 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
Institutes of *Physiology and Anatomy, University Regensburg, Regensburg, Germany.
Correspondence to: Dr. Hayo Castrop, Institut für Physiologie, Universität Regensburg, D-93040 Regensburg, Germany. Phone: 49-941-9432962; Fax: 49-941-9434315; E-mail: wolf.castrop{at}vkl.uni-regensburg.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
Cyclooxygenase-1 and -2 (Cox-1 and Cox-2), which are the two known isoforms of the cyclooxygenase, are the key enzymes for the formation of prostanoids. Cox-1 and Cox-2 catalyze the synthesis of prostaglandin H2, which is then converted into the different prostanoids (11,12).
Both Cox-1 and Cox-2 are constitutively expressed in the kidney, and they show different and species-dependent expression patterns. The intrarenal localization of Cox-1 is quite similar in most species so far examined, with highest expression in the collecting ducts and lower expression in blood vessels (13). In the inner medulla of the kidney of humans and rats, Cox-1 expression has also been demonstrated for medullary interstitial cells (13). The inner medulla was shown to be the site of the highest expression of the cyclooxygenases in the kidney of all species so far examined (13).
In contrast to Cox-1, differences exist in the expression pattern of Cox-2 between different species. In the renal cortex of rat, rabbit, and dog, Cox-2 has been reported to be expressed in the macula densa and surrounding cells of the thick ascending limb of Henle (13–19), whereas glomerular podocytes and blood vessels appear as the major sites of expression in the cortex of the kidney of humans and monkeys (13,15). In the medulla of the rat, Cox-2 is expressed in interstitial cells and at lower levels in the collecting ducts (13,15).
A number of reports exist describing the regulation of the expression of the Cox isoforms in the renal cortex, but less information is available concerning the renal medulla. Thus, Cox-2 expression in the macula densa and surrounding cells of the cTALH has been reported to be increased by a low-salt diet (14), by inhibition of the renin-angiotensin system (16,17), by renal hypoperfusion (18), or by furosemide treatment (19). A high-salt diet on the other hand has been shown to reduce Cox-2 expression in the kidney cortex (20,21). None of these conditions changed the expression of Cox-1 in the renal cortex (16–21).
In the kidney medulla, both Cox-1 and Cox-2 are downregulated by low-salt diet (20,21). Conversely, their expression is stimulated by high-salt diet (20,21), and as far as Cox-2 is concerned, by water deprivation (22,23). Conflicting data exist about the expression of Cox-1 in states of water deprivation, which were reported not to influence (22) or to increase Cox-1 expression in the renal medulla of rats (23). The expression of Cox-2 of cultured inner medullary collecting duct (IMCD) cells has been shown to be dependent on the osmolarity of the medium, in such way that high osmolarities lead to an increased expression of Cox-2 (20,24).
It is well known that loop diuretics like furosemide enhance the renal excretion of prostanoids (25,26). We have previously found that loop diuretics, in fact, moderately increase Cox-2 expression in the cTALH and macula densa region (19). The renal medulla is the main site of formation of prostanoids within the kidney (27,28); it is, therefore, conceivable that loop diuretics also enhance the expression of cyclooxygenases in the medulla. On the other hand, loop diuretics are known to lower the tonicity in the renal medulla (29). It has been proposed that the expression of Cox-2 in the renal medulla changes in parallel with the tonicity (22–24); it is, therefore, also conceivable that loop diuretics could downregulate the expression of cyclooxygenases in the renal medulla.
In contrast to the renal cortex, the influence of furosemide treatment on the expression of the Cox isoforms in the renal medulla, which is the main site of Cox expression (13), has not yet been determined in detail. We, therefore, examined the influence of chronic furosemide infusion on the mRNA and protein expression of both Cox-1 and Cox-2 in different kidney zones of the rat. We found a stimulation of Cox-2 expression in the cortex after chronic furosemide treatment, whereas Cox-1 expression remained unchanged in this zone of the kidney. In contrast, furosemide treatment led to a reduced expression of Cox-2 in the inner medulla and a markedly reduced expression of the highly abundant Cox-1, which was paralleled by a decreased tissue concentration of PGE2.
These data suggest that downregulation of the expression of Cox-1 and to a lesser extent of Cox-2 leads to reduced concentrations of PGE2 in the kidney inner medulla during chronic furosemide treatment. This effect is likely related to the breakdown of the papillary osmotic gradient induced by loop diuretics.
|
Methods and Materials |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
Four groups of rats were treated as follows:
All animals were fed with normal rat chow (Altromin, Lage, Germany) containing 0.6% NaCl.
Organ Sampling
Animals were killed by decapitation, and the kidneys were removed. The kidneys were cut in longitudinal halves. From one of these, halves kidney zones were separated under a stereomicroscope. Pieces of kidney zones were frozen in liquid nitrogen and stored at -80°C until isolation of protein or total RNA. The second half was used for in situ hybridization and immunohistochemistry.
Extraction of RNA
Total RNA was extracted from dissected kidney zones basically according to the acid-guanidinium-phenol-chloroform protocol by Chomczynski and Sacchi (30). RNA pellets were dissolved in diethylpyrocarbonate-treated water, the yield of RNA was quantified by spectroscopy at 260 nm, and samples were aliquotated and stored at -80°C until further processing. The quality of extracted RNA was confirmed by the observation of intact 18S and 28S rRNA bands after gel electrophoresis in an ethidium bromide-stained agarose gel.
Ribonuclease Protection Assays for Cox-1, Cox-2, and Cytoplasmic 
-Actin mRNA
Cox-1, Cox-2, and -actin mRNA levels were measured by RNase protection assays basically as described (16). In brief, after linearization and phenol/chloroform purification, the plasmids yielded radiolabeled antisense cRNA transcripts by incubation with SP6 polymerase (Promega Corporation, Mannheim, Germany) and 
-(32) P-GTP (Amersham-Pharmacia, Piscataway, NJ) according to the Promega riboprobe in vitro transcription protocol. The lengths of the cRNA transcripts were 394, 227, and 351 bp for Cox-1, Cox-2, and -actin, respectively. Five times 105 cpm of the cRNA probes were hybridized with 20 µg of total RNA (Cox-1 and Cox-2 cohybridized), 1 µg of total RNA (-actin), or 20 µg of tRNA (negative control) at 60°C overnight and were then digested with RNase A/T1 (RT/30 min) and proteinase K (37°C/30 min). After phenol/chloroform extraction and ethanol precipitation, protected fragments (370, 203, and 303 bp in length for Cox-1, Cox-2, and -actin, respectively) were separated on a 8% polyacrylamide gel. The gel was dried for 2 h, and bands were quantified in a Phosphoimager (Instant Imager 2024, Packard, Meriden, CT), and autoradiography was performed at -80°C for 1 to 3 d.
In Situ Hybridization for Cox-1 mRNA
For in situ hybridization, radioactive sense and antisense probes for Cox-1 were produced according to the Promega riboprobe in vitro transcription protocol using T7 or SP6 polymerase, respectively. The same purified plasmid was used as described for RNase protection assay. Labeling was performed by the use of -35S-UTP (Amersham-Pharmacia).
Cryosections (16-µm) of the kidneys were prepared at -20°C and fixed in 4% paraformaldehyde. After acetylation (0.25% acetic anhydride, 0.1 M triethanoleamine, 0.15 M NaCl), sections were dehydrated by alcohols and air-dried. After prehybridization for 3 h, sections were incubated with 100 µl of hybridization buffer (50% formamide, 0.75 M NaCl, 25 mM PIPES, 25 mM ethylenediaminetetraacetic acid [EDTA], 0,1% Ficoll, 0,1% polyvinylpirrolidone, 25 mM bovine serum albumin [BSA], 10% dextrane sulfate, 250 µg/ml herring sperm DNA, 250 µg/ml yeast tRNA) containing 2 x 106 cpm of the specific probe at 50°C for 14 h. Sections were twice washed with 4x sodium chloride sodium citrate buffer (SSC), and unhybridized probe was digested by RNase A treatment (37°C, 30 min) in RNase buffer (40 µg RNase A/ml, 0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA) followed by washing in the same buffer without RNase (37°C, 30 min). Washed sections (2x SSC, two times; 50°C) were dehydrated by alcohols and exposed to x-ray films (Biomax MS; Kodak, Rochester, NY) for 1 to 3 d.
Microdissection of IMCD and RT-PCR of Cox-1 mRNA
Nephron segments for RT-PCR were obtained by a modified collagenase digestion protocol by Schafer et al. (31). In brief, the anesthetized animals were decapitated, and both kidneys were removed. The inner medulla was carefully isolated and cut in small pieces of 1 to 2 mm in a direction parallel to the tubules. The obtained pieces were incubated in 2 ml of collagenase solution (0.5 mg/ml type 2 collagenase, 5 mM glycine, 50 U/ml DNAse, and 48 µg/ml soybean trypsin inhibitor in MEM) at 37°C. In 25-min intervals, the supernatant containing nephron fragments was poured off into 2 ml of chilled BSA-solution (1% BSA in MEM). Fresh collagenase solution was added to the remaining renal tissue, and the incubation was continued with supernatant removal in 25-min intervals. After supernatant removal, the nephron segments sedimented in the tube containing BSA solution. To remove the collagenase, the supernatant was again poured off and 2 ml of chilled BSA solution were added. Fractions 3 to 6 were stored on ice and transferred into a tissue culture dish (diameter, 35 mm). Before collecting IMCD, the digested tissue pieces were further microdissected with sharpened forceps. IMCD carefully were moved to a free area of the dish under a stereomicroscope and then transferred to a new tissue culture dish containing 0.25% BSA solution. At least 11 mm of IMCD were pooled. Collected tubules were transferred to 400 µl of GTC solution (guanidine thiocyanate [4 M] containing 0.5% N-lauryl-sarcosinate, 10 mmol/L EDTA, 25 mmol/L sodium citrate, 700 mmol/L -mercaptoethanol), and 12 µg of yeast tRNA were added as a carrier. Samples were stored at -80°C until extraction of RNA.
Total RNA was extracted according to the protocol by Chomczynski and Sacchi (30). The resulting RNA pellets were finally dissolved in 9 µl of diethylpyrocarbonate-treated water and used for reverse transcription using standard RT protocol. Resulting cDNA samples were diluted to a final concentration of 1 mm tubules/2 µl. PCR were performed in a total volume of 20 µl in the presence of 2 µl (1:1) of cDNA equivalent to 1 mm tubule, 0.2 µl (1:10) of cDNA, and 0.02 µl (1:100) of cDNA. Negative controls included water instead of cDNA in the PCR, and yeast tRNA with no further addition of RNA in the RT. PCR was run with 1 min/94°C denaturation, 1 min/60°C annealing, and 1 min/72°C extension using standard PCR protocols. PCR amplification was done with the following primers: cgggatccgaaatggctgcagagttg and ggaattctcatctagtctggagtgg for Cox-1 (30 cycle); cgggatccccggcctaggcaccagggtg and ggaattcggctggggtgttgaaggtctcaaa for -actin (28 cycles).
Immunoblotting
The inner medulla was homogenized in a sample buffer containing 2% sodium dodecyl sulfate (SDS), 10% glycerin, 125 mM Tris-HCl, 1mM EDTA and was then centrifuged at 10000 x g for 10 min. The supernatants were used in the following experiments. The protein concentration was measured by a Bio-Rad DC protein microassay (Bio-Rad Laboratories, Hercules, CA). Forty milligrams of protein were separated by SDS-PAGE in 10% Laemmli minigels and then electrophoretically transferred to P-Immobilon membranes (Millipore, Eschborn, Germany). To detect immunoreactive proteins, the blots were first blocked (phosphate-buffered saline, pH 7,2; 0.05% Tween [Sigma, St. Louis, MO]; 10% horse serum [Boehringer, Mannheim, Germany]), and finally a Cox 1 antibody (Santa Crux, CA; dilution 1:100) was applied for 2 h. A horseradish peroxidase-conjugated donkey anti-mouse and donkey anti-goat Ig antiserum (1:1000; Dianova, Hamburg, Germany) served as detecting antibody and was applied for 45 min. The staining reaction was started by addition of 0.5 mg/ml diaminobenzidine, 0.02% H202, and 0.03% cobalt chloride dissolved in citrate buffer, pH 6,3. The reaction was stopped by washing the membrane in tap water. Determination of apparent molecular weight was performed in conjunction with broad range molecular weight standard proteins (Bio-Rad Laboratories).
Cox-1 and Aquaporin-2 Immunoreactivity
After fixation in methyl-Carnoy solution (60% methanol, 30% chloroform, and 10% acetic acid), tissues were dehydrated by bathing in increasing concentrations of methanol, followed by 100% isopropanol. The tissue was embedded in paraffin, and 4-µm sections were cut with a Leitz SM 2000R microtome (Leica instruments, Oberkochel, Germany). After deparaffinization, endogenous peroxidase activity was blocked with 3% H2O2 in methanol for 20 min at room temperature. Sections were layered with the primary antibodies (Santa Crux, CA; dilution 1:1000) and incubated at 4°C overnight. After addition of the second antibody (dilution 1:1000; biotin-conjugated, goat anti-rabbit IgG or rabbit anti-goat IgG for Cox-1 and aquaporin-2, respectively), the sections were incubated with avidin D horseradish peroxidase complex (Vectastain DAB kit; Vector Laboratories, Burlingame, CA) and exposed to 0.1% diaminobenzidine tetrahydrochloride and 0.02% H2O2 as a source of peroxidase substrate. Each slide was counterstained with hematoxylin. As a negative control, we used the second antibodies only without incubation with the primary antibody.
Determination of Prostaglandin E2 in Kidney Tissues
For determination of PGE2 in cortex or inner medullary kidney tissue, frozen tissue pieces (50 to 150 mg) were homogenized in 1 ml of 0.9% NaCl solution. Homogenates were centrifuged for 10 min (12,000 x g; 4°C), and 100 µl of the supernatants was used for determination of PGE2 by enzyme-immunoassay (Cayman, San Diego, CA).
Determination of Urine Osmolarity
Urinary osmolarity was measured by depression of the freezing point using a semimicro-osmometer (Knauer, Berlin, Germany).
Cell Culture Experiments
Mouse IMCD cells (IMCD-3, CRL-2123, American Type Culture Collection [ATCC], Manassas, VA) (32) were kept in DMEM/HAM’s F-12 (1:1) medium (Biochrom, Berlin, Germany) with 5% fetal calf serum in 75-cm2 flasks under room air with 5% CO2 at 37°C. Medium was changed every second day. Osmolarity was changed in 100 mosmol/L steps by addition of NaCl. Cells were kept at the final osmolarities for 24 or 48 h before extraction of RNA. The PGE2 concentration of the medium was determined by enzyme-immunoassay (Cayman). In additional experiments, furosemide was added to the medium at concentrations of 10, 100, and 1000 µmol/L.
Statistical Analyses
Data are presented as mean ± SE. Levels of significance were calculated by ANOVA followed by Benferoni’s test for multiple comparisons. P < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
|
Cox-2 mRNA expression in the kidney cortex was stimulated twofold in rats treated with furosemide compared with untreated controls. In the inner medulla, furosemide infusion led to a reduced expression of Cox-2 (to approximately 60% of the control level), whereas no changes were observed in the outer medulla (Figure 1, lower panel).
Furosemide treatment did not alter the expression of cytoplasmic -actin mRNA in any kidney zone (not shown).
To confirm the distribution of Cox-1 mRNA in the inner medulla and its downregulation after furosemide infusion, we performed in situ hybridization for Cox-1 mRNA. With in situ hybridization, we found a strong signal for Cox-1 mRNA in the kidney inner medulla of untreated rats that was markedly reduced after chronic furosemide infusion (Figure 2), which confirms the data of the RNase protection experiments.
|
|
To determine if the changes of Cox-1 mRNA levels also led to changes of protein levels, we semiquantified the overall Cox-1 protein abundance in the inner medulla by Western blot analyses. Moreover, to find out the exact localization of the Cox-1 protein in the inner medulla we analyzed the distribution of Cox-1 protein by immunohistochemistry.
Influence of Furosemide Treatment on Cox-1 Protein Abundance in the Kidney Inner Medulla
In accordance with the changes of Cox-1 mRNA, Cox-1 protein, as semiquantified by Western blot analyses, was reduced in the renal inner medulla of rats under furosemide treatment compared with rats under control conditions (Figure 4). As shown in Figure 5, this result was confirmed by immunohistochemistry localizing the Cox-1 protein to collecting ducts and to single interstitial cells. In furosemide-treated rats, Cox-1 immunoreactivity was clearly reduced both in collecting ducts and in interstitial cells. No staining was observed for the negative control.
|
|
Influence of Furosemide Treatment on PGE2 Concentration
The lower Cox-1 mRNA and protein levels in the inner medulla of furosemide-treated compared with untreated rats were paralleled by a reduced concentration of PGE2 in the inner medullary tissue of approximately 30% of the level in untreated rats (Figure 6). 2
|
The markedly reduced expression of Cox-1 and the lowered PGE2 concentration in the inner medulla under furosemide treatment led us to consider the possible mechanism by which furosemide influences the expression of Cox. The expression of Cox-2 in the inner medulla has already been shown to be influenced by the osmolarity (22–24), and we found in this study that furosemide reduced the osmolarity of the urine from 1550 ± 108 mosmol/L in untreated to 480 ± 33 mosmol/L in furosemide-treated rats; we, therefore, considered the possibility that it may be the low osmolarity that causes the downregulation of Cox-1 and to a lesser extent of Cox-2 expression in the inner medulla.
To clarify the question of whether it is the lowered osmolarity that reduces the expression of Cox-1 and to a lesser extent of Cox-2, we performed additional in vivo studies using water loading to reduce the tonicity of the inner medulla by a second experimental maneuver.
Influence of Water Loading on the mRNA Expression of Cox-1 and Cox-2 and the PGE2 Content of the Inner Medulla
Water loading of the rats by offering a sucrose solution (40 g/L) increased the water intake from 18 ± 3 ml/d (tap water) to 73 ± 5 ml/d (succrose solution) and lowered urine osmolarity from 1530 ± 110 mosmol/L in untreated to 690 ± 55 mosmol/L in water loaded animals. Water loading reduced the mRNA expression of Cox-1 to 50% of the control level but only slightly reduced the mRNA expression of Cox-2 in the inner medulla. The PGE2 content of the inner medulla was reduced by water loading to 40% of the level in untreated animals (Figure 7).
|
To investigate the influence of the osmolarity on the expression of Cox and on the production of PGE2 systematically under defined in vitro conditions, we performed cell culture experiments using a cell line of the inner medullary collecting duct (IMCD-3 cells) kept under different osmolarities of the culture medium.
Influence of the Osmolarity on Cox mRNA Expression and PGE2 Production in IMCD-3 Cells
Both Cox-1 and Cox-2 mRNA were detectable in IMCD-3 cells by RNase protection assay. A reduction of the medium-osmolarity from 300 to 200 mosmol/L for 24 or 48 h led to a reduced mRNA abundance of Cox-1, whereas the Cox-2 mRNA abundance remained unchanged. Conversely, a graded increase of the osmolarity of the medium up to 600 mosmol/L applied over a period of 24 or 48 h gradually increased the mRNA abundance of Cox-1 and to a lower extent also of Cox-2, with a maximum of the expression after 48 h in a medium of 600 mosmol/L (Figure 8). The differential mRNA expression of Cox-1 and Cox-2 was paralleled by the production of PGE2 (Table 1).
|
|
Taken together, our in vitro studies suggest that expressions of Cox-1 and to a lesser extent of Cox-2 are influenced by the osmolarity of the medium.
|
Discussion |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
In accordance with previous data (20,21) we also found in this study that the expression of both Cox isoforms increased in a gradient from the cortex toward the inner medulla, in which Cox-1 mRNA markedly dominated the expression of cyclooxygenases. This striking heterogeneity of cyclooxygenase expression between the different kidney zones was paralleled by the tissue concentrations of PGE2, which were 50 fold higher in the inner medulla when compared with the cortex, confirming the inner medulla as the main site of PGE2 formation in the kidney (27,28).
In the outer medulla furosemide changed neither Cox-1 nor Cox-2 gene expression. In the inner medulla, however, both Cox-2 and to a greater extent Cox-1 gene expression were downregulated by furosemide treatment. This decrease of mRNA was associated with decreased levels of Cox-1 protein in the IMCD and in inner medullary interstitial cells, which are known to express both isoforms of cyclooxygenases in the rat (13). The decrease of the Cox expression by furosemide in the inner medulla was associated with markedly lower tissue PGE2 concentrations, indicating a functional impact of the reduced cyclooxygenase expression in the inner medulla. Given that Cox-1 and Cox-2 have similar specific activities (12), the far higher expression of Cox-1 mRNA compared with Cox-2 mRNA and its more pronounced downregulation suggest that Cox-1 is mainly responsible for the high concentration of PGE2 in the inner medulla and its reduction during chronic furosemide treatment.
PGE2 in the inner medulla is considered to decrease the reabsorption of NaCl in the collecting duct and to reduce its water permeability induced by vasopressin (5–8). PGE2 is also known to increase the medullary blood flow (5). One could imagine therefore that a decreased synthesis of PGE2 in the renal inner medulla caused by furosemide leads to a reduced natriuretic and diuretic effect of this prostanoid that would, in part, counteract the effects of the loop diuretic.
A further explanation is that the modulation of papillary Cox expression and PGE2 generation reflects a cellular protective effect of PGE2 against the high interstitial tonicity in the inner medulla. In this context, Cox inhibitors have been shown to reduce the survival of IMCD cells kept under high osmolarities in culture, pointing to cellular protective effects of Cox-derived prostanoids (24). It has been demonstrated that an increase of papillary tonicity by dehydration increases not only Cox-2 (22–24) but also Cox-1 expression in the inner medulla of rats (23). Cell culture experiments with IMCD cells confirmed a stimulation of Cox-2 expression by high osmolarity mediated by ERK, JNK-2, and p38 kinases (24).
In line with previous data, we observed that furosemide markedly decreased the tonicity of the urine (29). Similar to furosemide infusion, chronic water loading, which is known to reduce the medullary osmolarity (33), led to a reduced expression of Cox-1 and to a slightly reduced expression of Cox-2 (NS) that was paralleled by a lower content of PGE2, suggesting again an osmolarity-dependent mechanism of the regulation of the expression of Cox in the inner medulla. However, these effects were less pronounced than after chronic furosemide infusion, which might be due to a lower reduction of the medullary osmolarity caused by water loading compared with furosemide infusion.
We also found that the expression of both Cox-1 and Cox-2 in cultured inner medullary collecting duct cells (IMCD-3) changed in parallel with the extracellular osmolarity; we, therefore, think that a fall of the interstitial osmolarity in the inner medulla is a likely signal that led to the downregulation of Cox expression during furosemide infusion. In contrast to previous reports for mIMCD-K2 cells reporting that Cox-1 expression is not influenced by the tonicity (22,24), we found in this study that not only the expression of Cox-2 but to a greater extent the expression of Cox-1 in IMCD-3 cells was dependent on the osmolarity of the culture medium. This discrepant finding might be due to the different cell lines used in the studies. Furosemide alone did not influence the production of PGE2 in IMCD-3 cells; it is, therefore, likely that the production of PGE2 is directly dependent on the tonicity and is not affected by the inhibition of ion transport caused by furosemide.
We are aware that a marked decrease of Cox expression in the medulla, which is the predominant site of renal prostanoid synthesis, is at a first glance difficult to reconcile with the well-known enhancement of renal prostanoid excretion by furosemide (25,26). However, there is increasing evidence that loop diuretics can stimulate prostanoid formation in different tissues (34,35), thus increasing the concentration of circulating prostanoids and increasing their glomerular filtration. Increased filtration of prostanoids in combination with high tubular flow rates could therefore account for the increase of renal prostanoid excretion by furosemide. Our data point to an enhanced formation of PGE2 in extrarenal sources, leading to an increased renal excretion during chronic furosemide infusion.
Taken together, our data suggest that loop diuretics decrease the expression of cyclooxygenases and consequently the tissue PGE2 concentrations in the inner medulla of the rat kidney. This effect is likely related to the breakdown of the papillary osmotic gradient induced by loop diuretics.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. Norregaard, B. L. Jensen, S. O. Topcu, M. Diget, H. Schweer, M. A. Knepper, S. Nielsen, and J. Frokiaer COX-2 activity transiently contributes to increased water and NaCl excretion in the polyuric phase after release of ureteral obstruction Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1322 - F1333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Kazama, T. Arata, M. Michimata, R. Hatano, M. Suzuki, N. Miyama, S. Sanada, A. Sato, S. Satomi, Y. Ejima, et al. Lithium effectively complements vasopressin V2 receptor antagonist in the treatment of hyponatraemia of SIADH rats Nephrol. Dial. Transplant., January 1, 2007; 22(1): 68 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Theilig, H. Debiec, B. Nafz, P. Ronco, R. Nusing, H. W. Seyberth, H. Pavenstadt, N. Bouby, and S. Bachmann Renal cortical regulation of COX-1 and functionally related products in early renovascular hypertension (rat) Am J Physiol Renal Physiol, November 1, 2006; 291(5): F987 - F994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Dobrowolski and J. Sadowski Furosemide-induced renal medullary hypoperfusion in the rat: role of tissue tonicity, prostaglandins and angiotensin II J. Physiol., September 1, 2005; 567(2): 613 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lantz, T. Vondrichova, H. Parikh, C. Frenander, M. Ridderstrale, P. Asman, M. Aberg, L. Groop, and B. Hallengren Overexpression of Immediate Early Genes in Active Graves' Ophthalmopathy J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4784 - 4791. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Kotnik, J. Nielsen, T.-H. Kwon, C. Krzisnik, J. Frokiaer, and S. Nielsen Altered expression of COX-1, COX-2, and mPGES in rats with nephrogenic and central diabetes insipidus Am J Physiol Renal Physiol, May 1, 2005; 288(5): F1053 - F1068. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
