Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afrouzian, M.
Right arrow Articles by Halloran, P. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afrouzian, M.
Right arrow Articles by Halloran, P. F.
J Am Soc Nephrol 13:1199-1209, 2002
© 2002 American Society of Nephrology

Transcription Factor IRF-1 in Kidney Transplants Mediates Resistance to Graft Necrosis during Rejection

Marjan Afrouzian*, Vido Ramassar*, Joan Urmson*, Lin-Fu Zhu{dagger} and Philip F. Halloran*

*Department of Medicine, Division of Nephrology and Immunology, and {dagger}Department of Surgery, University of Alberta, Edmonton, Alberta, Canada.

Correspondence to: Dr. Philip F. Halloran, Director, Division of Nephrology & Immunology, University of Alberta, 250 Heritage Medical Research Centre, Edmonton, Alberta T6G 2S2, Canada. Phone: 780-407-8880; Fax: 780-407-3417; E-mail: phil.halloran{at}ualberta.ca


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. In many circumstances kidney transplants remain viable despite extensive inflammation, permitting rejection episodes to be reversed. The mechanisms by which the kidney resists host effector mechanisms are not known. In mouse kidney transplants, resistance requires interferon-{gamma} (IFN-{gamma}), which acts on the graft to protect the graft from necrosis during the first days of rejection as well as inducing major histocompatibility complex (MHC) expression. Because some effects of IFN-{gamma} are mediated by transcription factor IRF-1, the role of IRF-1 in the donor tissue early phases of rejection of mouse kidney allografts was studied. H-2b kidneys were transplanted from mice with wild-type IRF-1 genes (WT) or mice with disrupted IRF-1 genes (IRF-1KO) into CBA (H-2k) recipients. At day 5 and day 7, IRF-1KO and WT kidneys were functioning despite typical rejection pathology: interstitial infiltration and tubulitis. However, function deteriorated rapidly in rejecting IRF-1KO allografts, associated with widespread epithelial necrosis, peritubular capillary congestion, glomerulitis, and fibrin thrombi in small veins by day 7. At day 21, WT kidneys were viable despite severe tubulitis and arteritis, whereas IRF-1KO kidneys showed massive necrosis of the epithelium despite patent large vessels. Compared with WT kidneys, rejecting IRF-1KO kidneys showed less induction of donor MHC yet had similar mRNA levels of perforin, granzyme B, and Fas ligand and evoked host alloantibody responses. Thus in rejecting kidney transplants, IRF-1 in the graft mediates MHC induction, but it also mediates resistance to necrosis, an effect that could be crucial to permit success in interventions against rejection.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Acute rejection of vascularized kidney allografts can run a variety of courses, varying from rapidly destructive to indolent. Rejection spontaneously resolves in some kidney transplant models (1), similarly to the events in experimental liver transplants (2). Resolution implies that the kidney can resist immune effector mechanisms, and evidence is accumulating that interferon-{gamma} (IFN-{gamma}) is involved. In addition to its immunoregulatory effects, IFN-{gamma} is unique in that IFN-{gamma} receptors (IFN-{gamma}Rs) are abundant and constitutively active in kidney (3). In rejecting kidneys, host-infiltrating cells produce large quantities of IFN-{gamma}, which acts on the IFN-{gamma}R in the transplant to induce major histocompatibility complex (MHC) expression in endothelial and parenchymal cells (4). Rejecting kidney transplants from mice lacking IFN-{gamma}R (GRKO mice) display little MHC expression and undergo immune-mediated necrosis of the epithelium by day 7 (5), despite patency of the large vessels. Heart and kidney allografts into recipients lacking IFN-{gamma} (GKO mice) also show a severe deficiency in induction of MHC genes and rapidly develop necrosis, which can be reduced by administering IFN-{gamma} (6). Thus IFN-{gamma} not only regulates the host immune response, but it also acts directly on the allograft to induce both MHC expression and resistance to necrosis.

The actions of IFN-{gamma} and of IFN-{gamma}R in nonlymphoid tissues are mediated in part by the IFN regulatory factor (IRF) family of transcription factors, which includes IRF-1 through IRF-9 (7). By binding to related consensus sequences such as the IRF-E, the interferon-stimulated regulatory element (ISRE), and the interferon consensus sequence (ICS), the IRF family proteins regulate the promoters of many IFN-inducible genes, such as inducible nitric oxide synthase (NOS2) (8). IRF-1 is of particular interest because it regulates expression of MHC class I (9) and class II genes (10), the latter by inducing promoter PIV of the class II transactivator (CIITA) (11). Mice with a targeted disruption of the IRF-1 gene (IRF-1KO) display severe defects in MHC regulation in kidney and other organs (10).

Given that IFN-{gamma} protects rejecting allografts from necrosis and that IRF-1 is essential for some effects of IFN-{gamma}, we examined how IRF-1 deficiency affects the course of fully allogeneic kidney transplants in vivo. We compared kidney transplants from donors with wild-type (WT) IRF-1 genes with those from IRF-1KO donors in hosts with normal IFN-{gamma}, IFN-{gamma}R, and IRF-1 genes. The results indicate that IRF-1 expression is induced in rejecting kidney allografts and is essential for both MHC regulation and for resistance to necrosis during acute allograft rejection.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
IRF-1KO Mice
The IRF-1KO mice were originally created using the construct pMIRF1neoB, containing 4.9-kb homologous IRF-1 genomic DNA with a 1.2-kb deletion where the neomycin resistance gene was inserted, and were generously supplied by Dr. Tak W. Mak, Ontario Cancer Institute, Ontario, Canada (12). The deletion effectively removed the exons required for the DNA-binding domain, resulting in an inactive IRF-1 product.

C57Bl6 (B6), 129/J, (129xB6)F1, and CBA/J Mice
Because IRF-1KO mice were created with both 129/J and B6 background, B6, 129/J, or (129xB6)F1 were selected as controls. B6, 129/J, (129xB6)F1, and CBA/J mice aged 9 to 11 wk were obtained from Jackson Laboratories, Bar Harbor, Maine. The response of CBA hosts to B6, 129/J, or (129xB6)F1 kidneys was the same up to 21 d posttransplant, permitting any of these to be used as control donors for the IRF-1KO donor experiments. Health Sciences Laboratory Animal Service at the University of Alberta sustained all mice. Acidified water (250 µl of 2 N HCl in 250 ml of water) was supplied to mice. All experimental procedures conformed to animal care protocols enforced by this institution. Transplant recipient mice that appeared significantly ill were euthanized in accordance with institutional policy.

Kidney Transplants
The method of transplantation is described elsewhere (5,6). Unless otherwise stated, the contralateral host CBA kidney was left in place to preserve renal function and permit the transplants to be followed to complete rejection. In selected mice, the contralateral kidney was removed on either day 3 or day 4, and the mice were allowed to survive with daily observation. They were killed if they appeared unwell.

Pathology: Modified Banff Scoring System
One pathologist assigned scores for the lesions observed in whole kidney sections (two sections per kidney), including cortex and outer medulla. Additional findings not included in the Banff scoring system (13) were also studied and scored as follows. For the extent of necrosis and peritubular capillary (PTC) congestion, percentage of parenchymal involvement was recorded. Glomerulitis, interstitial infiltrate, and tubulitis were scored from 0 to 3 on the basis of the percentage of parenchymal involvement (0, no changes; 1, <25% of the total parenchyma involved; 2, 25 to 75% of total parenchyma involved; 3, >75% of the total parenchyma involved). Arteritis, venulitis, and venous thrombosis were counted in each specimen, and the mean number of lesions observed per kidney was calculated for each group. Thrombotic lesions were first assessed by hematoxylin and eosin stain, and the presence of fibrin in the thrombus was confirmed by martius scarlet blue stain for fibrin.

Antibodies
Monoclonal antibodies (mAb) were purified in our laboratory from supernatants of hybridoma cell lines. AF6-120.1.2 (mouse IgG against mouse I-Ab), 20-8-4S (mouse IgG against mouse H-2KbDb), 11 to 4.1 (mouse IgG against mouse H-2K), 11 to 5.2.1.9 (mouse IgG against mouse I-Ak), M1/42.3.9.8 (rat IgG against all mouse H-2 haplotypes), and M5/114.15.2 (rat IgG against mouse I-Ab,d,q and I-Ed,k) were obtained from American Type Culture Collection (Rockville, MD). The hybridomas were maintained in culture and purified as described previously (5).

Radiolabeled Antibody-Binding Assay (RABA)
This has been described in detail elsewhere (6,14).

IIP Staining of Tissue Sections
Fresh frozen sections (4 µm) were fixed in acetone and then incubated with normal goat serum. The slides were incubated with rat mAb against class I (M1) and class II (M5) or with phosphate-buffered saline (PBS) as a control. The slides were then incubated with affinity purified peroxidase-conjugated goat anti-rat IgG F(ab')2 fragment (ICN, Costa Mesa, CA). Immune complexes were visualized by the use of 3'3 diaminobenzidine tetrahydrochloride and hydrogen peroxide for the color reaction and counterstained with hematoxylin.

Assessment of Cytotoxic Alloantibody
Sera from transplanted mice (CBA) with WT or IRF-1 KO kidneys were bled at the time of harvest, and their sera were assessed by microcytotoxicity. Serum (2 µl) and CBA (2 µl) or B6 spleen cells (2 x 106/ml) were incubated in a 37°C CO2 incubator for 30 min. Rabbit complement (2 µl at 1:3 dilution) was added and incubated at room temperature for 90 min. Eosin and 10% buffered formalin were added to each well.

Assessment of Gene Expression
Total RNA extracted from kidneys was transcribed into cDNA using Superscript reverse transcriptase (BRL, Burlington, Ontario, Canada) and amplified in a thermal cycler (Perkin Elmer Cetus, Norwalk, CT) using Taq DNA polymerase. The sequences for IFN-{gamma} primers are 5' CGCTACACACTGCATCTTGG (forward primer) and 5' GGCTGGATTCCGGCAACA (reverse primer). The sequences of the other PCR primers were previously described (5,10). The PCR products were Southern blotted and probed with radiolabeled oligonucleotide probes.

The TUNEL Assay
Apoptotic cells were stained by terminal deoxynucleotidyl transferase-mediated dUTP-biotin end labeling (TUNEL) assay (5,15). Briefly, sections deparaffinized in xylene were hydrated through alcohols. Endogenous peroxidase was inactivated with 1% H2O2 and treated with proteinase K. The sections were incubated with terminal transferase (TDT) buffer (30 mM Tris-HCl, pH 7.2, 1 mM CoCl2, 140 mM sodium cacodylate) for 30 min and then labeled with TDT and biotin-16-dUTP for 1 h. The slides were incubated with the avidin-biotin complex, visualized by using the DAB substrate kit (Vector Laboratories, Burlingame, CA), and counterstained with methyl green.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IRF-1KO mice displayed normal renal function (serum creatinine, urea, electrolytes) and renal histology, and kidney transplants from IRF-1KO donors into syngeneic recipients survived normally with no histologic abnormalities at day 7 (data not shown).

Renal Function and Pathology Deteriorates Rapidly in Rejecting Kidneys from IRF-1KO but Not WT Donors
To monitor the effects of rejection on renal function, we removed the right recipient kidney and transplanted the donor kidney into the right side. We performed nephrectomy of the left recipient kidney on day 3 or 4. We observed the mice daily and killed them on day 5 to 7, or earlier if they were unwell, according to animal care policies. The creatinine at sacrifice was low in mice with WT transplants (mean 55 ± 17 µmol/L). In hosts bearing allografts from IRF-1KO donors, the creatinine was increased more than fivefold (mean 276 ± 29 µmol/L) and the urea and potassium also increased (Table 1). The weights of rejecting kidneys from both IRF-1KO (241 ± 25 mg) and WT (303 ± 85 mg) donors were increased compared with controls (148 ± 32 mg). The pathology of the IRF-1KO kidneys showed interstitial inflammation like that in WT allografts, but displayed increased necrosis and glomerulitis and a tendency to increased peritubular capillary congestion and tubulitis (Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1. Kidney function and pathology after kidney transplant on nephrectomized mice
 
The rapid development of uremia in nephrectomized hosts with IRF-1KO allografts made it impossible to follow them beyond day 6. We, therefore, used hosts with the contralateral kidney in place to avoid morbidity and death from uremia. This permitted us to study the evolution of the changes in both the WT and the IRF-1KO grafts without the complicating influence of host uremia, because the residual native kidney maintained normal renal function. The transplant and host kidneys were studied 5, 7, or 21 d after transplant. Compared with kidneys of control mice (125 ± 41 mg), weights of the rejecting transplants were increased at day 7, but the increase was similar in IRF-1KO transplants (302 ± 41 mg) compared with WT transplants (365 ± 64 mg) at day 5. By day 21, the transplanted WT kidneys weighed 430 ± 137 mg versus 303 ± 60 mg for transplanted IRF-1KO kidneys, compared with 148 ± 33 for the controls.

Table 2 and Figure 1 show the pathology of the WT and IRF-1KO kidney transplants at day 5, 7, or 21. WT transplants at day 5 showed moderate interstitial infiltrate but little tubulitis and no necrosis, peritubular capillary congestion, or glomerulitis (Figure 1A). Arteritis and arterial and venous thrombotic lesions were absent. The WT transplants examined at day 7 also showed similar findings: no necrosis or peritubular capillary congestion, mild glomerulitis, moderate cellular infiltrate with mild tubulitis (Figure 1, C and E), and venulitis. Arteritis and thromboses were absent. Even at day 21, the WT kidneys continued to show little necrosis despite severe tubulitis and arteritis (Table 2 and Figure 1G).


View this table:
[in this window]
[in a new window]

  		Table 2. Pathologic findings In the WT and the IRF-1KO transplanted right kidneysa
 


View larger version (126K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Pathology of the wild-type (WT) versus disrupted IRF (IRF-1KO) kidney allografts in CBA hosts. (A) WT transplants at day 5 showing interstitial infiltrate with no glomerulitis or tubulitis. (B) IRF-1KO transplants at day 5 showing interstitial infiltrate and glomerulitis (arrow). (C) WT transplants at day 7 showing mild tubulitis (arrow) and interstitial infiltrate with no peritubular capillary congestion or tubular necrosis. (D) IRF-1KO transplants at day 7 showing tubulitis (arrow) and extensive tubular necrosis (asterisk). (E) WT transplant at day 7 showing no peritubular congestion. (F) IRF-1KO transplants at day 7 showing peritubular congestion (arrows) and necrosis. (G) WT transplants at day 21 showing severe tubulitis (arrows) but no necrosis. (H) IRF-1KO transplants at day 21 showing extensive necrosis. Panels A through D, G, and H were stained with periodic acid-Schiff (PAS), and panels E and F were stained with hematoxylin and eosin (H&E). Magnification, x400.

 
IRF-1KO transplants on day 5 (Table 2) showed some necrosis, peritubular capillary congestion, glomerulitis, mild to moderate cellular infiltrate, and mild tubulitis (Figure 1B). Two kidneys showed arteritis. By day 7, all IRF-1KO transplants showed extensive necrosis (Figure 1D) accompanied by peritubular capillary congestion (Figure 1F). The large vessels were patent, although nonocclusive mural thrombi were present in five IRF-1KO transplants (Figure 2, A and B) (Table 2). The extent of necrosis in some kidneys prevented reliable grading of some features, e.g., glomerulitis in experiment 1 (Table 2). There was moderate interstitial infiltrate, mild tubulitis, arteritis, and venulitis. At day 21, the IRF-1KO transplants showed a mixture of widespread necrosis of the tubular epithelium and global infarction (Table 2 and Figure 1H). Nevertheless, most large vessels remained patent. The contralateral kidneys of hosts rejecting kidney allografts were normal.



View larger version (122K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Comparison of WT and IRF-1KO kidney allografts in CBA hosts. (A) IRF-1KO transplants at day 7 showing a nonocclusive mural thrombus within a small vein (arrow) (stained with H&E). (B) IRF-1KO transplants at day 7 showing arteriolar (arrow) and glomerular (arrowhead) fibrin thrombi (stained with martius scarlet blue). (C) Terminal deoxynucleotidyl transferase-mediated dUTP-biotin end labeling (TUNEL) staining of WT transplants showing apoptotic cells (arrows) mostly within the interstitium. (D) IRF-1KO transplants showing apoptotic cells (arrows) mostly within the interstitium. (E) Class I expression in WT transplants at day 5 showing moderate tubular staining (stained with rat monoclonal antibody against class I [M1]). (F) Major histocompatibility complex (MHC) class I expression in IRF-1KO transplants with interstitial staining but no staining of tubules (stained with M1). (G) Class II expression in WT transplants at day 5 showing staining of the basolateral aspect of the tubular epithelium (arrows) and Bowman’s capsule in the glomerulus (g) (stained with M5). (H) Class II in IRF-1KO transplants at day 5 showing mild interstitial but no tubular staining (stained with M5). Magnifications: x250 in A, C, and D; x400 in B and E through H

 
Assessing the Extent of Apoptosis
TUNEL assays were performed to determine the nature of the massive cell death in kidneys from IRF-1KO recipients (Figure 2D) at day 7 compared with transplants from WT donors (Figure 2C). TUNEL-positive cells were rarely present in tubular epithelium, despite massive epithelial cell necrosis in the IRF-1KO kidneys. TUNEL-positive cells were present to a similar degree in the interstitium in transplants from WT and IRF-1KO donors.

Immunostaining of the WT and IRF-1KO Transplants
WT transplants at day 5 (Figure 2E) showed class I staining of the basolateral aspect of all renal tubules, whereas IRF-1KO transplants showed little or no class I in tubules, even in viable tubules (Figure 2F). Class II expression was increased in some tubules of the WT transplants at day 5 (Figure 2G), whereas IRF-1KO transplants showed no tubular staining for class II (Figure 2H). The results were similar with donor-specific mouse anti-class I or class II monoclonals and with rat monoclonals, except that the rat monoclonals also stained the host cells in the interstitial infiltrate.

The infiltrating host cell populations were also assessed by immunostaining of tissue sections, including viable areas of IRF-1KO transplants at day 7 (Table 3). CD45+ cells were increased in WT kidney transplants at day 5 compared with normal kidneys and increased further at day 7, mostly due to increased CD8 T cells. The IRF-1KO kidneys tended to have fewer CD45+ cells and CD3 cells at day 7 than the WT transplants or the day-5 IRF-1KO transplants, probably due to tissue necrosis. CD4+ cells were infrequent, which is consistent with previous observations in mouse kidney transplants.


View this table:
[in this window]
[in a new window]

  		Table 3. Cell marker assessment of interstitial cells in WT and IRF-1KO rejecting transplants by immunostaining
 
In control kidneys, PECAM was expressed on endothelium of arteries, glomeruli, and interstitial peritubular capillaries. Staining was not increased in rejecting WT transplants, as previously reported (16,17). In rejecting IRF-1KO kidneys (Table 3), platelet endothelial cell adhesion molecule (PECAM) staining of peritubular capillaries was reduced compared with control kidneys or rejecting WT kidneys.

RABA confirmed that donor class I and class II were strongly induced in the WT (B6) transplants (Tx) at day 5, 7, and 21 (Figure 3A). Induction of donor MHC was less in rejecting IRF-1KO Tx kidneys. As expected, donor MHC was absent in the host kidneys. Host class I and II products were increased in the transplant, reflecting infiltrating host cells (Figure 3B). Host MHC was induced in the host kidney as expected due to the systemic release of IFN-{gamma} in hosts rejecting WT or IRF-1KO transplants.



View larger version (27K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. MHC product expression in host kidney and transplanted (tx) kidney at day 5, 7, and 21 by radiolabeled antibody-binding assay (RABA). (A) Donor MHC class I (upper panel) and class II (lower panel) in normal host and tx kidney. (B) Host MHC expressing class I (upper panel) and class II (lower panel) in normal host and tx kidney. * significant difference by ANOVA compared with normal kidneys of B6 (donor) or CBA (host) on the same day.

 
Gene Expression in Rejecting IRF-1KO versus WT Kidney Allografts
We studied the mRNA levels for a number of representative genes (Figure 4). Rejecting IRF-1KO and WT kidneys both showed abundant expression of granzyme B, FasL, and perforin mRNA compared with control kidneys. Rejecting IRF-1KO and WT kidneys showed increased expression of IRF-1 mRNA compared with control kidneys, particularly in the WT transplants. The expression of some IRF-1 mRNA in the rejecting IRF-1KO kidneys is attributable to the infiltrate. The greater increase in the rejecting WT kidneys reflects induced expression in donor cells, consistent with our previous demonstration that IRF-1 mRNA is inducible in kidney by IFN-{gamma} (10). IFN-{gamma} mRNA expression was strongly induced in rejecting IRF-1KO and WT kidneys. The mRNA for NOS2 and for IFN-{gamma}-inducible chemokines monokine-inducible by IFN-{gamma} (MIG) was also increased in rejecting WT or IRF-1KO transplants. Rejecting IRF-1KO and WT kidneys showed increased expression of the HO-1 mRNA compared with control kidneys, but the increase was greater in the IRF-1KO kidneys, perhaps because of ischemia.



View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Evaluation of mRNA for various inflammatory markers in WT and IRF-1KO rejecting transplants at day 5 and 7. WT kidney was transplanted in CBA mice and harvested at day 5 and 7. HPRT was included as a loading control. GrzB, granzyme B.

 
Alloantibody Responses
Several hosts were selected for assessment of donor-specific alloantibody levels in each group. Alloantibody was detected in both groups, weakly at day 7 and strongly at day 21 (data not shown). However, alloantibody may be absorbed to the transplant, underestimating the alloantibody response.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, grafts lacking IRF-1 underwent rapid functional deterioration and massive necrosis during acute rejection beginning at day 5. WT grafts developed a typical rejection at days 5 to 7 but were resistant to necrosis even at day 21. In rejecting IRF-1KO transplants, the early cellular infiltrate was similar to that in WT mice at day 5, but function deteriorated by day 6 and necrosis was extensive by day 7. The IRF-1KO transplants showed impaired induction of MHC expression. Thus the phenotype of kidney transplants lacking IRF-1 was similar to that of kidneys lacking IFN-{gamma}R (5), suggesting that IRF-1 is essential for the protective effect of IFN-{gamma} against necrosis in acute graft rejection. The basis for the congestion and necrosis in rejecting IRF-1KO transplants was not thrombosis of large vessels; the thrombi in small veins tended to be mural and non-occlusive. Moreover, the weight of the rejecting IRF-1KO transplants was not greater than that of rejecting WT transplants, as would be expected if venous occlusion were a primary event. Thus the necrosis is probably mediated by ischemia due to failure of the microcirculation, with secondary thrombosis of veins and/or arteries in some grafts. IRF-1 in the grafted tissue was only required during rejection, arguing against a direct effect on thrombosis or coagulation. Syngeneic IRF-1KO transplants displayed no renal abnormalities, and IRF-1 mice have no excess of thrombosis. Thus in acute rejection donor IRF-1 is essential for inducing MHC expression and preventing failure of the microcirculation and ischemic necrosis.

There was no obvious difference in the immune response of CBA hosts to allografts with and without IRF-1 to explain the differences in tissue injury. Whether the kidneys were WT or IRF-1KO, the CBA hosts produced abundant IFN-{gamma} and had normal IFN-{gamma}R, as witnessed by the induction of host MHC expression in the normal native kidney, which is highly dependent on IFN-{gamma} (14,18). The expression of the CTL effector genes perforin, granzyme B, and FasL in the graft was increased in both WT and IRF-1KO grafts at day 7. Alloantibody responses were readily induced during rejection of both WT and IRF-1KO grafts. Comparisons of host alloantibody responses to IRF-1 versus WT kidneys must remain qualitative because of the potential effect of the different levels of donor MHC expression on the production and absorption of alloantibody. Thus the phenotype of rejecting IRF-1KO transplants probably reflects increased sensitivity of the graft to host effector mechanisms rather than differences in the effector mechanisms themselves.

Given that alloantibody can damage endothelium in allografts, the necrosis of the epithelium in IRF-1KO kidneys could reflect excessive sensitivity to antibody-mediated endothelial injury. Alloantibody was demonstrable in the circulation of these hosts around day 7 whether the kidney was from WT or IRF-1KO donors. IFN-{gamma} protects against vascular injury by antibody in concordant rat xenotransplants (19), indicating that IFN-{gamma} has the potential to protect vessels against antibody injury. The mechanism by which IRF-1 expression could cause resistance to antibody is undefined. Deficiency in the endothelial protective effect of HO-1 could not be incriminated in the necrosis of IRF-1KO kidneys because the IRF-1KO actually had higher levels of HO-1 mRNA, perhaps as a response to ischemia (20). Moreover, neither IFN-{gamma} nor IRF-1 has been shown to affect HO-1 expression. Other possible roles of IRF-1 such as effects on production of IFN-{gamma}-regulated chemokines must also be considered, given the major effects of donor IP-10 and CXCR3 in some models (21,22). However, IP-10 does not seem to be regulated through IRF-1 (23,24). Moreover, the lack of donor IP-10 or lack of CXCR3 activation is protective, the reverse of that observed with IFN-{gamma}, IFN-{gamma}R, and IRF-1 deficiency.

The protective action of IRF-1 against necrosis during rejection may be mediated by changes in the microcirculation of inflamed tissue. IRF-1 positively regulates the expression of COX-2, which produces prostaglandin E2, an important vasodilator. IRF-1 could thus contribute to the ability of IFN-{gamma} and other cytokines to induce COX-2 in a number of cell types, including epithelial cells (25,26). IRF-1 also positively regulates NOS2 and thus nitric oxide (NO) production (27). NO limits inflammation at endothelial surfaces (28) and inhibits apoptosis of some cell types (29), including endothelial cells (30). NOS2 expression is IRF-1-dependent in some (31) but not all cells types (32). In this study, grafts lacking IRF-1 displayed abundant levels of mRNA for NOS2. However, NOS2 can be expressed both in the host infiltrate cells and in the donor cells. The observation that inhibitors of NO synthesis aggravate rejection injury supports the concept that NO has protective effects on graft rejection (33), and NO production in graft cells may have effects not replaceable by NO from inflammatory cells. Thus NO produced by NOS2 in the graft cells may have a role in graft protection, potentially antagonizing the effects of inflammation and immune effector mechanisms. NO from host immune cells is a potential effector of tissue injury (34,35) and should be unchanged by donor IRF-1 gene disruption. Further investigations of the possibility that IRF-1 mediates protection via NO are planned, including studies with renal grafts from mice with disrupted NOS2 genes in the donor or in the recipient.

The protective effect of IFN-{gamma}, IFN-{gamma}R, and IRF-1 against necrosis could be mediated by MHC genes themselves. IRF-1 is a major regulator of class I and, through CIITA, of class II. Induction of intense MHC expression during graft rejection is often assumed to favor rejection because MHC products are powerful alloantigens and key antigen-presenting structures. However, allogeneic MHC can also lead to tolerance or anergy, and MHC can regulate inhibitory natural killer (NK) receptors in vitro (36). Direct recognition of intact donor MHC molecules in some types of grafts protects the graft (37), providing support for their role in the present studies. This could be mediated by T cell receptors or by inhibitory receptors, engaged by either membrane-bound or soluble MHC released from the graft. This effect would be temporary and relative; rejection obviously does proceed to completion in grafts from WT donors with high MHC expression. This would be compatible with the biphasic roles described for IFN-{gamma} and IFN-{gamma}R mediating graft protection in the first week but graft injury over later time periods (38,39).

The protective action of IFN-{gamma}, IFN-{gamma}R, and IRF-1 during acute rejection must be balanced against the many other potentially protective and deleterious effects of the interferon system in transplantation, arguing against any clinical extrapolations. Our previous studies have indicated that the protective effect of IFN-{gamma} during early acute rejection is mediated by the massive amounts of IFN-{gamma} produced in the graft and is poorly simulated by exogenous IFN-{gamma} (6). We have not explored whether exogenous IFN-{gamma} would have adverse or deleterious effects in stable grafts. Moreover human experience indicates that exogenous IFN-{alpha} can trigger rejection episodes in renal transplants (40–42), a concern that has been amplified with the use of interferon therapy for hepatitis C in organ transplant recipients (43). Although IFN-{alpha} and IFN-{gamma} have very different properties, receptors, and signaling, this experience should discourage attempts to use IFN-{gamma} for preventing or suppressing rejection in the clinic until more is known about mechanisms and how to capture benefits without incurring harm.


   Acknowledgments
 
This research has been supported by operating grants from the Canadian Institutes of Health Research, the Roche Organ Transplant Research Foundation, the Kidney Foundation of Canada, Novartis Pharmaceuticals Canada, Inc., The Muttart Foundation, and The Royal Canadian Legion. Dr Halloran holds a Canada Research Chair in Life Sciences Related to Human Health and Disease.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Russell PS, Chase CM, Colvin RB, Plate JMD: Kidney transplants in mice. An analysis of the immune status of mice bearing long-term, H-2 incompatible transplants. J Exp Med 147: 1449–1468, 1978[Abstract/Free Full Text]
  2. Calne RY: Immunological tolerance-the liver effect. Immunol Rev 174: 280–282, 2000[CrossRef][Medline]
  3. Boehm U, Klamp T, Groot M, Howard JC: Cellular responses to interferon-{gamma}. Annu Rev Immunol 15: 749–795, 1997[CrossRef][Medline]
  4. Bishop GA, Hall BM, Phillips J, Waugh J, Duggin GG, Horvath JS, Tiller DJ: Expression of HLA-DR antigens on renal tubular cells during rejection. Transplant Proc 17: 64–65, 1985
  5. Halloran PF, Afrouzian M, Ramassar V, Urmson J, Zhu LF, Helms LMH, Solez K, Kneteman N: IFN-{gamma} acts directly on rejecting renal allografts to prevent graft necrosis. Am J Pathol 158: 215–226, 2001[Abstract/Free Full Text]
  6. Halloran PF, Miller LW, Urmson J, Ramassar V, Zhu LF, Kneteman NM, Solez K, Afrouzian M: IFN-{gamma} alters the pathology of graft rejection: Protection from early necrosis. J Immunol 166: 7072–7081, 2001[Abstract/Free Full Text]
  7. Taniguchi T, Ogasawara K, Takaoka A, Tanaka N: IRF family of transcription factors as regulators of host defense. Annu Rev Immunol 19: 623–655, 2001[CrossRef][Medline]
  8. Kamijo R, Harada H, Matsuyama T, Bosland M, Gerecitano J, Shapiro D, Le J, Koh SI, Kimura T, Green SJ: Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 263: 1612–1615, 1994[Abstract/Free Full Text]
  9. Blanar MA, Baldwin AS, Flavell RA, Sharp PA: A gamma-interferon-induced factor that binds the interferon response sequence of the MHC class I gene, H-2Kb. EMBO J 8: 1139–1144, 1989[Medline]
  10. Hobart M, Ramassar V, Goes N, Urmson J, Halloran PF: IFN regulatory factor 1 (IRF-1) plays a central role in the regulation of the expression of class I and II MHC genes in vivo. J Immunol 158: 4260–4269, 1997[Abstract]
  11. Xi H, Eason DD, Ghosh D, Dovhey S, Wright KL, Blanck G: Co-occupancy of the interferon regulatory element of the class II transactivator (CIITA) type IV promoter by interferon regulatory factors 1 and 2. Oncogene 18: 5889–5903, 1999[CrossRef][Medline]
  12. Matsuyama T, Kimura T, Kitagawa M, Pfeffer K, Kawakami T, Watanabe N, Kündig TM, Amakawa R, Kishihara K, Wakeham A, Potter J, Furlonger CL, Narendran A, Suzuki H, Ohashi PS, Paige CJ, Taniguchi T, Mak TW: Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75: 83–97, 1993[CrossRef][Medline]
  13. Solez K, Axelsen RA, Benediktsson H, Burdick JF, Cohen AH, Colvin RB, Croker BP, Droz D, Dunnill MS, Halloran PF, Hayry P, Jennette JC, Keown PA, Marcussen N, Mihatsch MJ, Morozumi K, Myers BD, Nast CC, Olsen S, Racusen LC, Ramos EL, Rosen S, Sachs DH, Salomon DR, Sanfilippo F, Verani R, von Willebrand E, Yamagushi Y: International standardization of criteria for the histologic diagnosis of renal allograft rejection: The Banff working classification of kidney transplant pathology. Kidney Int 44: 411–422, 1993[Medline]
  14. Goes N, Sims T, Urmson J, Vincent D, Ramassar V, Halloran PF: Disturbed MHC regulation in the interferon-{gamma} knockout mouse. J Immunol 155: 4559–4566, 1995[Abstract]
  15. Gavrieli Y, Sherman Y, Ben-Sasson SA: Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119: 493–501, 1992[Abstract/Free Full Text]
  16. Temonen M, Mustonen J, Helin H, Pasternack A, Vaheri A, Holthofer H: Cytokines, adhesion molecules, and cellular infiltration in nephropathia epidemica kidneys: An immunohistochemical study. Clin Immunol Immunopathol 78: 47–55, 1996[CrossRef][Medline]
  17. Hauser IA, Riess R, Hausknecht B, Thuringer H, Sterzel RB: Expression of cell adhesion molecules in primary renal disease and renal allograft rejection. Nephrol Dial Transplant 12: 1122–1131, 1997[Abstract/Free Full Text]
  18. Halloran PF, Autenried P, Ramassar V, Urmson J, Cockfield S: Local T cell responses induce widespread MHC expression. Evidence that IFN-{gamma} induces its own expression in remote sites. J Immunol 148: 3837–3846, 1992[Abstract]
  19. Wang H, DeVries ME, Deng S, Khandaker MH, Pickering JG, Chow LH, Garcia B, Kelvin DJ, Zhong R: The axis of interleukin 12 and gamma interferon regulates acute vascular xenogeneic rejection. Nat Med 6: 549–555, 2000[CrossRef][Medline]
  20. Matsuoka Y, Kitamura Y, Okazaki M, Sakata M, Tsukahara T, Taniguchi T: Induction of heme oxygenase-1 and major histocompatibility complex antigens in transient forebrain ischemia. J Cereb Blood Flow Metab 18: 824–832, 1998[CrossRef][Medline]
  21. Hancock WW, Lu B, Gao W, Csizmadia V, Faia K, King JA, Smiley ST, Ling M, Gerard NP, Gerard C: Requirement of the chemokine receptor CXCR3 for acute allograft rejection. J Exp Med 192: 1515–1519, 2000[Abstract/Free Full Text]
  22. Hancock WW, Gao W, Csizmadia V, Faia KL, Shemmeri N, Luster AD: Donor-derived IP-10 initiates development of acute allograft rejection. J Exp Med 193: 975–980, 2001[Abstract/Free Full Text]
  23. Cheng G, Nazar AS, Shin HS, Vanguri P, Shin ML: IP-10 gene transcription by virus in astrocytes requires cooperation of ISRE with adjacent kappaB site but not IRF-1 or viral transcription: J Interferon Cytokine Res 18: 987–997, 1998[Medline]
  24. Majumder S, Zhou LZ, Chaturvedi P, Babcock G, Ransohoff RM: p48/STAT-1alpha-containing complexes play a predominant role in induction of IFN-gamma-inducible protein, 10 kDa (IP-10) by IFN-gamma alone or in synergy with TNF-alpha. J Immunol 161: 4736–4744, 1998[Abstract/Free Full Text]
  25. Matsuura H, Sakaue M, Subbaramaiah K, Kamitani H, Eling TE, Dannenberg AJ, Tanabe T, Inoue H, Arata J, Jetten AM: Regulation of cyclooxygenase-2 by interferon gamma and transforming growth factor alpha in normal human epidermal keratinocytes and squamous carcinoma cells. Role of mitogen-activated protein kinases. J Biol Chem 274: 29138–29148, 1999[Abstract/Free Full Text]
  26. Misko TP, Trotter JL, Cross AH: Mediation of inflammation by encephalitogenic cells: interferon gamma induction of nitric oxide synthase and cyclooxygenase 2. J Neuroimmunol 61: 195–204, 1995[CrossRef][Medline]
  27. Martin E, Nathan C, Xie QW: Role of interferon regulatory factor 1 in induction of nitric oxide synthase. J Exp Med 180: 977–984, 1994[Abstract/Free Full Text]
  28. Peng HB, Spiecker M, Liao JK: Inducible nitric oxide: An autoregulatory feedback inhibitor of vascular inflammation. J Immunol 161: 1659–1563, 1998[Abstract/Free Full Text]
  29. Suschek CV, Krischel V, Bruch-Gerharz D, Berendji D, Krutmann J, Kroncke KD, Kolb-Bachofen V: Nitric oxide fully protects against UVA-induced apoptosis in tight correlation with Bcl-2-upregulation. J Biol Chem 274: 6130–6137, 1999[Abstract/Free Full Text]
  30. Ceneviva GD, Tzeng E, Hoyt DG, Yee E, Gallagher A, Engelhardt JF, Kim YM, Billiar TR, Watkins SA, Pitt BR: Nitric oxide inhibits lipopolysaccharide-induced apoptosis in pulmonary artery endothelial cells. Am J Physiol 275: L717–L728, 1998[Abstract/Free Full Text]
  31. Bachmaier K, Neu N, Pummerer C, Duncan GS, Mak TW, Matsuyama T, Penninger JM: iNOS expression and nitrotyrosine formation in the myocardium in response to inflammation is controlled by the interferon regulatory transcription factor 1. Circulation 96: 585–591, 1997
  32. Shiraishi A, Dudler J, Lotz M: The role of IFN regulatory factor-1 in synovitis and nitric oxide production. J Immunol 159: 3549–3554, 1997[Abstract]
  33. Stojanovic T, Grone HJ, Gieseler RK, Klanke B, Schlemminger R, Tsikas D, Grone EF: Enhanced renal allograft rejection by inhibitors of nitric oxide synthase: A non-immunologic influence on alloreactivity. Lab Invest 74: 496–512, 1996[Medline]
  34. Koglin J, Glysing-Jensen T, Mudgett JS, Russell ME: NOS2 mediates opposing effects in models of acute and chronic cardiac rejection: Insights from NOS2-knockout mice. Am J Pathol 153: 1371–1376, 1998[Abstract/Free Full Text]
  35. Sass G, Koerber K, Bang R, Guehring H, Tiegs G: Inducible nitric oxide synthase is critical for immune-mediated liver injury in mice. J Clin Invest 107: 439–447, 2001[Medline]
  36. Gould DS, Auchincloss H: Direct and indirect recognition: The role of MHC antigens in graft rejection. Immunol Today 20: 77–82, 1999[CrossRef][Medline]
  37. Lee RS, Grusby MJ, Laufer TM, Colvin R, Glimcher LH, Auchincloss H: CD8+ effector cells responding to residual class I antigens, with help from CD4+ cells stimulated indirectly, cause rejection of "major histocompatibility complex-deficient" skin grafts. Transplant 63: 1123–1133, 1997[CrossRef][Medline]
  38. Nagano H, Mitchell RN, Taylor MK, Hasegawa S, Tilney NL, Libby P: Interferon-{gamma} deficiency prevents coronary arteriosclerosis but not myocardial rejection in transplanted mouse hearts. J Clin Invest 100: 550–557, 1997[Medline]
  39. Raisanen-Sokolowski A, Glysing-Jensen T, Koglin J, Russell ME: Reduced transplant arteriosclerosis in murine cardiac allografts placed in interferon-gamma knockout recipients. Am J Pathol 152: 359–365, 1998[Abstract]
  40. Kramer P, Ten Kate FWJ, Bijnen AB, Jeekel J, Weimar W: Recombinant leucocyte interferon A induces steroid-resistant acute vascular rejection episodes in renal transplant recipients. Lancet 1: 989–990, 1984[Medline]
  41. Magnone M, Holley JL, Shapiro R, Scantlebury V, McCauley J, Jordan M, Vivas C, Starzl T, Johnson JP: Interferon-alpha-induced acute renal allograft rejection. Transplant 59: 1068–1070, 1995[Medline]
  42. Kovarik J, Mayer G, Pohanka E, Schwarz M, Traindl O, Graf H, Smolen J: Adverse effect of low-dose prophylactic human recombinant leukocyte interferon-alpha treatment in renal transplant recipients. Cytomegalovirus infection prophylaxis leading to an increased incidence of irreversible rejections. Transplant 45: 402–405, 1988[Medline]
  43. Takahara S, Kakimoto K, Kokado Y, Kameoka H, Ishibashi M, Kawada S, Kyo M, Nagano S, Mikami O, Okuyama A: Interferon alpha therapy for chronic active hepatitis type C after renal transplantation and allograft rejection. Int Urol Nephrol 27: 479–485, 1995[Medline]
Received for publication November 20, 2001. Accepted for publication December 22, 2001.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afrouzian, M.
Right arrow Articles by Halloran, P. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afrouzian, M.
Right arrow Articles by Halloran, P. F.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP