| 2008 JASN IMPACT FACTOR 7.505 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |




*Department of Medicine, University of Melbourne, Austin & Repatriation Medical Centre (Repatriation Campus), Heidelberg West, Victoria, Australia;
Department of Cell Biology, Institute of Nephrology, Niigata University School of Medicine, Niigata, Japan;
Department of Medicine, University of Virginia Health Sciences Center, Charlottesville, Virginia; and
Novartis Pharma AG, Basel, Switzerland.
Correspondence to Dr. Zemin Cao, Department of Medicine, University of Melbourne, Austin & Repatriation Medical Centre (Repatriation Campus), Heidelberg West, Victoria 3081, Australia; Phone: 613-9496-2347; Fax: 613-9497-4554; E-mail: cao{at}austin.unimelb.edu.au
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent studies in the heart have highlighted the controversy relating to the role of the AT2 receptor in various diseases. For example, the AT2 receptor has been reported to mediate an inhibitory effect on coronary arterial remodeling (10). By contrast, a recent study in the heart suggested that this receptor subtype has trophic effects (11). Indeed, whether the AT2 receptor is protective, neutral, or injurious in terms of end-organ protection, particularly in pathophysiologic states, has not been clarified (12). Specifically with respect to the kidney, whether the AT2 receptor plays a role in the pathogenesis of progressive renal injury is largely unknown. The aims of the present study were first to explore the status of angiotensin II receptor subtypes in the remnant kidney, a classical nonimmunologically mediated form of renal injury that is responsive to interruption of the RAS (1,13), and second to assess the effects of blockade of the AT2 receptor with the selective nonpeptide antagonist PD123319 alone or in combination with the AT1 receptor antagonist valsartan on functional, structural, cellular, and molecular aspects of renal injury. On the basis of postulated effects of the AT2 receptor, macrophage accumulation, cellular proliferation, and osteopontin expression were specifically evaluated. In addition, because recent studies have implicated a slit pore protein, nephrin, in the development of proteinuria in a number of renal diseases (1416), we also assessed nephrin gene and protein expression in this study.
| Materials and Methods |
|---|
|
|
|---|
Reverse TranscriptionPCR.
Three micrograms of total RNA extracted from each kidney was used to synthesize cDNA with the Superscript First Strand synthesis system for reverse transcriptionPCR (RT-PCR; Life Technologies BRL, Grand Island, NY). AT1 and AT2 receptor gene expression was analyzed by real-time quantitative RT-PCR performed with the TaqMan system based on real-time detection of accumulated fluorescence (ABI Prism 7700; Perkin-Elmer, Foster City, CA) (18). Fluorescence for each cycle was quantitatively analyzed by an ABI Prism 7700 Sequence Detection System (Perkin-Elmer, PE Biosystems, Foster City, CA). To control for variation in the amount of DNA available for PCR in the different samples, gene expression of the target sequence was normalized in relation to the expression of an endogenous control, 18S ribosomal RNA (rRNA) (18S rRNA TaqMan Control Reagent kit; ABI Prism 7700). Primers and Taqman probes for AT1 and AT2 receptors and the endogenous reference 18S rRNA were constructed with the help of Primer Express (ABI Prism 7700). For amplification of the AT1 receptor cDNA, the forward primer was 5'CGGCCTTCGGATAACATGA3', and the reverse primer was 5'CCTGTCACTCCACCTCAAAACA 3'. The probe specific for AT1 receptor was FAM-5'CTCATCGGCCAAAAAGCCTGCGT-3'-TAMRA; FAM = 6-carboxyfluorescein, TAMRA (quencher) = 6-carboxy-tetramethylrhodamine. For the AT2 receptor cDNA, the forward primer was 5' CAATCTGGCTGTGGCTGACTT 3' and the reverse primer was 5' TGCACATCACAGGTCCAAAGA 3'. The probe specific to AT2 receptor was FAM-5' CAACCCTTCCTCTCTGGGCAACCTATTACTCTTATA-3'-TAMRA. The amplification was performed with the following time course: 50°C for 2 min and 95°C for 10 min and 40 cycles of 94°C for 20 s and 60°C for 1 min. Each sample was tested in triplicate. Results were expressed as relative to control kidneys, which were arbitrarily assigned a value of 1.
