) for 24 h in the presence of 0.5% FCS. Total RNA was extracted at the indicated times and subjected to RT-PCR analysis. GAPDH, glyceraldehyde 3-phosphate dehydrogenase. (B) Left of the top panels shows an RT-PCR analysis of basic calponin expression in serum-starved cultures of HMC treated with increasing concentrations of TNF-{alpha}. Right of the top panels shows time course of an RT-PCR analysis of basic calponin expression in the cells treated with 100 ng/ml TNF-{alpha}. The bottom panel shows immunoblot analysis of basic calponin expression in serum-starved cultures of the HMC incubated with or without 100 ng/ml TNF-{alpha}. The cells were harvested at the indicated times. (C) RT-PCR analysis of basic calponin expression in another mesangial cell line from adult kidney (NHMC 2845) treated with 100 ng/ml TNF-{alpha} for 24 h.

 
In contrast to the effect on basic calponin expression, treatment with TNF-{alpha} had little effect on the steady-state levels of neutral and acidic calponin isoforms and caldesmon mRNA transcripts in serum-starved HMC. However, TNF-{alpha} mildly reduced the mRNA for {alpha}SMA and SM22{alpha}, which are smooth-muscle differentiation markers (Figure 3). SM22{alpha} shares sequence homology with calponin (9). All of the caldesmon transcripts detected in the mesangial cells were represented as a 744-bp product of mRNA for the non–smooth-muscle isoform.



View larger version (55K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. RT-PCR analysis of calponin isoforms (neutral and acidic), SM22{alpha}, and caldesmon. Serum-starved cultures of HMC were treated with or without TNF-{alpha} (100 ng/ml) for 24 h. Total RNA was extracted and subjected to RT-PCR analysis. The caldesmon PCR product was 744 bp in size, corresponding to a low-molecular-weight non–smooth-muscle isoform.

 
TNF-{alpha} Downregulates Basic Calponin Gene Expression by a Transcriptional Mechanism
To determine whether the effects of TNF-{alpha} on the steady-state levels of basic calponin mRNA were due to alterations in the stability of transcript, serum-starved HMC were incubated in the presence or absence of 100 ng/ml TNF-{alpha} for 8 h and subsequently treated with freshly prepared DMEM that contained 2.5 ng/ml actinomycin D for up to 24 h (Figure 4A, top panel). The viability of the cells treated with TNF-{alpha} was similar to that of nontreated cultures in the presence of actinomycin D. The half-life of basic calponin mRNA was determined to be 17 h for TNF-{alpha}–treated cultures and 16 h for nontreated cultures (Figure 4A, bottom panel). The results suggest that TNF-{alpha} does not modulate the degradation of basic calponin mRNA. We next investigated whether the promoter activity of the basic calponin gene is affected by TNF-{alpha}. A series of transient transfection assays were performed with the use of a functional human basic calponin promoter. The plasmids pGL2-421 CN were transfected into HMC cells and then were incubated with 0, 1, and 10 ng/ml of TNF-{alpha} in the presence of 10% FCS for 24 h. The addition of TNF-{alpha} significantly reduced the basic calponin promoter activity to 30 ± 1.8% of the control value at 1 ng/ml and to 25 ± 0.4% of the control value at 10 ng/ml (P < 0.05 versus no addition of TNF-{alpha}) (Figure 4B). Similarly, the transcriptional activity of the basic calponin promoter was reduced to 73 ± 1.4% (P < 0.05 versus no addition of PDGF-BB) by the treatment with 20 ng/ml PDGF-BB for 24 h (Figure 4B).



View larger version (24K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. (A) Serum-starved HMC were incubated with or without 100 ng/ml TNF-{alpha} for 8 h. The culture medium was replaced with Dulbecco’s modified Eagle’s medium that contained 0.5% FCS and 2.5 ng/ml actinomycin D. Total RNA was extracted and subjected to RT-PCR analysis at the indicated times. The top panel shows RT-PCR analysis of the expressions of basic calponin and GAPDH. The bottom panel shows kinetics of basic calponin mRNA degradation in control ({circ}) and TNF-{alpha}–treated (•) cells. Each intensity of the bands on the agarose gels was quantitated by use of a computer program. Values for the basic calponin transcripts were normalized to those of GAPDH mRNA and represented as the percentages of initial amounts. The experiment was repeated twice, and similar results were obtained. (B) TNF-{alpha} and PDGF-BB reduce transcription of the basic calponin promoter in HMC. The functional basic calponin promoter linked to the luciferase-reporter gene was transfected to the HMC, and they were incubated with basal medium or TNF-{alpha} (1 and 10 ng/ml) or 20 ng/ml PDGF-BB for 24 h. Data are presented as the relative percentages against those of control. All values are presented as mean ± SEM from four independent cell preparations. *P < 0.05. The experiment was repeated three times.

 
TNF-{alpha} Promotes PDGF-BB–Induced Mesangial Cell Proliferation
To test an effect of TNF-{alpha}–mediated downregulation of basic calponin on mesangial cell proliferation, growth-arrested HMC were treated with TNF-{alpha} (0, 1, and 10 ng/ml) in the presence of PDGF-BB (long ng/ml) for 24 h. In parallel with suppression of basic calponin expression, TNF-{alpha} significantly enhanced proliferation of HMC in a dose-dependent manner; 1 ng/ml (139 ± 6.6% of control value, P < 0.01) and 10 ng/ml (146 ± 2.5% of control value, P < 0.01) (Figure 5). TNF-{alpha} or TGF-ß1 alone did not affect the rate of proliferation of mesangial cells (data not shown).



View larger version (41K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Effects of TNF-{alpha} on basic calponin expression and mesangial cell proliferation in the presence of PDGF-BB. Serum-starved HMC were incubated for 24 h with either basal medium or 1 ng/ml TNF-{alpha} or 10 ng/ml TNF-{alpha} in the presence of 10 ng/ml PDGF-BB. The cells were subjected to RT-PCR analysis for basic calponin and the MTS conversion assay for cell proliferation. Data are presented as the relative percentages against those of control. All values are presented as mean ± SEM from four independent cell preparations. *P < 0.05.

 
Mesangial Cell Proliferation was Accentuated in Calponin-Deficient Mice with Anti-GBM Nephritis
To study a direct role for basic calponin in the pathogenesis of glomerulonephritis in vivo, we induced accelerated anti-GBM glomerulonephritis in mice lacking basic calponin (18). The model is particularly useful for defining the factors responsible for severe glomerular injury (32). In basic calponin knockout (-/-) mice at day 0, there was no basic calponin mRNA expression in the glomerulus studied by in situ RT-PCR analysis. On the contrary, basic calponin mRNA was demonstrated in mesangial areas of wild type (+/+) mice at day 0 (Figure 6, A and B). Compared with (+/+) mice, urinary protein excretions in (-/-) mice were significantly increased at day 5 (3.8 ± 0.3 versus 2.9 ± 0.3 arbitrary unit, P < 0.01) and day 12 (4.0 versus 3.1 ± 0.3 arbitrary unit, P < 0.01). In (-/-) mice, glomerular cell proliferation was accentuated both at day 5 (52.3 ± 1.5 versus 46.6 ± 1.1 cells per glomerulus, P < 0.05) and day 12 (63.3 ± 1.3 versus 57.2 ± 1.5 cells per glomerulus, P < 0.05), compared with (+/+) mice (Figure 7, A and B). The glomerular cellularity of (-/-) mice was unchanged at day 0 (33.5 ± 1.4 versus 34.6 ± 1.4 cells per glomerulus), compared with (+/+) mice. A significant increase in the number of PCNA-positive cells in (-/-) mice was shown at day 5 (3.4 ± 0.2 versus 2.4 ± 0.4 cells per glomerulus, P < 0.05) and day 12 (3.7 ± 0.4 versus 2.4 ± 0.4 cells per glomerulus, P < 0.01) (Figure 7, C and D). Crescentic formation and interstitial cellularity were also remarkable in (-/-) mice (data not shown).



View larger version (104K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. The detection of in situ RT-PCR–amplified basic calponin mRNA in the normal glomerulus of calponin knockout (-/-) and wild type (+/+) mice. Basic calponin mRNA was not detected in the glomerulus of (-/-) mice (A). On the contrary, basic calponin mRNA was demonstrated in mesangial areas of (+/+) mice (B). Original magnification, x132.

 


View larger version (130K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. Periodic acid–Schiff staining (A, B) and immunostaining for PCNA (C, D) in calponin (-/-) mice and (+/+) mice with accelerated anti-glomerular basement membrane nephritis. At day 12, glomerular cellularity was increased in (-/-) mice (A) compared with (+/+) mice (B). The number of proliferating cell nuclear antigen–positive cells per glomerulus was significantly increased in (-/-) mice (C) compared with (+/+) mice (D) at day 12. Original magnification, x132.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Phenotypic modulation and dedifferentiation of mesangial cells is a characteristic feature of glomerular diseases (33). For example, expression of {alpha}SMA is a marker for activation and phenotypic modulation of mesangial cells (2). Studies elsewhere have demonstrated that a core sequence of the {alpha}SMA promoter that contains two highly conserved CArG box motifs is essential for serum-stimulated {alpha}SMA expression in rat mesangial cells (34). In this study, we showed that basic calponin, a smooth-muscle differentiation-specific gene, is highly expressed in cultured mesangial cells and localizes along the actin filaments. We also showed that its expression was downregulated by TNF-{alpha} and PDGF-BB at the transcriptional level and upregulated by TGF-ß1.

It has been reported that basic calponin expression is downregulated in cultured smooth-muscle cells when quiescent cells reenter the cell cycle (12) and is upregulated by TGF-ß1 in smooth-muscle cells (35) and in Ito cells in the liver (36). These observations are consistent with our results in mesangial cells. Moreover, we have demonstrated that TNF-{alpha} potently downregulates basic calponin expression in all of the mesangial cell lines examined. Among endogenous mediators involved in mesangial proliferative nephritis, TNF-{alpha} has been considered to be a primary proinflammatory factor in the pathogenesis of glomerular injury (37). Various biologic activities of TNF-{alpha} could be relevant to glomerulonephritis. TNF-{alpha} induces mesangial cell contraction and proliferation (31) and increases the severity of antibody-mediated glomerular injury in vivo (38). The use of specific neutralizing antibodies against the action of TNF-{alpha} significantly attenuates the progression of experimental glomerular disease (39). Although these studies suggest an important role of TNF-{alpha} in the pathogenesis of immune glomerular disease, the role of TNF-{alpha} in the cellular responses of mesangial cells in proliferative glomerular diseases has not been fully understood. The present study demonstrates for the first time that TNF-{alpha} affects the phenotypic modulation of mesangial cells in vitro. To show a convincing link between TNF-{alpha} activity and calponin in vivo, we are planning to make double knockout mice deficient for both calponin gene and TNF-{alpha} gene or the TNF-{alpha} receptor gene. We also showed the relationship between TNF-{alpha}–induced downregulation of basic calponin and mesangial cell proliferation induced by PDGF-BB. We suggest that downregulation of basic calponin may be correlated with the promotion of mesangial cell proliferation, implicating suppressive effects of basic calponin on mesangial cell proliferation. Also consistent is the fact that overexpression of basic calponin in smooth-muscle cells, fibroblasts, and tumor cells can inhibit their proliferation (16,17).

Hautmann et al. (35) and Ueki et al. (36) demonstrated that TGF-ß1 stimulates increased expression of the basic calponin gene in smooth-muscle cells and hepatic Ito cells. Furthermore, Shah et al. (40) demonstrated that TGF-ß1 treatment stimulated differentiation of pluripotent neural crest stem cells into smooth-muscle–like mesenchymal cells with induction of the basic calponin gene. Consistent with these observations, the present results also showed that TGF-ß1 potentiated basic calponin mRNA expression in mesangial cells. TGF-ß1 may play a role in counteracting inflammatory processes mediated by TNF-{alpha} to restore glomerular architecture.

The facts that the inhibitory effect of TNF-{alpha} on basic calponin expression was not due to an increase in the degradation of calponin mRNA and that TNF-{alpha} reduced activity of the basic calponin promoter to ~40% of the control value suggests that the effect of TNF-{alpha} on the calponin expression may be caused by decreased gene transcription. TNF-{alpha} stimulates various intracellular signaling mechanisms, including the transcription factors nuclear factor–{kappa}B and c-fos (41). In the functional basic calponin promoter used in this study, there is no consensus sequence for nuclear factor–{kappa}B– or AP-1–binding sites. Further studies are necessary to elucidate the transcriptional mechanisms for the TNF-{alpha}–mediated downregulation of the basic calponin expression in glomerular mesangial cells, leading to their phenotypic modulation.

Our results demonstrating enhanced proliferation of mesangial cells in the glomerulus of calponin-deficient mice (-/-) with anti-GBM nephritis support the notion that downregulation of basic calponin expression may potentiate mesangial cell proliferation in proliferative glomerular diseases. Also consistent is the fact that calponin-deficient mice (-/-) display increased bone formation in bone fracture healing, with proliferation of activated periosteal osteoblasts differentiated from embryonic mesenchymal cells (18). We observed that not only crescentic formation but also interstitial cellularity were remarkable in calponin-deficient mice (-/-) with anti-GBM nephritis (data not shown). The increase in interstitial cellularity was present mainly around glomeruli and may be due to more prominent glomerular injuries. However, we should study the possibility of involvement of calponin in the myofibroblast proliferation in the interstitium in glomerular diseases in future, because proliferation of mesenchymal cells may be also important in the increase in interstitial cellularity (18).

In summary, this study demonstrates that glomerular mesangial cells express a smooth-muscle differentiation marker, basic calponin. Regulation of its expression by TNF-{alpha}, PDGF-BB, and TGF-ß1 suggests a possible role of basic calponin in the pathophysiology of mesangial cells and indicates specifically a role in suppressing proliferative glomerulonephritis. Elucidation of the molecular mechanisms of regulation of the basic calponin expression in mesangial cells may improve the understanding of the molecular basis of the glomerular response to injury and inflammatory reaction, and thus aid in the development of therapeutic interventions for human renal diseases.


   Acknowledgments
 
This study was supported in part by a Grant-Aid from the Ministry of Health and Welfare, Japan, for the Comprehensive 10-yr Strategy of Cancer Control and Cardiovascular Research (to K.T), from the Ministry of Education, Science, Sports and Culture, Japan, for the Special Project of Research of Atherosclerosis (to K.T.), from the Scientific Research (C) (09671177, to A.Y.), from the High-Technology Research Center Project (to Y.S.) and from Health Sciences Research, Japan, for Nephro-urological Study Group of Research on Specific Diseases (to A.Y.). We thank Professor Richard J. Johnson (Renal Section, Baylor College of Medicine) for critical reading of this manuscript and for his advice. We also thank Professor Mohamed R. Daha (University Hospital of Leiden, The Netherlands) for providing human mesangial cells and Professors S. Noguchi (Osaka University), Shinobu Kawaguchi, Hiroaki Ihara, Naomi Hisano, and Hiroko Buto (Department of Medicine, Osaka Medical Center for Cancer and Cardiovascular Diseases) for technical assistance.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sappino AP, Schurch W, Gabbiani, G: Differentiation repertoire of fibroblastic cells: Expression of cytoskeletal proteins as marker of phenotypic modulation. Lab Invest 63: 144–161, 1990[Medline]
  2. Johnson RJ, Floege J, Yoshimura A, Iida H, Couser WG, Alpers CE: The activated mesangial cell: A glomerular "myofibroblast"? J Am Soc Nephrol 2: S190–S197, 1992[Abstract]
  3. Takahashi K, Hiwada K, Kokubu T: Vascular smooth muscle calponin: A novel anti-alpha-smooth muscle actin monoclonal antibody. Hum Pathol 24: 710–716, 1993[CrossRef][Medline]
  4. Gimona M, Herzog M, Vandekerckhove J, Small JV: Smooth muscle specific expression of calponin. FEBS Lett 274: 159–162, 1990[CrossRef][Medline]
  5. Winder SJ, Walsh MP: Smooth muscle calponin: Inhibition of actomyosin MgATPase and regulation by phosphorylation. J Biol Chem 265: 10148–10155, 1990[Abstract/Free Full Text]
  6. Strasser P, Gimona M, Moessler H, Herzog M, Small JV: Mammalian calponin: Identification and expression of genetic variants. FEBS Lett 330: 13–18, 1993[CrossRef][Medline]
  7. Masuda H, Tanaka T, Takagi M, Ohogami K, Sakamaki T, Shibata N, Takahashi K: Molecular cloning and characterization of human non-smooth muscle calponin. J Biochem 120: 415–424, 1996[Abstract/Free Full Text]
  8. Applegate D, Feng W, Green RS, Taubman MB: Cloning and expression of a novel acidic calponin isoform from rat aorta vascular smooth muscle. J Biol Chem 269: 10683–10690, 1994[Abstract/Free Full Text]
  9. Takahashi K, Nadal-Ginard B: Molecular cloning and sequence analysis of smooth muscle calponin. J Biol Chem 266: 13284–13288, 1991[Abstract/Free Full Text]
  10. Duban J-L, Gimona M, Scatena M, Satore S, Small JV: Calponin and SM22 as differentiation markers of smooth muscle: Spatiotemporal distribution during avian embryonic development. Differentiation 55: 1–11, 1993[CrossRef][Medline]
  11. Miano JM, Olsern EN: Expression of the smooth muscle cell calponin gene marks the early cardiac and smooth muscle cell lineages during mouse embryogenesis. J Biol Chem 271: 7095–7103, 1996[Abstract/Free Full Text]
  12. Samaha FF, Ip HS, Morrisey EE, Seltzer J, Tang Z, Solway J, Permacek MS: Developmental pattern of expression and genomic organization of the calponin-h1. J Biol Chem 271: 395–403, 1996[Abstract/Free Full Text]
  13. Gimona M, Small JV: Calponin.In: Biochemistry of smooth muscle contraction,edited by Baraney M, New York, Academic Press, 1995,pp 91–103
  14. Winder SJ, Walsh MP: Calponin. Curr Topics Cell Regul 34: 33–61, 1996[Medline]
  15. Kake T, Kimura S, Takahashi K, Maruyama K: Calponin induces actin polymerization at low ionic strength and inhibits depolymerization of actin filaments. Biochem J 312: 587–592, 1995
  16. Jiang Z, Grange RW, Walsh MP, Kamm KE: Adenovirus-mediated transfer of the smooth muscle cell calponin gene inhibits proliferation of smooth muscle cells and fibroblasts. FEBS Lett 413: 441–445, 1997[CrossRef][Medline]
  17. Horiuchi A, Nikaido T, Taniguchi S, Fujii S: Possible role of calponin h1 as tumor suppressor in human uterine leiomyosarcoma. Natl Cancer Inst 91: 790–796, 1999[Abstract/Free Full Text]
  18. Yoshikawa H, Taniguchi S, Yamamura H, Mori S, Sugimoto M, Miyado K, Nakamura K, Nakao K, Katsuki M, Shibata N, Takahashi K: Mice lacking smooth muscle calponin display increased bone formation that is associated with enhancement of bone morphogenetic protein responses. Genes Cells 3: 685–695, 1998[Abstract]
  19. Yamabe H, Osawa H, Inuma H, Kaizuka M, Tamura N, Tunoda S, Baba Y, Shirato K, Onodera K: Thrombin stimulates production of transforming growth factor-beta by cultured human mesangial cells. Nephrol Dial Transplant 12: 438–442, 1997[Abstract/Free Full Text]
  20. Harper PA, Robinson JM, Hoover RL, Wright TC, Karnovsky MJ: Improved methods for culturing rat glomerular cells. Kidney Int 26: 875–880, 1984[Medline]
  21. Humphrey MB, Herrera-Sosa H, Gonzalez G, Lee R, Bryan J: Cloning of cDNAs encoding human caldesmons. Gene 112: 197–204, 1992[CrossRef][Medline]
  22. Takahashi K, Tazunoki T, Okada T, Ohgami K, Miwa T, Miki A, Shibata N: The 5'-flanking region of the human smooth muscle cell calponin gene contains a cis-acting domain for interaction with a methylated DNA-binding transcription repressor. J Biochem 120: 18–21, 1996[Abstract/Free Full Text]
  23. Hitoshi N, Ken-ichi Y, Jun-ichi M: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108: 193–200, 1991[CrossRef][Medline]
  24. Yamamura H, Masuda H, Ikeda W, Tokuyama T, Takagi M, Shibata N, Tatsuta M, Takahashi K: Structure and expression of the human SM22{alpha} gene, assignment of the gene to chromosome11, and repression of the promoter activity by cytosine DNA methylation. J Biochem 122: 157–167, 1997[Abstract/Free Full Text]
  25. Nuovo GJ, Gallery F, MacConnell P, Braun A: In situ detection of polymerase chain reaction-amplified HIV-1 nucleic acids and tumor necrosis factor-{alpha} RNA in the central nervous system. Am J Pathol 144: 659–666, 1994[Abstract]
  26. Hara S, Fukatsu A, Suzuki N, Sakamoto N, Matsuo S: The effect of a new immunosuppressive agent, FK506, on the glomerular injury in rats with accelerated nephrotoxic serum nephritis. Clin Immunol Immunopathol 57: 351–362, 1990[CrossRef][Medline]
  27. Johnson RJ, Garcia RL, Pritzl P, Alpers CE: Platelets mediate glomerular cell proliferation in immune complex nephritis induced by anti-mesangial antibodies in the rat. Am J Pathol 136: 369–374, 1990[Abstract]
  28. Yoshimura A, Iwasaki S, Inui K, Ideura T, Koshikawa S, Yanagisawa M, Masaki T: Endothelin-1 and endothelin B type receptor are induced in mesangial proliferative nephritis in the rat. Kidney Int 48: 1290–1297, 1995[Medline]
  29. Gimona M, Herzog M, Vanderkerckhove J, Small JV: Smooth muscle specific expression of calponin. FEBS Lett 274: 159–162, 1990
  30. Takeuchi K, Takahashi K, Abe M, Nishida W, Hiwada K, Nabeya T, Maruyama K: Co-localization of immunoreactive forms of calponin with actin cytoskeleton in platelets, fibroblasts, and vascular smooth muscle. J Biochem 109: 311–316, 1991[Abstract/Free Full Text]
  31. Francesco PS, Loreto G, Giuseppe G, Vincenzo M: Progression of renal damage in human glomerulonephritides: Is there sleight of hand in winning the game. Kidney Int 52: 1439–1457, 1997[Medline]
  32. Savill J and Rees AJ: Mechanisms of glomerular injury.In: Oxford Textbook of Clinical Nephrology,edited by Davison AM, Cameron JS, Grunfeld JP, Kerr DNS, Ritz E, Winearls CG, Oxford, Oxford University Press, 1998,pp 403–439
  33. Johnson RJ: The glomerular response to injury: Progression or resolution? Kidney Int 45: 1769–1782, 1994[Medline]
  34. Simonson MS, Walsh K, Kumar CC, Bushel P, Herman WH: Tow proximal CArG elements regulate SM {alpha}-actin promoter, a genetic marker of activated phenotype of mesangial cells. Am J Physiol 268: F760–F769, 1995[Abstract/Free Full Text]
  35. Hautmann MB, Madsen CS, Owens GK: A transforming growth factor ß (TGF-ß) control element drives TGF-ß-induced stimulation of smooth muscle {alpha}-actin gene expression in concert with two CArG elements. J Biol Chem 272: 10948–10956, 1997[Abstract/Free Full Text]
  36. Ueki N, Ohkawa T, Yamamura H, Takahashi K, Tsutsui T, Kawai Y, Yokoyama Y, Amuro Y, Hada T, Higashino K: Induction of calponin-h1 by transforming growth factor-ß1 in cultured human Ito cells, L190. Biochem Biophys Acta 1403: 28–36, 1998[Medline]
  37. Egido J, Gomez-Chiarri M, Ortiz A, Bustos C, Alonso J, Gomez-Guerrero C, Gomez-Garre D, Lopez-Armada MJ, Plaza J, Gonzalez E: Role of tumor necrosis factor-{alpha} in the pathogenesis of glomerular diseases. Kidney Int 43 [Suppl 39]: S59–S64, 1993
  38. Tomosugi NI, Cashman SJ, Hay H, Pusey CD, Evans DJ, Shaw A, Rees AJ: Modulation of antibody-mediated glomerular injury in vivo by bacterial lipopolysaccharide, tumor necrosis factor, and IL-1. J Immunol 142: 3083–3090, 1989[Abstract]
  39. Hruby ZW, Shirota K, Jothy S, Lowry RP: Antiserum against tumor necrosis factor-alpha and a protease inhibitor reduce immune glomerular injury. Kidney Int 40: 43–51, 1991[Medline]
  40. Shah NM, Groves AK, Anderson DJ: Alternative neural crest cell fates are instructively promoted by TGFß superfamily members. Cell 85: 331–343, 1996[CrossRef][Medline]
  41. Heller RA, Kronke M: Tumor necrosis factor receptor-mediated signaling pathways. J Cell Biol 126: 5–9, 1994[Free Full Text]
Received for publication April 27, 2001. Accepted for publication September 5, 2001.




This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
W. K. Peitsch, I. Hofmann, N. Endlich, S. Pratzel, C. Kuhn, H. Spring, H.-J. Grone, W. Kriz, and W. W. Franke
Cell Biological and Biochemical Characterization of Drebrin Complexes in Mesangial Cells and Podocytes of Renal Glomeruli
J. Am. Soc. Nephrol., June 1, 2003; 14(6): 1452 - 1463.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
T. Morioka, H. Koyama, H. Yamamura, S. Tanaka, S. Fukumoto, M. Emoto, H. Mizuguchi, T. Hayakawa, I. Kojima, K. Takahashi, et al.
Role of H1-Calponin in Pancreatic AR42J Cell Differentiation Into Insulin-Producing Cells
Diabetes, March 1, 2003; 52(3): 760 - 766.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugenoya, Y.
Right arrow Articles by Takahashi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugenoya, Y.
Right arrow Articles by Takahashi, K.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP