 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
1 on Mesangial Cells by Overexpression of Smad7
*Departments of Medicine and Microbiology and Immunology, Medical University of South Carolina, Charleston, South Carolina; and Medical Specialty Service, Ralph H. Johnson VA Medical Center, Charleston, South Carolina.
Correspondence to: Dr. Richard V. Paul, Division of Nephrology, Department of Medicine, Medical University of South Carolina, 171 Ashley Avenue, Charleston, SC 29425. Phone: 803-792-4123; Fax: 803-792-8399; E-mail: paulr{at}musc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 (TGF-1) in many target cells, inhibits TGF-1 signal transduction and is thought to mediate an intracellular negative feedback response that limits TGF-1 effects. It is possible that overexpression of Smad7 could block specified effects of TGF-1 on mesangial cells, a TGF- target in glomerular disease. Smad7 mRNA was induced by TGF-1 within 1 h in a concentration-dependent manner in a transformed mouse mesangial cell (MMC) line. Uptake of 14C-spermidine from the medium by MMC and the transcriptional activity of a segment of the human collagen pro-
2 type 1 chain (COL1A2) promoter fused to a luciferase reporter gene were used as indices of TGF-1. Treatment with TGF-1 increased 14C-spermidine uptake rate in a time-, concentration-, and temperature-dependent manner. For example, exposure to 1 ng/ml TGF-1 for 15 h increased uptake approximately twofold, a response that was attenuated by cycloheximide. Transfection of Smad7 expression vector into MMC abrogated both TGF-1-dependent stimulation of spermidine uptake and COL1A2 promoter activity. It is concluded that: (1) TGF-1 induces Smad7 in MMC; (2) 14C-spermidine uptake is a convenient quantitative index of TGF-1 effect in these cells; and (3) overexpression of Smad7 is a highly effective method of blocking at least some mesangial cell effects of TGF-1 that may warrant evaluation in vivo in experimental glomerular disease. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 (TGF-1) include regulation of cell proliferation, apoptosis, differentiation, and matrix protein synthesis. TGF-1 exerts these effects primarily through modulation of the expression of genes, for example, those of some collagens and other extracellular matrix proteins. The best characterized mechanism by which cellular TGF-1 exposure affects nuclear events is receptor-mediated phosphorylation of specific members of the Smad family of proteins, i.e., Smad2 and Smad3 (1,2). Phosphorylated Smad2 or Smad3 then forms a heteromeric complex with Smad4. This complex is translocated to the nucleus, where it can interact with other transcription factors and/or directly with DNA to alter gene expression (3,4,5).
Within the kidney, extensive evidence indicates an essential role for TGF-1 in the glomerulosclerosis that constitutes the final common pathway in the progression of numerous clinical and experimental kidney diseases (6–9). For example, experimental gene transfer of TGF-1 into the glomerular mesangium of normal mice is sufficient to produce progressive glomerulosclerosis (10). Therefore, the TGF-1 signaling cascade in mesangial cells constitutes a potential therapeutic target in renal diseases of diverse origins. Most current knowledge about TGF-1 signaling in general is derived from experiments in 3T3 fibroblast or mink lung epithelial cell lines. However, activation of an intact initial Smad pathway by TGF-1 exposure has been demonstrated by Poncelet et al. (11) in human mesangial cells. These investigators also showed that certain downstream cellular responses to TGF- can be blocked by transfection of a dominant negative Smad3 mutant.
One gene in which transcription is stimulated in many cells by TGF-1 is Smad7 (12,13). This inhibitory Smad prevents signal transduction to the nucleus by blocking the association of Smad2 with the TGF-1 receptor complex (14). The inducibility of Smad7 by TGF-1 suggests that Smad7 functions as an intracrine negative feedback modulator of TGF-1 action. Because Smad7 is a specific endogenous inhibitor of TGF-1 actions, modulation of its expression might be an attractive, physiologically based strategy to block TGF-1 effects in the mesangium. Smad7 gene transfer has already been successfully employed to abrogate experimental bleomycin-induced pulmonary fibrosis in mice (15). However, signaling molecules other than Smads may be activated by TGF-1 in mesangial cells, e.g., mitogen-activated protein (MAP) kinases (16) and protein kinase A (17). These pathways would not be expected to be susceptible to overexpressed Smad7. Some important downstream effects of TGF-1 in other cell lines, such as the induction of fibronectin mRNA in a human fibrosarcoma cell line (18), do appear to be independent of Smad pathways.
The goals of this study were to determine if Smad7 is upregulated by TGF-1 in mesangial cells and to characterize the functional ability of overexpression of Smad7 to block selected effects of TGF-1 in these cells. We reasoned that demonstration of the ability of Smad7 to block a given cellular effect of TGF-1 would indicate a requirement for intact Smad signaling to produce that effect, even if other signaling pathways may be involved.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1–dependent changes in spermidine uptake (see below). This observation may result from the inclusion of small quantities of the spermidine precursor, putrescine, in the latter medium. Rat glomeruli were obtained by sieving of male Sprague-Dawley rat renal cortex as described previously (19). Isolated glomeruli were incubated in RPMI 1640 medium supplemented with 20% FBS, and mesangial cells were isolated by serial passage in this medium. Rat aorta smooth muscle cells were isolated from aortic explants from the same strain of animals and grown in MEM (Life Technologies BRL) containing 10% FBS, as described previously (20). All cell culture media contained antibiotics (100 U/ml penicillin and 0.1 mg/ml streptomycin).
Spermidine Uptake Activity
The polyamines, spermidine and spermine, have been determined to be necessary for some effects of TGF-1 to be exerted in other cell systems (21,22). In a previous study (Chen et al., unpublished observations), we observed that TGF-1 upregulated spermidine content in pulmonary artery smooth muscle cells by stimulating both its synthesis and uptake. To measure spermidine uptake in the present study, MMC or rat mesangial or vascular smooth muscle cells were grown to confluence in 12-well plates and maintained in serum-free medium supplemented with 0.5% bovine serum albumin (BSA) for 48 h. The cells were treated with TGF-1 or its vehicle for the indicated duration before the medium was replaced with fresh serum-free medium supplemented with 0.5% BSA. 14C-spermidine trihydrochloride was added to each well to the final concentration of 3 µM and incubated with cells for 30 min at 4°C and 37°C. The uptake of spermidine into MMC was linear for at least 45 min (data not shown). At the end of the incubation period, medium containing residual 14C-spermidine was aspirated, and cells were placed on ice and rinsed with phosphate-buffered saline. The cells were then digested for 1 h at room temperature with 200 µl/1 N NaOH and then neutralized with 200 µl/1 N acetic acid. Radioactivity was determined using a Packard (Meriden, CT) liquid scintillation counter. The specific component of uptake was determined by subtracting cell-associated radioactivity after 4°C incubation from that after 37°C incubation. The spermidine uptake activity in MMC was increased 40- to 60-fold at every time point by raising the incubating temperature from 4°C to 37°C, indicating that the observed spermidine transport was dependent on cellular metabolic activity (data not shown).
Plasmids, Transfection, and Promoter Activity
Smad7 cDNA (a generous gift from Wylie Vale, Salk Institute, La Jolla, CA) was subcloned into the expression vector pcDNA3.1(+) (Invitrogen) and verified by sequencing. The sequence of a 353-bp promoter segment of collagen pro-2 type 1 chain (COL1A2) was previously reported (23). The promoter-luciferase construct, p353Lux, was obtained by cloning this 353 bp into the pGL2-Basic vector (Promega Corp., Madison, WI). Transient transfection was carried out using Exgen 500 (USA Fermentas, Hanover, MD) per manufacturer’s instructions (0.5 µg cDNA per well:4 µl Exgen 500 solution). Cells were transfected in growth medium at approximately 80% confluency; the medium was changed to serum-free medium at 24 h, and experimental maneuvers were undertaken after 24 more hours. Green fluorescent protein (GFP) in the vector, pEGFP-N3 (Clontech, Palo Alto, CA), and the Exgen 500 reagent were used to assess transfection efficiency. Efficiency (2.5% ± 0.7%; n = 7) was determined 48 h after transfection by flow cytometry using a FACStar Plus (Becton Dickinson, San Jose, CA) with INNOVA 70-4 argon laser tuned to 488 nm. The effect of TGF-1 on luciferase expression or spermidine uptake in transfected cells was determined by incubation with TGF-1 or control serum-free medium at the indicated times and concentrations, beginning 48 h after transfection. Luciferase activity was measured with a commercial assay kit (Promega Corp., Madison, WI) per manufacturer’s instructions.
Western Blot Analyses
Cell lysates were prepared by dissolving MMC with sodium dodecyl sulfate (SDS) sample buffer (62.5 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 50 mM dithiothreitol; and 0.1% bromophenol blue). Lysates were sonicated briefly, boiled for 5 min, and chilled on ice. For Western blot analyses, aliquots containing equal volume of cell lysates were fractionated on a 4 to 20% Tris-glycine gel (Novex, San Diego, CA) and transferred to PVDF membranes (Millipore, Bedford, MA). To detect Smad7 expression, a commercial polyclonal antiserum against Smad7 (Santa Cruz Biotechnology, Santa Cruz, CA) was used as the primary antibody. After incubation with alkaline-phosphatase–conjugated anti-rabbit IgG, the blots were developed using the CDP-STAR chemiluminescent substrate system (New England Biolabs, Beverly, MA) and exposed to Kodak X-O-Mat film (Eastman Kodak, Rochester, NY). Activation of the p42 and p44 mitogen-activated protein kinases ERK1 and ERK2 was detected by incubating blots with a phospho-specific anti-ERK antiserum from New England Biolabs, and developing them with the CDP-STAR system as described above.
Ribonuclease Protection Assay (RPA)
To generate the Smad7 antisense riboprobe, a PCR (sense primer, ggatcggtcacactggtg; antisense primer, atgaagatggggtaactgctg) product was cloned into pCR II-TOPO (Invitrogen, Carlsbad, CA). The Smad7 segment was excised from pCR II-TOPO vector with HindIII/XbaI and ligated into pBluescript II KS (Stratagene, La Jolla, CA). The resulting construct was linearized with XbaI for in vitro transcription using T3 polymerase. RPA was carried out using RPAII kit (Ambion, Austin, TX). The reaction products were separated on 6% TBE urea gels (Novex). Bands on the dried gels were identified and quantitated with a Storm Imager (Molecular Dynamics, Sunnyvale, CA).
Statistical Analyses
Quantitative data are presented as mean ± SD from the indicated number of studies. Statistical analyses were performed with commercial microcomputer software (StatView, Abacus Concepts, Berkeley, CA) using ANOVA, with post-hoc t test when indicated.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 Increased Smad7 mRNA in MMC1 exposure increased the content of Smad7 mRNA in MMC in a concentration-dependent manner within 1 h of exposure. TGF-1 treatment for 90 min also caused an increase in Smad7 mRNA content in rat aorta smooth muscle cells (150% over basal after exposure to 10 ng/ml TGF-1), and rat mesangial cells (127% over basal after exposure to 1 ng/ml TGF-1; 49% over basal after exposure to 10 ng/ml).
|
1 Increased Spermidine Uptake Activity in MMC1 (1 ng/ml) treatment, peaked at 15 h, and remained elevated at 37 h (Figure 2A). Kinetic analyses showed that this effect was due to an increase in Vmax of the putative transporter, because Km remained constant at 0.9 µM (data not shown). Spermidine uptake increased in response to increasing concentrations of TGF-1 (Figure 2B); the concentration that caused a half-maximal increase in uptake activity was approximately 0.5 ng/ml. TGF-1 caused a similar concentration-dependent increase in spermidine uptake activity in primary mesangial cells and aortic smooth muscle cells (Figure 2C). Interestingly, the basal uptake of spermidine, as well as the magnitude of the stimulation produced by TGF-1, was lower in the primary cell lines, which grow more slowly than MMC cells.
|
1 Induction of Spermidine Activity Required New Protein Synthesis–inducible spermidine uptake but did not affect the basal activity, indicating that the TGF-1–dependent increase in spermidine uptake activity required new protein synthesis.
|
1 Induction of 14C-Spermidine Uptake1 in MMC. To test this, we transfected the Smad7 expression construct into MMC before TGF-1 stimulation. Immunoblotting was carried out to ensure that the transfected Smad7 gene was appropriately expressed. As expected, in Smad7 gene-transfected MMC, there was a marked increase in the content of Smad7 protein relative to mock-transfected controls (Figure 4B). As shown in Figure 4A, transfection of Smad7 significantly abrogated the induction of 14C-spermidine uptake by TGF-1, but it had no significant effect on the basal uptake activity. The effect was due to the Smad7 gene, not the vector, because transfection of empty vector did not produce any effect. The effect was also dependent on the transfection conditions, because use of other cationic lipid transfection reagents with the Smad7 vector produced lesser degrees of blockade (data not shown).
|
1 can activate MAP kinases in mesangial cells (5). To test the specificity of the Smad7 effect on spermidine uptake, we used the ERK kinase inhibitor PD98059 (100 µM). This concentration effectively inhibited the phosphorylation of the MAP kinases ERK1 and ERK2 in cultured mesangial cells, as indicated by immunoblotting with phosphorylation state-specific antiserum. We found that PD98059 did not affect the TGF-1–dependent increase in spermidine uptake (data not shown). Therefore, activation of the Smad pathway but not the MAP kinase pathway appears to be required for TGF-1 stimulation of spermidine uptake.
Cotransfection of Smad7 Gene Blocked the TGF-1 Induction of COL1A2 Promoter Activity
MMC transfected with p353Lux displayed a more than twofold increase in luciferase activity in response to TGF-1 stimulation. Although basal activity was not affected, the TGF-1–dependent increase was blocked by cotransfection with Smad7 cDNA (Figure 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
signaling, is present and upregulated by TGF-1 in mesangial cells. The direction of regulation is appropriate to support the proposition that Smad7 functions as a negative feedback influence on TGF-1 actions in these cells, as it presumably does in fibroblasts and other target tissues (1).
To demonstrate the effects of overexpression of Smad7, we used two independent measures of TGF-1 effects on mesangial cells, i.e., activity of a segment of the COL1A2 promoter and spermidine uptake. The 353-bp COL1A2 promoter segment we used in the reporter analysis contains a consensus Smad-binding element. In human skin fibroblasts, the interaction of Smad3/Smad4 with this element is required for activation of the COL1A2 promoter by TGF-1 (24). Other investigators have suggested a role for MAP kinases in the regulation of collagen expression by mesangial cells (16). Although a potential contribution from other TGF-–activated signaling pathways to collagen expression in general was not excluded by our current experiments, the blockade of TGF-1–dependent induction of COL1A2 promoter activity by Smad7 in MMC is consistent with the requirement for Smad3/Smad4 activation of this particular promoter segment in human fibroblasts.
In either experimental or human glomerular disease, appreciable expression of type I collagen in glomeruli is pathognomonic of glomerulosclerosis. Therefore, the potential relevance of COL1A2 promoter activity in glomerulosclerosis is clear. The relevance of our novel finding of a stimulatory effect of TGF-1 on polyamine uptake may appear less direct. The polyamines, spermidine and spermine, and their diamine precursor, putrescine, are low molecular weight organic cations that are important for many cellular functions, including proliferation, apoptosis, differentiation, and migration (25). These processes are all regulated by TGF-, and indeed polyamines are required for the effects of TGF-1 to be exerted in some cell systems (21,22). One plausible mechanism for the requirement for polyamines is that spermidine is required for the synthesis of hypusine, which is in turn required for the assembly of initiation factor 5A (26). Therefore, there is reason to believe that polyamines can be limiting factors in protein synthesis, presumably including the synthesis of matrix proteins.
Therefore, the stimulation of spermidine uptake by TGF-1 may be an important and previously underappreciated mechanism of its action in mesangial and other cells. The fact that the response took several hours and could be blocked by cycloheximide suggests that it was mediated by an increase in the net synthesis of polyamine transporters. Unfortunately, this hypothesis is difficult to test at present because the molecular identity of the putative transporter(s) is not known. Nevertheless, we found that the 14C-spermidine uptake assay was reproducible, robust, and technically straightforward. In parallel experiments with the MAP kinase kinase inhibitor, PD98059, we were able to exclude any significant role for the p42 and p44 ERK in this response. We therefore suggest that measurement of polyamine uptake may be useful in future investigations in mesangial cells as a convenient index of TGF- action that is directly dependent on an intact Smad pathway.
The ability of transfected Smad7 to block specific TGF- effects in mesangial cells has important implications. These findings suggest that delivery of a Smad7 expression construct to glomerular mesangial cells in vivo, if technically feasible, could potentially abrogate TGF-–mediated glomerulosclerosis. Several other approaches to blocking glomerular TGF- actions in vivo have been reported, including gene therapy by induction of decorin expression in skeletal muscle (27) or administration of TGF-–neutralizing antibody (28). Gene therapy could be preferable to administration of proteins because of the potential for long-lasting or permanent effects from a single treatment.
Other previously reported examples of a gene transfer approach to blocking TGF- actions include overexpression of dominant negative Smad3 in cultured mesangial cells (11) and dominant negative TGF- type II receptors in cultured adipocytes (29) or in transgenic mice (30). Dominant negative constructs must ordinarily outnumber their target molecules to be effective. One potential advantage of using Smad7 for gene transfer, versus a dominant negative approach, is that lesser degrees of overexpression may suffice for the naturally occurring inhibitor Smad7. Indirect support for this hypothesis is suggested by our transfection efficiency measurements. Using the same transfection conditions for the Smad7 and GFP expression constructs, only 2.5% of GFP-transfected cells demonstrated an unequivocal fluorescence signal in the flow cytometer. This finding contrasts with the major degree of blockade that Smad7 transfection was found to exert on stimulation of spermidine uptake, which should represent the total activity of both transfected and nontransfected cells. One possible explanation for this disparity relates to the sensitivity of the method used to measure transfection efficiency. If significant Smad7 action requires much less gene expression than does detection of GFP fluorescence, low-level Smad7 transfection of a majority of cells might have been responsible for our findings. Alternatively, it is conceivable that Smad7 release by a few cells with high expression levels could have suppressed TGF-1 responsiveness in their neighbors. Direct comparison of the effectiveness of Smad7 with dominant negative receptor or Smad3 expression constructs may be of interest in future in vitro and in vivo studies.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor and phosphorylation is required for nuclear accumulation and signaling. Cell 87: 1215–1224, 1996[CrossRef][Medline]
in glomerulonephritis. J Int Med Res 25: 71–80, 1997[Medline]
This article has been cited by other articles:
 |
|
 |
|
  M. Ruiz-Ortega, M. Ruperez, V. Esteban, J. Rodriguez-Vita, E. Sanchez-Lopez, G. Carvajal, and J. Egido Angiotensin II: a key factor in the inflammatory and fibrotic response in kidney diseases Nephrol. Dial. Transplant., January 1, 2006; 21(1): 16 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Rodriguez-Vita, E. Sanchez-Lopez, V. Esteban, M. Ruperez, J. Egido, and M. Ruiz-Ortega Angiotensin II Activates the Smad Pathway in Vascular Smooth Muscle Cells by a Transforming Growth Factor-{beta}-Independent Mechanism Circulation, May 17, 2005; 111(19): 2509 - 2517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Satoguina, E. Weyand, J. Larbi, and A. Hoerauf T Regulatory-1 Cells Induce IgG4 Production by B Cells: Role of IL-10 J. Immunol., April 15, 2005; 174(8): 4718 - 4726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-C. Hou, W. Wang, X. R. Huang, P. Fu, T.-H. Chen, D. Sheikh-Hamad, and H. Y. Lan Ultrasound-Microbubble-Mediated Gene Transfer of Inducible Smad7 Blocks Transforming Growth Factor-{beta} Signaling and Fibrosis in Rat Remnant Kidney Am. J. Pathol., March 1, 2005; 166(3): 761 - 771. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Vrljicak, D. Myburgh, A. K. Ryan, M. A. van Rooijen, C. L. Mummery, and I. R. Gupta Smad expression during kidney development Am J Physiol Renal Physiol, April 1, 2004; 286(4): F625 - F633. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Y. Lan, W. Mu, N. Tomita, X. R. Huang, J. H. Li, H.-J. Zhu, R. Morishita, and R. J. Johnson Inhibition of Renal Fibrosis by Gene Transfer of Inducible Smad7 Using Ultrasound-Microbubble System in Rat UUO Model J. Am. Soc. Nephrol., June 1, 2003; 14(6): 1535 - 1548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Mason and N. A. Wahab Extracellular Matrix Metabolism in Diabetic Nephropathy J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1358 - 1373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kanasaki, D. Koya, T. Sugimoto, M. Isono, A. Kashiwagi, and M. Haneda N-Acetyl-Seryl-Aspartyl-Lysyl-Proline Inhibits TGF-{beta}-Mediated Plasminogen Activator Inhibitor-1 Expression via Inhibition of Smad Pathway in Human Mesangial Cells J. Am. Soc. Nephrol., April 1, 2003; 14(4): 863 - 872. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. W. Schnaper, T. Hayashida, S. C. Hubchak, and A.-C. Poncelet TGF-beta signal transduction and mesangial cell fibrogenesis Am J Physiol Renal Physiol, February 1, 2003; 284(2): F243 - F252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. Sharpe and B. M. Hendry Signaling: Focus on Rho in Renal Disease J. Am. Soc. Nephrol., January 1, 2003; 14(1): 261 - 264. [Full Text] [PDF]
|
|
|
|
|
|
H. W. Schnaper, T. Hayashida, and A.-C. Poncelet It's a Smad World: Regulation of TGF-{beta} Signaling in the Kidney J. Am. Soc. Nephrol., April 1, 2002; 13(4): 1126 - 1128. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
) or its vehicle (
) for 15 h. The spermidine uptake activity was then determined. *P < 0.05, ANOVA with post hoc comparisons corrected by the Scheffe method. Values shown are the mean ± SD from the indicated number of replicates. The entire experiment was repeated once with similar results. Experiments using higher concentrations of cycloheximide showed that this agent diminished basal as well as TGF-