AT1 and AT2 Receptor Binding by Autoradiography.
Binding densities of AT1 and AT2 receptors were determined in the kidneys of control and STNx rats (4). In brief, the kidneys were removed and frozen in liquid nitrogencooled isopentane and stored at -20°C. Twenty-micron sections were cut on a cryostat at -20°C, then dehydrated overnight under reduced pressure at 4°C before in vitro binding studies were performed. The sections were preincubated for 15 min in 10 mM sodium phosphate buffer (pH 7.4) followed by 1 h of incubation in a fresh volume of the same buffer containing the AT2 receptor-selective radioligand 125I-CGP42112B (15 pmol/L) (4), 0.1% bovine serum albumin, and 0.3 mM bacitracin in the absence (total binding) or the presence (nonspecific binding) of nonradiolabeled CGP42112B (10-6 mol/L).
Binding for the AT1 receptor was assessed using an analogue of angiotensin II, 125I-Sar1, Ile8 angiotensin II (19). Sections were preincubated for 15 min in 10 mM sodium phosphate buffer (pH 7.4) followed by 1 h of incubation in a fresh volume of the same buffer containing 125I-Sar1, Ile8 angiotensin II (approximately 90 pmol/L), 0.1% bovine serum albumin, and 0.3 mM bacitracin. Specific AT1 receptor binding was determined in the presence of the AT2 receptor antagonist PD123319 (10-6 mol/L; Parke-Davis, Ann Arbor, MI), whereas nonspecific binding was determined in parallel incubations in the presence of both 10-6 mol/L PD123319 and 10-6 mol/L valsartan (Novartis Pharma AG, Basel, Switzerland) (20).
After incubation with either 125I-CGP42112B or 125I-Sar1, Ile8 angiotensin II, the sections were washed four times for 1 min each in ice-cold buffer and air dried at room temperature. Slides were exposed to Kodak BioMax x-ray film at room temperature for 5 d. After exposure, the films were processed and the optical densities were quantified by a microcomputer imaging device (MCID Imaging system, St. Catherines, Ontario, Canada) connected to an IBM Pentium computer (21). The computer program using the radioactivity standards constructed a calibration curve of optical density versus radioactivity density. Specific binding densities were calculated as the difference between total and nonspecific binding densities.
AT1 and AT2 Receptor Expression by Immunohistochemistry.
Immunohistochemical staining of the AT2 receptor was performed using a specific polyclonal antiserum to this receptor (22). This polyclonal antiserum was raised in the rabbit against a synthetic peptide sequence derived from the AT2 receptor, and its specificity has been previously determined (23). Immunohistochemical staining of the AT1 receptor was performed using a specific rabbit polyclonal antibody to this receptor subtype (sc 1173;, Santa Cruz Biotechnology, Santa Cruz, CA). In brief, 20-µ frozen kidney sections were cut on a cryostat at -20°C. Frozen sections were fixed with cold acetone, and endogenous peroxidase was inactivated using 0.1% hydrogen peroxide in phosphate-buffered saline. The sections were incubated with protein-blocking agent, and endogenous nonspecific binding for biotin/avidin was blocked using a biotin/avidin blocking kit (Vector Laboratories, Burlingame, CA). Kidney sections were incubated overnight (16 h) at 4°C after 1 h of incubation at room temperature with polyclonal antiserum to either the AT1 receptor or the AT2 receptor (both 1:50 dilution). Biotinylated horse anti-rabbit Ig (Vector Laboratories) was used as a second antibody, followed by horseradish peroxidase-conjugated streptavidin. Peroxidase activity was identified by reaction with 3,3'-diaminobenzidine tetrahydrochloride (DAB, Sigma Chemical Co., St. Louis, MO) substrate.
Protocol 2: Effect of AT2 Receptor Blockade Alone or in Combination with the AT1 Receptor Antagonist
Experimental Protocol.
STNx (n = 50) was performed as described in protocol 1. The STNx animals were randomly allocated to one of the following groups: (1) no treatment (STNx, n = 13); (2) AT1 receptor antagonist valsartan at a dose of 30 mg/kg/d by gavage (STNx+valsartan, n = 15); (3) AT2 receptor antagonist PD123319 at a dose of 5 mg/kg/d delivered by subcutaneous osmotic minipump (Alzet model 2ML4, Alza Corporation, Palo Alto, CA) implanted immediately after STNx (STNx+PD123319, n = 16); or (4) The combination of valsartan and PD123319 (STNx+valsartan+PD123319, n = 6). The doses of valsartan and PD123319 were chosen according to a previous study showing effective blockade of these receptor subtypes at these doses, as assessed by in vitro binding (4). Sham-operated rats were used as control (n = 12).
Systolic BP (SBP) was measured weekly by indirect tail-cuff plethysmography. Animals were housed weekly in metabolic cages for collection of 24-h urine samples and measurement of urinary protein excretion using the Coomassie Brilliant Blue method. Before the rats were killed after 4 wk of treatment, GFR was measured by using the 99mTc-DTPA method (24). Plasma urea and creatinine concentrations were measured by autoanalyzer (Beckman Instruments, Palo Alto, CA) at the conclusion of the experiment. At the end of the experiment, animals were anesthetized and the kidneys were removed, weighed, and fixed in 10% formalin for subsequent pathologic examination and in situ hybridization and frozen for RT-PCR as well as immunostaining with nephrin antibody.
Kidney Histopathology.
Assessment of glomerulosclerosis and tubulointerstitial injury was performed by semiquantitative methods as described previously (17,25). In brief, kidney sections were stained with hematoxylin and eosin and observed under light microscope in a masked manner at a magnification of x400. All glomeruli in each kidney section were graded according to the severity of the glomerular damage: 0, normal; 1, slight glomerular damage, the mesangial matrix and/or hyalinosis with focal adhesion, involving <25% of the glomerulus; 2, sclerosis of 25% to 50%; 3, sclerosis of 50% to 75%; 4, sclerosis of >75% of the glomerulus. The tubulointerstitial area in the cortex was observed and graded as follows: 0, normal; 1, the area of interstitial inflammation and fibrosis, tubular atrophy, and dilation with cast formation involving <25% of the field; 2, lesion area between 25% and 50% of the field; and 3, lesions involving >50% of the field. Indices of glomerular damage or tubulointerstitial injury were calculated by averaging the grades assigned to all glomeruli or tubular fields.
In Situ Hybridization for Osteopontin and Nephrin.
In situ hybridization studies were performed using techniques as reported previously (26) and outlined below. Antisense riboprobes for rat nephrin were generated as described previously (14). Osteopontin RNA probes were generated from the rat smooth muscle osteopontin cDNA (a gift from Dr. Richard Johnson, Department of Nephrology, University of Washington, Seattle, WA, and currently Chief, Renal Section, Baylor College of Medicine, Houston, TX) (27). 35S-labeled RNA probes for nephrin or osteopontin were prepared with transcription kits (Promega, Madison, WI). Purified riboprobe length was adjusted to approximately 150 bases by alkaline hydrolysis. Four-micron sections were cut onto slides precoated with 3-aminopropyltriethoxysilane and baked overnight at 37°C. Tissue sections were dewaxed and rehydrated in graded ethanol and milliQ water, equilibrated in P buffer (50 mM Tris-HCl [pH 7.5], 5 mM EDTA) and incubated in 125 µg/ml Pronase E in P buffer for 10 min at 37°C. Sections were then washed twice in 0.1 M sodium phosphate buffer (pH 7.2), postfixed in 4% paraformaldehyde for 10 min, washed twice in 0.1 M sodium phosphate buffer, then rinsed in milliQ water, dehydrated in 70% ethanol, and air dried. Hybridization buffer containing 2 x 104 cpm/µl riboprobe in 300 mM NaCl, 10 mM Tris-HCl (pH 7.5), 10 mM Na2HPO4, 5 mM EDTA (pH 8.0), 50% deionized formamide, 20 mg/ml yeast RNA, 10% wt/vol dextran sulfate, and 100 mM dithiothreitol was heated to 85°C for 5 min. Twenty-five microliters of this solution was then added to each section and incubated at 60°C overnight in a 50% formamide humidified incubator. As controls for nonspecific signal, sections were incubated with sense riboprobe. Slides were washed in 2x standard saline citrate containing 50% formamide and then prewarmed to 50°C to remove coverslips. Sections were then washed in the above solution for 1 h shaking at 55°C, rinsed three more times in RNAse buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA [pH 8.0], 0.5 M NaCl) and then incubated with RNAse A (150 µg/ml) for 1 h at 37°C. Sections were later washed in 2x standard saline citrate for 45 min at 55°C, dehydrated in graded ethanol, air-dried, and exposed to BioMaxMR autoradiographic film for 3 to 5 d. Slides were then dipped in Amersham nuclear emulsion (Ilford, Mobberley, Cheshire, UK), stored in a light-free box at 4°C for 21 to 28 d, brought to room temperature, then immersed in Kodak D19 developer, washed in acetic acid, and fixed in Ilford Hypan before staining with hematoxylin and eosin.
RT-PCR for Nephrin Gene Expression.
Gene expression for nephrin was also assessed by RT-PCR as described previously (15). In brief, the probe specific to nephrin was FAM-5'CAACCCTTCCTCTCTGGGCAACCTATTACTCTTATA-3';-TAMRA; FAM = 6-carboxyfluorescein, TAMRA (quencher) = 6-carboxy-tetramethylrhodamine.
Immunohistochemistry.
Immunohistochemical staining of nephrin was performed as described previously according to a modified method using a specific antibody to 5-1-6 antigen, which is identical to rat nephrin (14). In brief, 20-µ frozen kidney sections were incubated for 1 h at room temperature with monoclonal 5-1-6 antibody. Biotinylated horse anti-mouse Ig (Vector Laboratories) was used as a second antibody, followed by horseradish peroxidase-conjugated streptavidin. Peroxidase activity was identified by reaction with DAB.
Immunohistochemistry for osteopontin, proliferating cell nuclear antigen (PCNA), and ED-1 was performed with paraffin-embedded sections as described previously (20,28). In brief, sections were labeled with a monoclonal antibody to PCNA (PC-10; DAKO A/S, Copenhagen, Denmark), the monocyte/macrophage antigen (ED-1; Serotec, Oxford, UK), or osteopontin (a gift from Dr. Richard Johnson) (27). Biotinylated Ig was used as a second antibody, followed by horseradish peroxidase-conjugated streptavidin. Detection was accomplished by reaction with DAB.
Histomorphometery.
Quantification of nephrin immunostaining was performed by calculation of the proportion of area occupied by the brown staining in all glomeruli per section using the Imaging Analysis System (AIS, Imaging Research, St. Catherines, Ontario, Canada) associated with a videocamera and computer as described previously (15,29). Quantification of osteopontin immunostaining was performed by assessment of the proportion of area of positive staining in tubules in the cortex areas per section. The positive cell numbers stained with PCNA or ED-1 were counted manually in the 30 renal cortical areas (nonischemic, nonscar area) including the glomeruli at a magnification of x400. The PCNA- or ED-1positive cells were expressed as number per field.
Statistical Analyses
Data were analyzed by analysis of variance using Statview SE (Brainpower, Calabasas, CA) on a Macintosh Computer (Cupertino, CA). Comparisons of group means were performed by Fishers least significant difference method. Data are shown as mean ± SEM, and P < 0.05 was viewed as statistically significant unless otherwise specified.
| Results |
|---|
|
|
|---|
|
|
|
BP.
SBP increased significantly after STNx (Figure 3A). This rise was prevented by valsartan administered alone or in combination with PD123319. Treatment with PD123319 alone did not affect the increase in SBP, and there was no significant difference in the antihypertensive effect of valsartan when PD123319 was added.
|
Plasma urea and creatinine concentrations were increased in STNx rats compared with control animals (Table 2). Treatment with either valsartan or PD123319 alone and in combination had similar effects in reducing plasma urea concentration. GFR was markedly reduced by 70% in STNx rats but was not significantly influenced by any of the treatments.
|
Severe tubulointerstitial injury followed renal mass reduction, and this was significantly attenuated to a similar extent by all treatments (Figure 4A). Similarly, increased monocyte/macrophage infiltration observed in the STNx rats was reduced to similar levels by all treatments (Figures 4B and 5). PCNA in the renal tubules was markedly increased in the STNx rats (Figures 4C and 6). Treatment with either valsartan or PD1233319 reduced the number of PCNA-positive renal tubular cells. The combination of valsartan and PD1233319 was associated with an additional reduction in PCNA-positive cells than seen with either monotherapy.
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
In the present study, we reported the status of AT1 and AT2 receptor expression in the kidney after STNx. With the use of a number of complementary techniques to assess gene and protein expression and status of the receptor at the level of ligand binding, reduced AT1 receptor expression was detected in this model. There seems to be a significant increase in AT2 receptor gene expression in this model. Global radioligand binding assessment of the AT2 receptor revealed no overall change in the remnant kidney, although this does not exclude local changes in receptor activation particularly at sites of injury. Indeed, immunohistochemical staining confirmed evidence of the AT2 receptor protein in the remnant kidney primarily at sites of tubulointerstitial injury. With reduced AT1 receptor expression and binding density, there seems to be an imbalance in the relative proportion of AT1 and AT2 receptors in this model. Changes of AT1 and AT2 receptors in the present study are similar to those reported in other models of renal injury (4,30). Renal AT1 but not AT2 receptors are downregulated in angiotensin IIinduced hypertension and in renal hypertension caused by clipping renal arteries as assessed by immunohistochemistry (30). Reduced AT1 but not AT2 receptor binding was also reported in the kidney after angiotensin II infusion as assessed by specific radioligand binding (4). It is important to appreciate that assessment of receptor status per se in an experimental model does not predict the response of that model to interruption of that receptor subtype. Indeed, despite STNx animals having reduced AT1 receptor expression, this model is very sensitive to the renoprotective effects of AT1 receptor antagonists (17,28). Nevertheless, the identification and characterization of the AT2 receptor in this model provided the rationale to investigate specific blockade of this receptor subtype.
A hallmark of renal injury is excessive urinary excretion of protein (proteinuria). The mechanisms of proteinuria or albuminuria continue to be investigated extensively. Recent studies have suggested that the human gene NPHS protein, nephrin, a cytoskeletal protein, localizes to the slit pore of podocytes in the glomerulus, playing a pivotal role in the pathogenesis of proteinuria (14,31). Several investigators have postulated a link between a deficiency in renal nephrin expression and proteinuria on the basis of a number of recent findings. First, mutation within the nephrin NPHSI gene has been reported to be responsible for the massive proteinuria observed in patients with congenital nephrotic syndrome of the Finnish type (32). Second, injection of an antibody to this protein has been shown to promote the development of proteinuria (14). Third, the association between the development of proteinuria and the deficiency in nephrin expression has been reported in various models of experimental renal injury, including puromycin aminonucleoside nephropathy (33), Passive Heymann nephritis (16), and diabetic nephropathy (15). In the present study, reduced gene and protein expression of nephrin expression in the renally ablated rats was associated with increased proteinuria. This is consistent with previous findings that indicate that there is a link between reduced nephrin expression and development of proteinuria (albuminuria) in the proteinuric renal disease.
The possible links between the RAS and the regulation of nephrin expression have been suggested by recent studies (15,16). Administration of an ACE inhibitor or an AT1 receptor antagonist attenuated the deficiency in renal nephrin expression in association with reduced proteinuria in two different models of progressive renal injury, Passive Heymann nephritis and diabetic nephropathy (15,16). These findings are consistent with those of our present study that demonstrated that AT1 receptor antagonism attenuated reduced nephrin expression in the remnant kidney. Furthermore, the AT2 receptor antagonist PD123319 also attenuated the deficiency of nephrin expression in the context of less proteinuria in these STNx rats. These findings could be interpreted as suggesting that at least part of the antiproteinuric effects of the RAS blockers, including the AT1 and AT2 receptor antagonists, is related to attenuation of nephrin expression. However, one cannot exclude that the changes in nephrin expression are secondary to improved renal ultrastructure in response to these agents that block the RAS. Indeed, it has been shown that agents that block the RAS influence slit pore structure in various disease states, including diabetes (34).
There is increasing evidence to suggest that increased urinary protein excretion not only is an indicator of renal injury but also may contribute to tubulointerstitial injury. In the normal setting, protein is filtrated from glomerulus and is reabsorbed by proximal tubule cells, where they are degraded by lysosomes. Accumulation of protein in proximal tubules may induce lysosome rupture and phenotypic changes, which will release or activate local vasoconstrictor or chemotactic proteins leading to inflammation (35). Blockade of angiotensin II by an ACE inhibitor or an AT1 receptor antagonist has been shown to reduce proteinuria in this model (1,2,4). This antiproteinuric effect has been reproduced in many human proteinuric renal diseases (36,37). A major finding in the present study was that the STNx rats treated with the AT2 receptor antagonist as well as the AT1 receptor antagonist had less proteinuria than untreated rats. It is possible that the antiproteinuric effects of AT2 receptor antagonist as has been previously observed with AT1 receptor antagonist lead to reduced tubular exposure to proteins, thereby providing and/or attenuating tubulointerstitial injury.
The finding of the AT2 receptor antagonist PD123319 on proteinuria in the present study is in contrast with a previous study, which showed a lack of beneficial effects after the administration of the AT2 receptor antagonist PD123319 (38). This previous study involved PD123319 being given via drinking water (38). Therefore, the discrepancy between two studies may be due to mode of administration of PD1233319 because other investigators have reported beneficial and positive findings with respect to PD123319 in the kidney and the vasculature when the compound was administered by continuous osmotic minipumps (4,20,39). Indeed, administration of PD123319 by continuous osmotic minipumps, as used in the present study, has been shown previously by our group to be an effective approach to block the AT2 receptor, specifically in the kidney and the vasculature (4,18).
Matrix protein accumulation is a pivotal pathologic process that leads to progressive renal injury, including fibrosis. It has been shown that osteopontin is increased in various models of renal injury (40) and that the expression of osteopontin is modulated directly by angiotensin II (27,41). Our previous study in angiotensin IIinfused rats showed that both AT1 and AT2 receptors modulate osteopontin expression (4). In the present study, we confirmed that there was increased osteopontin gene and protein expression in this model of progressive renal injury as previously reported (42). Furthermore, blockade of either the AT1 or AT2 receptor reduced osteopontin accumulation in the proximal tubules, albeit not to control levels. Importantly, combined AT1 and AT2 receptor blockade was superior to monotherapies with osteopontin mRNA levels in this group being similar to those observed in control rats.
Monocyte/macrophage infiltration is considered to play an important role in the development of inflammatory changes in the tubulointerstitium. Monocytes/macrophages are attracted to sites of injury by chemokines such as osteopontin (40). In addition, accumulation of monocytes/macrophages further releases inflammatory chemokines and cytokines, potentially leading to a vicious cycle perpetuating the pathways responsible for progressive tubulointerstitial injury. It has been shown that angiotensin II infusion induces inflammatory changes in renal tubules and the interstitium (27). In the present study, accumulation of monocytes/macrophages was noted in the remnant kidney after STNx, and this was prevented not only by AT1 but also by AT2 receptor blockade. A previous study showed that angiotensin II stimulates the expression of the chemokine RANTES, which promotes monocyte/macrophage infiltration in the kidney (6). This action of angiotensin II was mediated by the AT2 receptor (6). Therefore, the finding of this and previous studies linking the AT2 receptor to expression of osteopontin and RANTES, both proteins involved in macrophage recruitment, provides a potential pathway by which AT2 receptor blockade could reduce various aspects of tubulointerstitial damage.
Renal remodeling after renal mass reduction involves hypertrophy, increased proliferation, and extracellular matrix production (43). Cellular proliferation plays an important role in renal remodeling and is considered a compensatory mechanism in response to the loss of renal mass (43). The effect of the AT2 receptor on cell proliferation remains controversial. Increasing evidence from both in vitro and in vivo studies suggests that the conventional view that the AT2 receptor is antiproliferative (4446) may not be correct in a range of pathophysiologic contexts (12). For example, several studies that explored the AT2 receptor in vascular proliferation suggested that the AT2 receptor is proliferative (20,39,47). The present study indicates that both AT1 and AT2 receptor antagonists reduce tubular cell proliferation, a phenomenon that we observed in the kidney from angiotensin IIinfused rats (4). The additive effects of PD123319 to the AT1 receptor antagonist on PCNA staining further suggest the specific role of the AT2 receptor in preventing the proliferative response in the kidney in this context.
The findings of the present study further challenge the previous view that only the AT1 receptor is important in mediating the actions of angiotensin II. Increasing evidence is accumulating for a role of the AT2 receptor in modulating the pathogenesis of proteinuria, cellular proliferation, and matrix protein accumulation, which ultimately lead to the classical functional and structural hallmarks of progressive renal injury. Because the present study has identified potential renoprotective actions of AT2 receptor blockade, this strategy may have therapeutic benefits that need to be evaluated in the context of the currently available approaches to interrupt the RAS, such as ACE inhibitors and AT1 receptor antagonists. ACE inhibitors and AT1 receptor antagonists have disparate effects on the availability of angiotensin II to interact at the AT2 receptor. Previously, Klahr et al. (48) showed a difference between an ACE inhibitor and an AT1 receptor antagonist in reducing monocyte/macrophage infiltration in obstructive nephropathy that could partially relate to the ability of ACE inhibition to reduce availability of angiotensin II for the AT2 receptor. However, this difference between ACE inhibitors and AT1 receptor antagonists has not been a uniform finding (49) and may partly relate to differences in renal models that have been evaluated. It remains to be determined whether these disparate effects of AT1 receptor antagonists and ACE inhibitors are of clinical relevance and whether there is ultimately a role for specific AT2 receptor antagonism. The findings from the present study need to be evaluated in the setting of increasing evidence of crosstalk between AT1 and AT2 receptors in mediating the actions of angiotensin II (5052). Furthermore, whether the results of this crosstalk lead to an overall neutralization of the effects of the two receptor subtypes or these receptors may act in a more synergistic or additive manner in terms of their renal effects has not been defined.
In the present study, although AT2 receptor blockade was shown to influence a range of molecular and cellular processes implicated in progressive renal injury as well as reducing proteinuria, no clear-cut effects on GFR or glomerulosclerosis were observed. It remains to be determined whether these early changes observed with AT2 receptor blockade ultimately lead to preserved renal function and structure.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Suzuki, G. D. Han, N. Miyauchi, T. Hashimoto, T. Nakatsue, Y. Fujioka, H. Koike, F. Shimizu, and H. Kawachi Angiotensin II Type 1 and Type 2 Receptors Play Opposite Roles in Regulating the Barrier Function of Kidney Glomerular Capillary Wall Am. J. Pathol., June 1, 2007; 170(6): 1841 - 1853. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okada, T. Inoue, T. Kikuta, Y. Watanabe, Y. Kanno, S. Ban, T. Sugaya, M. Horiuchi, and H. Suzuki A Possible Anti-Inflammatory Role of Angiotensin II Type 2 Receptor in Immune-Mediated Glomerulonephritis during Type 1 Receptor Blockade Am. J. Pathol., November 1, 2006; 169(5): 1577 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. De, G. Das, K. Harley, and H. Nair Review: Dual blockade of renin-angiotensin system in diabetic nephropathy: review of literature and local experience The British Journal of Diabetes & Vascular Disease, January 1, 2006; 6(1): 23 - 28. [Abstract] [PDF] |
||||
![]() |
R. Kumar and P. H Winocour Review: Dual blockade of the renin angiotensin system in diabetes -- rationale and risks The British Journal of Diabetes & Vascular Disease, September 1, 2005; 5(5): 266 - 271. [Abstract] [PDF] |
||||
![]() |
P. K. Jacobsen Review: Preventing End-Stage Renal Disease in Diabetic Patients -- Dual Blockade of the Renin-Angiotensin System (Part II) Journal of Renin-Angiotensin-Aldosterone System, June 1, 2005; 6(2): 55 - 68. [Abstract] [PDF] |
||||
![]() |
B. J Epstein and J. G Gums Angiotensin Receptor Blockers versus ACE Inhibitors: Prevention of Death and Myocardial Infarction in High-Risk Populations Ann. Pharmacother., March 1, 2005; 39(3): 470 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Benigni, D. Corna, C. Zoja, L. Longaretti, E. Gagliardini, N. Perico, T. M. Coffman, and G. Remuzzi Targeted Deletion of Angiotensin II Type 1A Receptor Does not Protect Mice from Progressive Nephropathy of Overload Proteinuria J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2666 - 2674. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lassila, K. K. Seah, T. J. Allen, V. Thallas, M. C. Thomas, R. Candido, W. C. Burns, J. M. Forbes, A. C. Calkin, M. E. Cooper, et al. Accelerated Nephropathy in Diabetic Apolipoprotein E-Knockout Mouse: Role of Advanced Glycation End Products J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2125 - 2138. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. T.H. Lee, Z. Cao, D. M. Long, S. Panagiotopoulos, G. Jerums, M. E. Cooper, and J. M. Forbes Interactions between Angiotensin II and NF-{kappa}B-Dependent Pathways in Modulating Macrophage Infiltration in Experimental Diabetic Nephropathy J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2139 - 2151. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. R. Goncalves, C. K. Fujihara, A. L. Mattar, D. M. A. C. Malheiros, I. L. Noronha, G. de Nucci, and R. Zatz Renal expression of COX-2, ANG II, and AT1 receptor in remnant kidney: strong renoprotection by therapy with losartan and a nonsteroidal anti-inflammatory Am J Physiol Renal Physiol, May 1, 2004; 286(5): F945 - F954. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hashimoto, Y. Maeshima, M. Satoh, M. Odawara, H. Sugiyama, N. Kashihara, H. Matsubara, Y. Yamasaki, and H. Makino Overexpression of angiotensin type 2 receptor ameliorates glomerular injury in a mouse remnant kidney model Am J Physiol Renal Physiol, March 1, 2004; 286(3): F516 - F525. [Abstract] [Full Text] |
||||
![]() |
X. Zhang, M. Lassila, M. E. Cooper, and Z. Cao Retinal Expression of Vascular Endothelial Growth Factor Is Mediated by Angiotensin Type 1 and Type 2 Receptors Hypertension, February 1, 2004; 43(2): 276 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Rizkalla, J. M. Forbes, M. E. Cooper, and Z. Cao Increased Renal Vascular Endothelial Growth Factor and Angiopoietins by Angiotensin II Infusion Is Mediated by Both AT1 and AT2 Receptors J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3061 - 3071. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sarlos, B. Rizkalla, C. J. Moravski, Z. Cao, M. E. Cooper, and J. L. Wilkinson-Berka Retinal Angiogenesis Is Mediated by an Interaction between the Angiotensin Type 2 Receptor, VEGF, and Angiopoietin Am. J. Pathol., September 1, 2003; 163(3): 879 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rossing, P. Jacobsen, L. Pietraszek, and H.-H. Parving Renoprotective Effects of Adding Angiotensin II Receptor Blocker to Maximal Recommended Doses of ACE Inhibitor in Diabetic Nephropathy: A randomized double-blind crossover trial Diabetes Care, August 1, 2003; 26(8): 2268 - 2274. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jacobsen, S. Andersen, B. R. Jensen, and H.-H. Parving Additive Effect of ACE Inhibition and Angiotensin II Receptor Blockade in Type I Diabetic Patients with Diabetic Nephropathy J. Am. Soc. Nephrol., April 1, 2003; 14(4): 992 - 999. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |