 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
Department of Nephrology-Hypertension, University of Antwerp, Belgium.
Correspondence to Dr. Marc E. De Broe, Department of Nephrology-Hypertension, University of Antwerp, p/a University Hospital Antwerp, Wilrijkstraat 10, B-2650 Edegem/Antwerpen, Belgium. Phone: +32-3-821-3421; Fax: +32-3-829-0100; E-mail: debroe{at}uia.ua.ac.be
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In several experimental models of renal disease, highly upregulated OPN levels have been reported (5,6,10–16). The precise role of OPN in renal pathophysiologic processes remains unclear, however. A protective role for OPN was deduced from its ability to reduce inducible nitric oxide synthase levels (17,18). Through its interactions with several integrins, OPN has been reported to promote cell attachment and migration (19,20) and to decrease tubular cast formation (21). The stimulation of transforming growth factor-
activity, collagen deposition (22), and macrophage attraction (22,23) and the reduction of apoptotic cell death (22) suggest a role for OPN in renal fibrosis.
Upregulated OPN expression after acute renal injury in rats exhibits a specific pattern (5,6). Distal tubular cells (DTC) demonstrate pronounced OPN expression at their apical cell surfaces, whereas only a few DTC exhibit perinuclear staining. In proximal tubular cells (PTC), however, OPN is predominantly observed in perinuclear vesicles and apical cell surface expression is restricted to regenerating PTC (6). The same pattern of OPN expression, although less prominent, was observed by Hudkins et al. (2) in normal human kidney at sites of interstitial inflammation and fibrosis.
An understanding of renal OPN function requires elucidation of this peculiar OPN expression pattern. OPN synthesis, secretion, and localization in primary cell cultures of human PTC and DTC were examined, to obtain better insight into the cellular OPN expression pattern and to learn more regarding human OPN expression in general.
A cell culture system for mixed and pure human PTC and DTC was previously developed in our laboratory (24–26). Flow cytometric immunodissection of PTC and DTC, on the basis of their expression of leucine aminopeptidase (LAP) and epithelial membrane antigen (EMA), respectively, has been described as an accurate method to obtain pure primary cultures of human PTC and DTC (24–26). In the mixed cultures, PTC or DTC origins can be determined by means of LAP or EMA expression, respectively (24–26).
OPN localization was investigated by microscopic and flow cytometric analyses after immunofluorescent staining of cell cultures for OPN, LAP, and EMA. OPN transcription was studied by Northern blotting and reverse transcription (RT)-PCR, and OPN synthesis and secretion were investigated by Western blotting and enzyme-linked immunosorbent assays (ELISA) of both cell culture conditioned media and cell lysates. Intracellular OPN localization was investigated by means of confocal microscopy, using antibodies raised against OPN and specific organelle markers.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
OPN Detection in Human Biopsies
Ischemic human biopsies obtained from transplantation kidneys before implantation were fixed in methacarn fixative for 4 h and embedded in paraffin. Tissue sections were blocked with normal horse serum, incubated overnight with OP189, washed, and subsequently incubated for 30 min with biotinylated horse anti-goat Ig antibody (Vector, Burlingame, CA). After washing and incubation with avidin-biotin-peroxidase complex (Vector), OPN immunoreactivity was detected with diaminobenzidine. Sections were counterstained with periodic acid-Schiff reagent.
Isolation, Purification, and Culture of Human PTC and DTC
PTC and DTC were isolated as described previously (24,25). Briefly, normal human kidney tissue, which became available through nephrectomies performed for oncologic indications, was collected and processed in a sterile manner. Macroscopically normal tissue was decapsulated. The cortex and outer stripe of the outer medulla were dissected, cut into pieces of approximately 1 mm3, and digested in collagenase D solution (Roche, Ottweiler, Germany) supplemented with DNase (Sigma). The suspension was shaken vigorously for 2 h at 37°C and sieved through a 120-µm sieve. The resulting single-cell suspension was loaded on top of a discontinuous Percoll (Amersham Pharmacia Biotech, Uppsala, Sweden) gradient with densities of 1.04 and 1.07 g/ml. After centrifugation, cells from the intersection were carefully aspirated, washed, and either brought into culture as a mixed population or subjected to further purification via flow cytometric sorting. For sorting, cells were incubated for 30 min at 4°C with anti-human LAP and EMA monoclonal antibodies; LAP and EMA were previously identified in our laboratory as markers of proximal and distal tubules, respectively (24). Phycoerythrin-labeled rabbit F(ab')2 anti-mouse Ig (Dako, Glostrup, Denmark) and FITC-labeled goat F(ab')2 anti-rat Ig (SBA, Birmingham, AL) secondary antibodies were then added to the cell suspensions. Labeled cells were sorted into distinct PTC (LAP+/EMA-) and DTC (LAP-/EMA+) populations by using a FACStar Plus flow cytometer (Becton Dickinson, San Diego, CA). For assessment of sorting purity, >1000 cells from each population were reanalyzed by flow cytometry.
Mixed and pure cultures of PTC and DTC were grown on six-well plates (Costar, Cambridge, UK) or tissue culture chamber slides (Life Technologies, Rockville, MD) for 5 d, in 
-minimal essential medium (Life Technologies) modified as described by Gibson d’Ambrosio et al. (28) and supplemented with 10% fetal calf serum. Fetal calf serum-containing medium was replaced with serum-free, Gibson d’Ambrosio-modified -minimal essential medium 24 h before experiments. Cultures were in a proliferating state when experiments were performed.
Recombinant Human OPN
Histidine6-tagged, recombinant human OPN was produced after induction of protein synthesis in Escherichia coli M15 cells containing an expression vector with the coding sequence for human OPN (kindly provided by Dr. M. Hook, ECM Research Center, University of Texas). OPN was purified on a nickel-nitrilotriacetic acid column (Qiagen, Hilden, Germany).
Immunofluorescent Staining of OPN, LAP, and EMA
Human tubular cell cultures were fixed in 4% formaldehyde for 10 min, washed, and blocked with normal donkey serum. Cells were incubated overnight with primary antibody combinations (OP189/anti-EMA, OP189/anti-LAP, or anti-LAP/anti-EMA) and were then incubated for 2 h with FITC- or Cy3-labeled donkey anti-goat, -rat, or -mouse Ig secondary antibodies (Jackson Immunoresearch, West Grove, PA). OP189 was replaced with preimmune serum as a negative control. For verification of OPN signal specificity, OP189 was preadsorbed with nickel-nitrilotriacetic acid immobilized human recombinant OPN. Both replacement and preadsorption of OP189 resulted in the loss of OPN signals.
Flow Cytometric Analysis
LAP, EMA, and OPN cell surface expression in human tubular cell cultures was investigated by LAP/EMA/OPN triple-staining of living, unfixed, nonpermeable cells. In these experiments, only extracellular OPN could be detected. Mixed human tubular cell cultures were trypsinized (0.125% trypsin, 0.04% ethylenediaminetetraacetate), and the resulting cell suspension was incubated for 30 min at 4°C with a combination of OP189, anti-EMA, and biotinylated anti-LAP antibodies. After washing, phycoerythrin-labeled donkey anti-goat Ig (Jackson Immunoresearch), FITC-labeled donkey anti-rat Ig (Jackson Immunoresearch), and Peridinin chlorophyll protein-conjugated streptavidin (Becton Dickinson) were added to the cell suspension. Analyses were performed by using a FACStar Plus flow cytometer (Becton Dickinson) equipped with LYSIS software. Double-staining (LAP/EMA, LAP/OPN, and EMA/OPN), single-staining (LAP, EMA, and OPN), and a negative control sample of unstained cells were assessed for regulation of fluorescence compensation settings. OPN signal specificity was confirmed as described above for immunofluorescent OPN staining.
Northern Blot Analysis
RNA was extracted from mixed and pure PTC and DTC cultures and from normal human kidney tissue by using Trizol reagent (Life Technologies), according to the instructions provided by the manufacturer. Extracted RNA (2.5 µg) was subjected to electrophoresis in denaturing 1.2% agarose gels and was transferred to Hybond N+ membranes (Amersham Pharmacia Biotech) by alkaline vacuum blotting. Membranes were then hybridized (in 50% formamide, 5x SSC) with a 32P-labeled DNA probe generated by random-primed DNA labeling (Megaprime DNA labeling kit; Amersham Pharmacia Biotech) of the cDNA insert from the human OPN expression vector. Posthybridization high-stringency washes were performed at 65°C. Membranes were then exposed to autoradiographic film for 8 h. RNA extracted from normal human kidneys was used as a positive control sample.
RT-PCR, Cloning, and Sequencing of OPN mRNA
RNA from PTC and DTC was extracted with a SV total RNA isolation kit (Promega, Madison, WI) and reverse-transcribed into cDNA. OPN primers (CCATGAGAATTGCAGTGATTTGCTTTTGC and CGTTAATTGACCTCAGAAGATGCACTATC) were used for PCR amplification of the OPN coding sequence. The PCR products were subjected to electrophoresis, isolated from the agarose gel, and cloned into a pGEM-T vector (Promega). Finally, OPN inserts from PTC and DTC were sequenced by Eurogentec (Ivoz-Ramet, Belgium) with a T7/T3 primer set and compared.
Western Blotting
Serum-free conditioned media were collected 24 h after addition to human tubular cell cultures. Cells were then washed with phosphate-buffered saline and lysed for 20 min at 4°C in RIPA buffer (0.05 M Tris-HCl, pH 7.2, 0.15 M NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate) supplemented with a mixture of protease inhibitors (Roche). Cell lysates were cleared by centrifugation (12,000 x g for 30 min at 4°C). Six microliters of conditioned medium or cell lysate were subjected to electrophoresis on a 10% sodium dodecyl sulfate-polyacrylamide gel. Proteins from the gel were electroblotted onto polyvinylidene difluoride membranes (Amersham Pharmacia Biotech). Membranes were incubated overnight in 5% nonfat dry milk (blotting-grade blocker; Bio-Rad, Hercules, CA) and were then incubated with LF123 antiserum for 1 h. After Tris-buffered saline/Tween washes, membranes were incubated with a peroxidase-conjugated donkey anti-rabbit Ig antibody (Amersham Pharmacia Biotech). The immune complexes were detected by using a chemiluminescence kit (ECL Western blotting kit; Amersham Pharmacia Biotech). Human recombinant and urinary OPN were used as positive control samples. OPN signal specificity was confirmed as described above.
ELISA
OPN concentrations were determined with an ELISA procedure. Serum-free conditioned media or cell lysates (see above) were coated overnight onto 96-well plates. Nonspecific protein binding was blocked with a 2-h incubation with 1% bovine serum albumin. OPN was detected with LF123 and a biotinylated goat anti-rabbit Ig antibody (Dako). After incubation with avidin-biotin-peroxidase complex (Dako), peroxidase substrate (TMB substrate kit; Pierce Chemical Co., Rockford, IL) was added. After 30 min, the reaction was stopped with 2 N H2SO4 and the color intensity was quantified at 450 nm. Using human recombinant OPN as a standard, OPN concentrations were estimated and expressed as milligrams of OPN per gram of protein. OPN signal specificity was confirmed as described above.
Intracellular OPN Localization
Endocytotic Vesicles.
Living human tubular cell cultures were incubated with 7.5 µg/ml FITC-labeled dextran (Mr 10,000; Molecular Probes, Eugene, OR) for 30 min at 37°C and were then washed 10 times, for removal of noninternalized dextran. Cells were then fixed in 4% formaldehyde for 10 min.
Lysosomes.
Mixed cultures of human PTC and DTC were fixed in 4% formaldehyde for 10 min, incubated with 0.1% Triton X-100 for 10 min, and blocked with normal donkey serum. Cells were incubated overnight with anti-cathepsin D antibody and were then incubated for 2 h with a Cy3-labeled anti-rabbit Ig secondary antibody (Jackson Immunoresearch).
Golgi Apparatus.
Mixed cultures of human PTC and DTC were fixed in 4% formaldehyde for 10 min, incubated with 0.1% Triton X-100 for 10 min, and blocked with normal donkey serum. Cells were incubated overnight with primary antibodies (OP189 and anti-58K protein) and were then incubated for 2 h with Cy3- and FITC-labeled donkey anti-goat Ig and donkey anti-mouse Ig secondary antibodies (Jackson Immunoresearch).
Fluorescence signals were analyzed by using a confocal laser scanning microscope (LSM 410; Zeiss, Jena, Germany). Image processing was performed by using Imaris 2.7 image-reconstruction software (Bitplane AG) on a Silicon Graphics (Mountain View, CA) Indigo workstation.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Localization of OPN Expression in Human Tubular Cell Cultures
Immunocytochemical analyses clearly demonstrated different OPN expression patterns in DTC and PTC (Figures 2 and 3). In both mixed (Figure 2, A, A', B, and B') and pure (Figure 2, C and D) tubular cultures, virtually all DTC (EMA-positive) demonstrated strong OPN immunoreactivity (Figure 2, A and A'), whereas PTC (LAP-positive) were weakly OPN positive (Figure 2, B and B'). OPN staining of EMA-positive DTC was intense and covered the entire cell surface (consistent with plasma membrane expression) (Figure 2C). Much less plasma membrane staining was observed in LAP-positive PTC (Figure 2D), where OPN staining appeared mainly intracellular and perinuclear. This perinuclear intracellular OPN staining in PTC was clearly demonstrated when cells were permeabilized before immunostaining and were observed with confocal laser scanning microscopy (Figure 3). Intracellular perinuclear OPN staining in DTC could be observed only when plasma membrane OPN staining was less prominent (Figure 3).
|
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In rats, OPN upregulation is observed in several models of acute or chronic renal failure (5,6,10,11,13,16), with OPN displaying a peculiar expression pattern. DTC demonstrate pronounced OPN expression at the apical cell surface, and only a few DTC exhibit perinuclear staining (5,6). In PTC, however, OPN is observed predominantly in perinuclear vesicles, and apical cell surface expression is limited to regenerating PTC (6). Little is currently known regarding OPN upregulation in the human kidney. Limited OPN upregulation has been observed at sites of interstitial inflammation and fibrosis in human kidney sections (2). In cell culture, upregulation of OPN mRNA after hypoxia and reoxygenation has been observed (29). Therefore, we performed OPN staining in human renal tissue from transplantation kidneys. In this tissue, which had been ischemic (variable degrees of warm and cold ischemia), prominent OPN immunostaining was detected at the apical cell surface of DTC and perinuclear OPN staining was observed in slightly damaged PTC. These findings are in good agreement with the OPN expression pattern observed in rat kidneys after acute toxic/ischemic renal damage (5,6). Because all biopsies were obtained from the cortex, it is not possible to comment on OPN localization in the S3 segments of proximal tubules. However, clear perinuclear OPN localization in both S1/S2 and S3 segments in rats has been reported (5,6), which strongly suggests that perinuclear OPN localization is present in all proximal tubular segments in human kidneys as well.
An understanding of the peculiar OPN expression pattern is required for accurate comprehension of renal OPN function. To obtain better insights into the synthesis, secretion, and cellular localization of human renal OPN, we used a human PTC and DTC culture system that was developed in our laboratory (24–26).
OPN immunostaining of these cultures resulted in a staining pattern comparable to the OPN staining pattern observed in injured rat kidneys, which is characterized by immediate OPN upregulation in >90% of the distal tubules and de novo OPN expression in the proximal tubular segments (5,6). Correspondingly, 93 ± 5.6% of the DTC (EMA-positive) were OPN-positive in the in vitro model. Moreover, the presence of OPN on the plasma membrane is consistent with the apical localization of OPN observed in vivo (5,6). Intracellular OPN expression in DTC was masked by strong cell surface expression; intracellular perinuclear OPN staining was visible in only a few DTC. The in vitro intracellular OPN expression at the PTC level corresponds to the perinuclear vesicular OPN expression observed in vivo (5,6). In addition, weak plasma membrane staining of some PTC has been observed in vivo on regenerating PTC (6). It can be concluded that OPN localization in our cell cultures closely mimics the in vivo situation after toxic/ischemic renal damage. It is most likely that the detection of this pattern, indicating OPN upregulation in our cell cultures, is attributable to cellular stress caused by the cell culture procedure. In addition, OPN expression has been observed to be greater in renal cell cultures originating from older (>40 to 50 yr) individuals, compared with young (<10 to 20 yr) individuals (29). Because our kidney tissue donors were >50 yr of age, this finding may account to some degree for the pronounced OPN expression in our cultures. We attempted to alter OPN expression in our cell cultures with different stimuli (ATP depletion, HgCl2, transforming growth factor-, and lipopolysaccharide), but no OPN upregulation was observed. Therefore, our cell culture system reproduced the specific upregulated OPN expression pattern, which allowed us to investigate this pattern extensively.
We observed human renal OPN synthesis to be very similar in PTC and DTC. A single OPN transcript of 1.6 kb was observed in PTC and DTC. In addition, cell lysates and conditioned media of PTC and DTC contained the same three OPN forms, in comparable amounts. These findings indicate similar OPN transcription, translation, posttranslational modification, and secretion in PTC and DTC. OPN secretion by human tubular cells is in agreement with the presence of OPN in human urine (uropontin) (30,31). Posttranslational modification is supported by the detection of different OPN forms (with higher molecular masses than recombinant OPN) in the absence of alternative splicing. Moreover, the posttranslational modification of OPN in our culture system is identical to the posttranslational modification of OPN in vivo, as similar forms of OPN were observed in cell culture media and in urine.
These findings indicate that, in both PTC and DTC, the OPN protein passes through the Golgi apparatus after mRNA transcription in the nucleus and translation in the endoplasmic reticulum, before secretion. Indeed, we clearly demonstrated the presence of OPN in the Golgi apparatus. Therefore, the observed in vivo and in vitro intracellular OPN expression most likely corresponds to the posttranslational modification of OPN in the Golgi complex and its subsequent transport for secretion. This is consistent with immuno-electron microscopic studies that located OPN in the Golgi apparatus of epithelial cells in the gall bladder and gastric mucosa (32,33) and in the distal tubule of the kidney (14). In PTC, however, OPN has been observed primarily in cytoplasmic bodies with the ultrastructural appearance of endosomes and lysosomes (14,34). This indicates that OPN would accumulate in PTC by endocytosis, which is not consistent with OPN synthesis and secretion by PTC. However, it is possible that, as in DTC, at least part of the secreted OPN becomes linked with the plasma membrane but is immediately re-endocytosed. Such a mechanism would explain why OPN accumulates on cells with poorly developed endocytotic capacities, such as DTC and regenerating PTC. Observation of the endocytotic pathway in our cultures demonstrated that endocytotic/lysosomal vesicles were scattered throughout the cytoplasm, whereas intracellular OPN was confined to the perinuclear zone. Consequently, PTC endocytosis cannot account for the absence of OPN at the PTC membrane. This confirms that intracellular OPN corresponds primarily to OPN secretion and not to endocytosis. The possibility that differences in OPN localization are the result of different molecular mass OPN forms (with different biologic activities) in PTC and DTC can also be excluded, because PTC and DTC produced and secreted the same OPN isoforms, in comparable amounts.
The exact role of OPN in renal physiologic processes is still unclear (35). Therefore, it is difficult to ascribe a functional significance to the observed OPN expression pattern. Both PTC and DTC demonstrated perinuclear OPN staining, although it was masked by the strong extracellular plasma membrane OPN localization in DTC. This extracellular plasma membrane OPN localization pattern for DTC constituted the difference between PTC and DTC in both rats and human subjects, both in vivo and in vitro. It seems most reasonable that the perinuclear OPN staining reflects some common machinery involved in the synthesis of OPN (including the Golgi apparatus, in which OPN was clearly localized), whereas the extracellular plasma membrane OPN localization observed for DTC represents the difference between PTC and DTC. Because the synthesis and secretion of OPN are the same in PTC and DTC and because PTC endocytosis cannot account for this difference, a plausible hypothesis for this apical OPN localization involves a preferential binding capacity of OPN (secreted by both PTC and DTC) for the DTC membrane. It is possible that the presence of OPN at the DTC plasma membrane has consequences for the renal handling of casts (21) or crystals (7–9). Further research is needed to resolve this issue.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  P.-L. Chang, L. Harkins, Y.-H. Hsieh, P. Hicks, K. Sappayatosok, S. Yodsanga, S. Swasdison, A. F. Chambers, C. A. Elmets, and K.-J. Ho Osteopontin Expression in Normal Skin and Non-melanoma Skin Tumors J. Histochem. Cytochem., January 1, 2008; 56(1): 57 - 66. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Moochhala, J. A. Sayer, G. Carr, and N. L. Simmons Renal calcium stones: insights from the control of bone mineralization Exp Physiol, January 1, 2008; 93(1): 43 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Packer, S. Pavey, A. Parker, M. Stark, P. Johansson, B. Clarke, P. Pollock, M. Ringner, and N. Hayward Osteopontin is a downstream effector of the PI3-kinase pathway in melanomas that is inversely correlated with functional PTEN Carcinogenesis, September 1, 2006; 27(9): 1778 - 1786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A K Katakam, G Chipitsyna, Q Gong, A R Vancha, J Gabbeta, and H A Arafat Streptozotocin (STZ) mediates acute upregulation of serum and pancreatic osteopontin (OPN): a novel islet-protective effect of OPN through inhibition of STZ-induced nitric oxide production J. Endocrinol., November 1, 2005; 187(2): 237 - 247. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Verhulst, P. C. D'Haese, and M. E. De Broe Inhibitors of HMG-CoA Reductase Reduce Receptor-mediated Endocytosis in Human Kidney Proximal Tubular Cells J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2249 - 2257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Simeoni, A. Boyde, D. G. Shirley, G. Capasso, and R. J. Unwin Application of red laser video-rate scanning confocal microscopy to in vivo assessment of tubular function in the rat: selective action of diuretics on tubular diameter Exp Physiol, March 1, 2004; 89(2): 181 - 185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Asselman, A. Verhulst, M. E. de Broe, and C. F. Verkoelen Calcium Oxalate Crystal Adherence to Hyaluronan-, Osteopontin-, and CD44-Expressing Injured/Regenerating Tubular Epithelial Cells in Rat Kidneys J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3155 - 3166. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Verhulst, M. Asselman, V. P. Persy, M. S.J. Schepers, M. F. Helbert, C. F. Verkoelen, and M. E. De Broe Crystal Retention Capacity of Cells in the Human Nephron: Involvement of CD44 and Its Ligands Hyaluronic Acid and Osteopontin in the Transition of a Crystal Binding- into a Nonadherent Epithelium J. Am. Soc. Nephrol., January 1, 2003; 14(1): 107 - 115. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
