Cell-Biologic and Functional Analyses of Five New Aquaporin-2 Missense Mutations that Cause Recessive Nephrogenic Diabetes Insipidus
Nannette Marr*,
Daniel G. Bichet,
Susan Hoefs*,
Paul J. M. Savelkoul*,
Irene B. M. Konings*,
Fabrizio de Mattia*,
Michael P. J. Graat*,
Marie-Françoise Arthus,
Michele Lonergan,
T. Mary Fujiwara,
Nine V. A. M. Knoers,
Daniel Landau¶,
William J. Balfe#,
Alexander Oksche||,
Walter Rosenthal||,
Dominik Müller*,
Carel H. van Os* and
Peter M. T. Deen*
Departments of *Cell Physiology and Human Genetics, UMC St. Radboud, Nijmegen, The Netherlands; Department of Medicine, University of Montreal and Centre de Recherches, Hôpital du Sacre-Coeur de Montreal, Montreal, Quebec, Canada; Departments of Human Genetics and Medicine, McGill University and Research Institute of the McGill University Health Centre, Montreal, Canada; ¶Department of Pediatrics, Soroka Medical Center, Beer Sheva, Israel; #Department of Pediatrics, The Hospital for Sick Children, University of Toronto, Toronto, Canada; and ||Forschungsinstitut für Molekulare Pharmakologie, Berlin, Germany.
Correspondence to Dr. Peter M. T. Deen, 162, Department of Cell Physiology, NCMLS, UMC St Radboud, PO Box 9101, 6500 HB Nijmegen, The Netherlands. Phone: 31-24-361-7347; Fax: 31-24-3616430; E-mail: peterd{at}sci.kun.nl
ABSTRACT. Mutations in the Aquaporin-2 gene, which encodes arenal water channel, have been shown to cause autosomal nephrogenicdiabetes insipidus (NDI), a disease in which the kidney is unableto concentrate urine in response to vasopressin. Most AQP2 missensemutants in recessive NDI are retained in the endoplasmic reticulum(ER), but AQP2-T125M and AQP2-G175R were reported to be nonfunctionalchannels unimpaired in their routing to the plasma membrane.In five families, seven novel AQP2 gene mutations were identifiedand their cell-biologic basis for causing recessive NDI wasanalyzed. The patients in four families were homozygous formutations, encoding AQP2-L28P, AQP2-A47V, AQP2-V71M, or AQP2-P185A.Expression in oocytes revealed that all these mutants, and alsoAQP2-T125M and AQP2-G175R, conferred a reduced water permeabilitycompared with wt-AQP2, which was due to ER retardation. Thepatient in the fifth family had a G>A nucleotide substitutionin the splice donor site of one allele that results in an out-of-frameprotein. The other allele has a nucleotide deletion (c652delC)and a missense mutation (V194I). The routing and function ofAQP2-V194I in oocytes was not different from wt-AQP2; it wastherefore concluded that c652delC, which leads to an out-of-frameprotein, is the NDI-causing mutation of the second allele. Thisstudy indicates that misfolding and ER retention is the main,and possibly only, cell-biologic basis for recessive NDI causedby missense AQP2 proteins. In addition, the reduced single channelwater permeability of AQP2-A47V (40%) and AQP2-T125M (25%) mightbecome of therapeutic value when chemical chaperones can befound that restore their routing to the plasma membrane.
The aquaporin-2 (AQP2) water channel plays an important rolein reabsorption of water in the kidney collecting duct and consequentlyin concentrating urine (1). Binding of arginine vasopressin(AVP) to its V2 receptor (AVPR2) at the basolateral side ofprincipal cells of collecting ducts leads to an increase ofintracellular cAMP levels, resulting in phosphorylation of AQP2and possibly other proteins, by protein kinase A and subsequentredistribution of AQP2 from subapical storage vesicles to theapical plasma membrane. Driven by the interstitial hypertonicity,water reabsorption and urine concentration is thereby initiated.This process is reversed after dissociation of AVP from itsreceptor (2,3).
Several mutations in the AVPR2 and AQP2 genes have been reportedto cause congenital nephrogenic diabetes insipidus (NDI), adisease in which the kidney is unable to concentrate urine inresponse to AVP. Mutations in the AVPR2 gene result in NDI thatis inherited as an X-linked recessive trait, whereas mutationsin the AQP2 gene cause NDI that is inherited as either an autosomalrecessive or a dominant trait (1,46,7). Expression studiesin oocytes showed that an AQP2 mutant in dominant NDI, AQP2-E258K,was a functional water channel but was retained in the regionof the Golgi complex (7). In coexpression studies with wild-type(wt) AQP2, a dominant-negative effect was observed, which wascaused by impaired routing of wt-AQP2 to the plasma membranebecause of heterotetramerization with AQP2-E258K (8). Recently,four other AQP2 mutants, all with nucleotide deletions in thecoding region of the C-terminus of AQP2, were reported to causedominant NDI (9,10). Similar to AQP2-E258K, expression of theseAQP2 mutants in oocytes revealed that they were functional waterchannels, which conferred their dominant-negative effect byheteroligomerization with wt-AQP2 and mistargeting of the wt-mutantcomplex to another subcellular organelle than the plasma membrane.
Most mutations identified in the AQP2 gene, however, cause NDIthat is inherited as an autosomal recessive trait. On the basisof the cell-biologic outcome for plasma membrane proteins, genotypeshave been assigned to five different classes (11,12). Functionalanalyses of numerous mutants revealed that more than 50% ofmutations identified in inherited diseases are class II mutations.With class II mutations, the translation of the protein is complete,but the abnormal protein fails to be exported from the endoplasmicreticulum (ER; for review see reference 13). Retention in theER is usually followed by degradation of the protein (14); consequently,little or no protein reaches its final destination. Similarly,expression in oocytes of missense AQP2 mutants in recessiveNDI revealed that most were impaired in their export from theER (1518).
In contrast to these class II AQP2 mutations, Goji et al. describedtwo mutations in recessive NDI that would fall into class IV,because the corresponding AQP2 mutants (AQP2-T125M and AQP2-G175R)were reported to be nonfunctional channels that were not impairedin their routing to the plasma membrane (19). This suggestedthat there are at least two mechanisms by which AQP2 missensemutations can cause recessive NDI.
In this article, five NDI families are described in whom sevennew AQP2 mutations were identified, of which five were missensemutations. To determine their involvement in recessive NDI andthe cell-biologic mechanism underlying NDI in these families,the encoded AQP2 mutants were tested for their routing and functionin Xenopus oocytes and, to some extent, in polarized MDCK cells.Also included in this study were the two class IV mutations(T125M and G175R) that were reported to encode nonfunctionalwater channels.
Patients
Patient characteristics are illustrated in Figure 1. The indexpatient of family 1 was administered to the hospital at theage of 1 mo because of vomiting and failure to thrive. The femalepatient was the second child of consanguineous parents and hada healthy brother. Blood and urine analyses revealed hypernatremia(160 mmol/L) and low urine osmolality (89 mosmol/kg H2O), respectively.Uosm did not increase after administration of dDAVP, indicatingthat the child suffered from NDI. At the age of 6 yr, she isstill small and has mild hydronephrosis. Both patients fromfamily 2 presented in early infancy with fever, vomiting, polyuria,polydipsia, dehydration, and failure to thrive. On biochemicalanalysis, both showed hypernatremia (152 and 153 mmol/L) andlow urinary osmolality (230 and 224 mosm/kg H2O). During anoral fluid deprivation trial with consecutive dDAVP administration(40 µg intranasally), urinary osmolality did not increase(189 and 185 mosmol/kg H2O). Family 3 is a consanguineous familyof Pakistani origin with two affected girls. The parents aremost closely related as first cousins. Both patients presentedwith polydipsia, severe polyuria and low urinary osmolality(96 and 112 mosmol/kg H2O), which did not increase after dDAVPadministration (91 and 123 mosmol/kg H2O). The patient fromfamily 4 presented 5 d after birth with fever and bloody feces.She is the first child of parents of German origin who are relatedas first cousins, once removed. Clinical testing revealed hypernatremia(150 mmol/L) and a urinary osmolality of 84 to 150 mosm/kg H2O,which did not increase with dDAVP administration (150 mosm/kgH2O). The patient from family 5 presented with vomiting withinthe first week of life, which became severe in the following2 wk. Biochemical analysis at the age of 6 wk revealed hypernatremia(155 to 160 mmol/L) and an elevated plasma osmolality (324 mosmol/kg).The urinary osmolality of 80 mosmol/kg H2O did not increaseafter intramuscular or subcutaneous administration of dDAVP.Isolation of genomic DNAs, amplification of the AVPR2 and AQP2coding regions, and sequence analyses were done as described(1,20,21).
Figure 1. Segregation of nephrogenic diabetes insipidus (NDI) and Aquaporin-2 (AQP2) mutations in the studied families. For the five families studied (numbered 1 through 5), carriers (half-filled symbols), unaffected (open symbols) and affected individuals (filled symbols), and males (squares) and females (circles) are indicated. For families 3 and 4, the haplotype in chromosome region 12q13 is shown; the marker order is centromere-AFM259vf9-AQP2-D12S131-AFMb007yg5-telomere (52) (alleles of the dinucleotide markers are indicated by numbers or letters; for AQP2, the mutations or normal allele (n) are shown). For family 5, the intron 3 splice donor site mutation (G>A), V194I mutation, and exon 4 nucleotide deletion (c652delC) are indicated.
Generation of AQP2 Mutant Expression Constructs
With a three-steps PCR reaction or quick-change site-directedmutagenesis kit (T125M; Stratagene, Heidelberg, Germany), eachmutation carried by NDI patients was introduced into the humanAQP2 cDNA sequence. Primers used were CGTCTTC-TTTGGCCCCGGGTCTGCCCTCAACTGGfor L28P, CCCT-CTGTGCTGCAGATTGCCATGGTGTTTGGCTTGG for A47V, AGCGGGGCCCACATCAACCCGGCCATGACTGTGGCCTGCfor V71M, GCTCTGAGCAACAGCATGACGGCCGGCCAGGCGG for T125M, GGTGTAATGGATCCGAAGGAGGTGGCCfor G175R, GCTCTATGAATGCTGCCCGGTCCCTGGCTCCAGC for P185A, andGCTCCCTGGCTCCGGCTGTCATCACTGGCAAATTTG for V194I, with which restrictionsites were introduced for SmaI (L28P), PstI (A47V), or NciI(V71M, P185A) or were deleted for StyI (G175R) or PvuII (V194I).After cutting these fragments with BglII/ApaI (L28P), NcoI/SmaI(A47V), ApaI/BamHI (V71M, G175R), ApaI/SmaI (T125M), or BamHI/KpnI(P185A, V194I), the mutation-containing fragments were isolatedand cloned into the corresponding sites of the oocytes expressionconstruct pT7Ts-AQP2 (1).
For expression in MDCK cells, wt-AQP2, AQP2-R187C, and AQP2-T125Mwere N-terminally tagged with the green fluorescent protein(GFP). For the generation of GFP-tagged wt-AQP2 (G-AQP2), a900-bp NspI-blunted/SalI fragment of pBS-AQP2 (1), which containedthe complete wt-AQP2 coding sequence, was cloned into the HindIII-blunted/SalIsites of pEGFP-C1 (Clontech, Palo Alto, CA), resulting in pEGFP-AQP2.To facilitate cloning of AQP2 mutants in pEGFP-C1, the ApaIand KpnI sites were removed by digestion with SmaI and KpnI,after which the vector was blunted with T4 DNA polymerase andre-ligated. An 865-bp BglII/SalI fragment of pEGFP-AQP2 wassubsequently cloned into the corresponding sites of this pEGFP-AKvector to generate pEGFP-AK-AQP2. To generate the fusion constructsencoding GFP-AQP2-R187C (G-AQP2-R187C) and GFP-AQP2-T125M (G-AQP2-T125M),611-bp ApaI/KpnI fragments, encoding AQP2 segments containingthe mutations, were isolated from pTsT7-AQP2-R187C and pTsT7-AQP2-T125M,respectively, and cloned into the corresponding sites of pEGFP-AK-AQP2.Sequence analysis of selected clones confirmed that only thedesired mutations were introduced.
Generation of cRNAs
Expression constructs pT7Ts-AQP2, pT7Ts-AQP2-L28P, pT7Ts-AQP2-A47V,pT7Ts-AQP2-V71M, pT7Ts-AQP2-T125M, pT7Ts-AQP2-G175R, pT7Ts-AQP2-P185A,and pT7Ts-AQP2-V194I were linearized with SalI, after whichg-capped cRNA transcripts were synthesized in vitro using T7RNA polymerase according to Promegas Protocols and Principleguide (1991), except that 1 mM final concentration of nucleotidetriphosphates and m7G(5')ppp(5')G were used. The cRNAs werephenol extracted, precipitated and dissolved in di-ethylpyrocarbonatetreatedwater. The integrity was checked by agarose gel electrophoresis,and the concentrations were determined with a spectrophotometer.
Water Permeability Measurements
Stage V and VI oocytes were isolated from Xenopus laevis afterdefolliculation with 2 mg/ml collagenase A (Boehringer Mannheim,Mannheim, Germany) and stored at 18°C in modified Barthsolution (MBS: 88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 10 mM HEPES[pH 7.5], 0.82 mM MgSO4, 0.33 mM Ca(NO3)2, 0.41 mM CaCl2) supplementedwith 25 µg/ml gentamicin. The oocytes were injected withthe indicated amounts of cRNAs coding for wt or mutant AQP2proteins. Three days after injection, the vitelline membraneswere removed and the water permeability (Pf in µm/s) wasmeasured using a standard swelling assay (1). Oocyte swellingwas performed at 22°C after the transfer from 200 mosM to20 mosM.
Isolation of Total Membranes and Plasma Membranes
To isolate total membranes, 12 oocytes were homogenized in 250µl of homogenization buffer A (HbA: 20 mM Tris [pH 7.4],5 mM MgCl2, 5 mM NaH2PO4, 1 mM EDTA, 80 mM sucrose, 1 mM phenylmethylsulfonylfluoride, 5 µg/ml leupeptin and pepstatin) and centrifugedat 200 g at 4°C for 10 min to remove the yolk proteins.The membranes were isolated by centrifugation at 4°C at14,000 g for 20 min.
Plasma membranes were isolated as described (22). Briefly, 12oocytes were coated with 1% silica in modified MES-bufferedsaline for silica (MBSS: 20 mM MES, 80 mM NaCl, pH 6.0), washedtwice with MBSS buffer, and incubated in 0.1% polyacrylic acidin MBSS. In both incubations, oocytes were rotated slowly for30 min at 4°C. After two times washing with MBS, the oocyteswere homogenized in HbA. After five washing steps with slowcentrifugation (3 x 14 g; 1 x 24 g; 1 x 390 g) at 4°C for30 s, plasma membranes were pelleted by centrifugation at 14,000g for 20 min.
Immunoblotting
Protein samples were denatured by incubation for 30 min at 37°Cin Laemmli buffer, subjected to electrophoresis on a 12% SDS-polyacrylamidegel and transferred onto PVDF membranes (Millipore Corporation,Bradford, MA) by standard procedures. Next, the blots were incubatedwith 1:3000 diluted affinity-purified AQP2: 257 to 271 rabbitantibodies, raised against the 15 C-terminal amino acids ofrat AQP2 (15) in TBST-buffer (20 mM Tris, 140 mM NaCl, 0.1%Tween,pH 7.6) supplemented with 1% nonfat dried milk. As a secondaryantibody, a 1:5000 dilution of goat -rabbit IgG (Sigma, St Louis,MO) coupled to horseradish peroxidase was used. Finally, AQP2proteins were visualized using enhanced chemiluminescence (Pierce,Rockford, IL). Digestion of proteins with N-glycosidase F (BoehringerMannheim, Mannheim, Germany) was done according to the manufacturersprotocol.
Determination of the Relative Single Channel Water Permeabilities of AQP2 Mutants
To determine the functionality of AQP2 mutants in relation towt-AQP2, all immunoblot signals of AQP2 proteins in the plasmamembrane of oocytes were semi-quantified by densitometric scanningand comparison with the signals of a twofold dilution seriesof wt-AQP2, which was blotted in parallel. In each experiment,the different amounts of wt-AQP2 expressed in the plasma membranefraction of oocytes and the corresponding Pf values were fittedto the exponential function y = a(1-exp(-bx)) + c, where y isPf and x is the amount of protein in arbitrary units. The amountof wt-AQP2 that would be necessary to obtain the Pf value observedfor the mutants was calculated from the equation. The ratioof the amount of wt-AQP2 and mutant AQP2 for the Pf that hadbeen obtained for the mutant indicates the single channel waterpermeability of the mutant relative to wt-AQP2 in percentage.Statistical significance was determined using the t test.
Immunocytochemistry on Oocytes
Two days after injection of oocytes with 10 ng of mutant AQP2cRNAs or 1 ng of wt-AQP2 cRNA, vitelline membranes were removedand oocytes were incubated for 1 h in 1% wt/vol paraformaldehyde-lysineperiodate fixative (23), dehydrated, embedded in paraffin, andsectioned. Potential sites for nonspecific antibody bindingwere blocked with 10% goat serum in PBS. Sections were incubatedO/N with a 1:100 dilution of rabbit 5 -AQP2 antibodies. Afterwashing three times for 10 min in TBS, sections were incubatedfor 1 h with a 1:100 dilution of Alexa594-conjugated -rabbitantibodies (Molecular Probes, Pitchford, Eugene). The sectionswere again washed three times for 10 min in TBS, dehydratedin methanol, and mounted in vectashield (Vector Laboratories,Berlingame, CA). AQP2 proteins were visualized using confocallaser scanning microscopy (CLSM; Bio-Rad MRC-1000).
MDCK Cells
Polarized Madin-Darby Canine Kidney (MDCK) type I cells (24)were cultured as described (25). To obtain expression in MDCKcells, cell clones stably expressing G-AQP2 and G-AQP2-R187Cwere generated and selected as described (25). For expressionof G-AQP2-T125M, cells were transiently transfected with LipofectAmineaccording to the manufacturers protocol (Invitrogen,Breda, The Netherlands). After growth to confluence, the cellswere fixed and the AQP2 proteins were visualized by CLSM analysisas described (26).
Analysis of the Patients
In families 1 to 4, affected female individuals from consanguineousparents suggested that NDI was most likely inherited as an autosomalrecessive trait (Figure 1). In families 3 and 4, the NDI patientsinherited identical AQP2 gene alleles, which supported thisassumption. Family 5 presented with one affected boy; therefore,a mutation in the AVPR2 gene could not be excluded. However,sequence analysis of genomic DNA of the patient revealed nomutation in the coding or exon-flanking sequences of the AVPR2gene. Therefore, the AQP2 gene of patients in these five familieswas analyzed. As anticipated, patients from family 1 to 4 werehomozygous for an AQP2 mutation, namely c83T>C, c140C>T,c211G>A, or c553C>G, which encoded L28P, A47V, V71M, orP185A AQP2 missense proteins, respectively (Figure 2). In family5, the patient was a compound heterozygote for a mutation inthe splice donor site of exon3/intron3 (c606+1G>A) in oneallele, and a nucleotide substitution (c580G>A) combinedwith a nucleotide deletion (c652delC) in the other allele, whichwere inherited from the father and mother, respectively. Thec580G>A mutation codes for a V194I mutation in AQP2.
Figure 2. The localization of the mutations in AQP2. The AQP2 protein is predicted to consist of six transmembrane domains connected by loops A through E with the N and C-termini located intracellularly. In the proposed AQP2 topology, the amino acids are represented as circles and labeled with the standard single-letter designations. The missense mutations (encircled letters), splice site mutation (splice G>A), and nucleotide deletion (c652delC) as identified in the NDI patients are indicated.
Functional Analysis of Encoded AQP2 Missense Mutants in NDI
To determine whether the identified missense mutations couldbe causal for NDI, each mutation was introduced into the AQP2cDNA sequence, cloned into an oocyte expression vector and transcribed.In addition, two other mutants (AQP2-T125M and AQP2-G175R [Figure 2])were included, because these mutants were suggested to benonfunctional channels unimpaired in their routing to the plasmamembrane (19). Although low expression levels already revealwhether AQP2 mutants are misfolded, high expression levels alsoenable us to determine whether such mutants are functional waterchannels, because at these levels a considerable amount of themutants is often expressed in the plasma membrane (27,28). Therefore,oocytes were injected with 10 ng of cRNAs coding for AQP2 mutants,along with a concentration series of wt-AQP2 cRNA (0.3, 0.6,1.2, and 2.4 ng). An exception was AQP2-V194I, of which 0.5ng of cRNA was injected, because preliminary experiments indicatedthat this mutant conferred high water permeability (not shown).Three days later, water transport analysis revealed that thePfs of oocytes expressing wt-AQP2 or the mutants AQP2-A47V,AQP2-T125M, or AQP2-V194I were significantly higher than thatof control oocytes, whereas the Pfs of oocytes expressing AQP2-L28P,AQP2-V71M, AQP2-G175R, or AQP2-P185A were not different fromcontrols (Figure 3).
Figure 3. Osmotic water permeabilities of oocytes expressing AQP2 proteins. Three days after injection of the indicated amounts of wt-AQP2 cRNA, 0.5 ng of AQP2-V194I cRNA, or 10 ng cRNA encoding the other AQP2 mutants in recessive NDI, oocytes were subjected to a standard swelling assay. Non-injected oocytes were used as a control. Mean water permeabilities (Pf) and SEM of 12 oocytes are shown. An asterisk indicates a significant (P < 0.01) increase in Pf above that of control oocytes.
To check for expression levels, total membranes and plasma membraneswere isolated from these oocytes and subjected to immunoblottingfor AQP2. Wt-AQP2 and all AQP2 mutants were expressed in thetotal membrane and plasma membrane fractions (Figure 4, panelsA and B, respectively). For the AQP2 mutants AQP2-L28P, AQP2-A47V,AQP2-V71M, AQP2-G175R, and AQP2-P185A, the characteristic unglycosylated29-kD and high-mannose glycosylated 32-kD AQP2 forms were present,whereas only a 29-kD band was detected for wt-AQP2, AQP2-T125M,and AQP2-V194I. As reported in reference 28, a decreased ratioof plasma membrane versus total membrane expression for an AQP2mutant compared with that of wt-AQP2 indicates that the mutantprotein is retained within the cell. As can be seen in Figure 4,each AQP2 mutant showed a stronger total membrane than plasmamembrane signal when compared with those signals for wt-AQP2,except for AQP2-V194I (compare lanes A and B for wt and mutantAQP2 proteins). These data indicated that all AQP2 mutants,except AQP2-V194I, were retarded in their routing to the plasmamembrane. Other immunoblots and Pf measurements of oocytes injectedwith a concentration series of wt-AQP2 and AQP2-V194I cRNAsrevealed that the routing and function of AQP2-V194I were notdifferent from those of wt-AQP2 (not shown).
Figure 4. Immunoblot analysis of AQP2 proteins expressed in oocytes. From 12 oocytes injected as described in the legend of Figure 3, total membranes (A) or plasma membranes (B and C) were isolated. To semi-quantify the amount of AQP2 in the plasma membranes, oocyte equivalents of plasma membrane fractions were treated with N-glycosidase F before immunoblot analysis (C). Oocyte equivalents of 0.5 (A), 2 (B), or 1 (C) were immunoblotted for AQP2. The masses of unglycosylated AQP2 (29 kD), high-mannose glycosylated AQP2 (32 kD), and the degradation product of AQP2 (27 kDa) are indicated.
Interestingly, an AQP2 degradation product of about 27 kD wasobserved in the TM lanes of most AQP2 mutants, which was mostprominent for AQP2-T125M (Figure 4A). Because different levelsof cRNA of wt-AQP2 and AQP2 mutants were injected in these experiments,it was not clear whether this degradation product would alsobe found for wt-AQP2. Oocytes were therefore injected with 1-,3-, and 10-ng cRNA amounts encoding wt-AQP2 or AQP2-T125M. Immunoblotanalysis of total membranes of these oocytes revealed that this27-kD band is indeed also found for wt-AQP2, but only at highexpression levels (Figure 5). At these levels (Figure 5) butnot at low expression levels (Figure 4), also some complex-glycosylatedAQP2 (40 to 45 kD) is detected for wt-AQP2expressingoocytes. As noted before (15), this might be due to a differentrepertoire of proteins involved in glycosylation in oocytes,because our antibodies easily detect complex-glycosylated AQP2in renal samples (29).
Figure 5. Forms of wt-AQP2 and AQP2-T125M at different expression levels. From 12 oocytes injected with 1, 3, or 10 ng of cRNA coding for wt-AQP2 or AQP2-T125M, total membranes were isolated. Of each injection, a one oocyte equivalent was immunoblotted for AQP2. Unglycosylated AQP2 (29 kD), high-mannose glycosylated AQP2 (32 kD), and the degradation product of AQP2 (27 kD) are indicated.
Relative Water Permeabilities of Wild-Type and Mutant AQP2 Proteins
To determine the relative amounts of AQP2 in the plasma membrane,oocyte equivalents of plasma membranes were digested with N-glycosidaseF to remove the sugar moieties and immunoblotted for AQP2 (Figure 4C).The amount of all mutants present in the plasma membranefractions was consistently between the lowest and highest amountsof wt-AQP2 expressed in the plasma membranes. Comparison ofthe measured Pf values with the plasma membrane expression levelsallowed the determination of the channel permeabilities of AQP2mutants relative to that of wt-AQP2 (Figure 6). Previous experimentshave shown that the amounts injected of wt-AQP2 are within alogarithmic phase (28); a single exponential function was thereforefitted to the Pf values and amounts of the wt-AQP2 concentrationseries. Subsequently, the ratio of the amounts of wt-AQP2 andAQP2 mutant conferring the particular Pf of the mutant AQP2was calculated. From four such independent experiments, it wasconcluded that AQP2-L28P, AQP2-V71M, AQP2-G175R, and AQP2-P185Awere nonfunctional water channels. In contrast, AQP2-T125M andAQP2-A47V retained about 25% and 40% of the single channel waterpermeability of wt-AQP2, respectively, whereas the water permeabilityconferred by AQP2-V194I was similar to that of wt-AQP2.
Figure 6. Functionality of AQP2 mutants. To determine the relative single channel permeability of AQP2 mutants in recessive NDI, the water permeabilities (Pf ± SEM in µm/sec) obtained for oocytes expressing wt or mutant AQP2 proteins were related to their amounts detected in the plasma membrane. The wt-AQP2 data were fitted to an exponential function (see Materials and Methods). One representative experiment is shown (n = 12 oocytes).
Subcellular Localization in Oocytes and MDCK Cells
To determine the subcellular expression pattern, oocytes expressingwt-AQP2 or AQP2 mutants were subjected to immunocytochemistry(Figure 7). Confocal laser scanning analysis of stained sectionsof these oocytes revealed a dispersed staining for AQP2-L28P,AQP2-A47V, AQP2-V71M, AQP2-T125M, AQP2-G175R, and AQP2-P185A.In addition, some plasma membrane staining was observed foroocytes expressing AQP2-A47V, AQP2-V71M, AQP2-T125M, and AQP2-G175R.In contrast, wt-AQP2 and AQP2-V194I only showed strong plasmamembrane expression, while non-injected oocytes essentiallyrevealed no labeling.
Figure 7. Localization of the AQP2 mutants in oocytes. Non-injected oocytes (C), oocytes injected with 1 ng of cRNA coding for wt-AQP2 or 10 ng of AQP2-L28P, -A47V, -V71M, -T125M, -G175R, -P185A, or -V194I were fixed in paraformaldehyde and embedded in paraffin. Sections were incubated with rabbit -AQP2 antibodies followed by Alexa594-conjugated -rabbit antibodies. AQP2 proteins were visualized using confocal laser scanning microscopy. The plasma membrane is indicated by an arrow.
Although AQP2-T125M expression in oocytes revealed a similardistribution as the other AQP2 mutants in recessive NDI, theinability to determine whether AQP2-T125M is retained in theER by the appearance of a 32-kD high-mannose glycosylated bandin immunoblotting (Figure 4) urged us to investigate the expressionof this mutant in polarized MDCK cells. Therefore, MDCK cellswere transfected with constructs coding for wt-AQP2, AQP2-R187C,and AQP2-T125M coupled to GFP to facilitate detection. Immunocytochemistryand subsequent confocal laser scanning microscopy of cells transfectedwith these constructs revealed that GFP-AQP2 was predominantlyexpressed in the apical plasma membrane (Figure 8). In contrast,AQP2-R187C and AQP2-T125M showed a similar dispersed stainingthroughout the cell.
Figure 8. Localization of the AQP2-T125M in MDCK cells. MDCK cells were transfected with expression constructs encoding GFP-tagged wt-AQP2 (G-AQP2), AQP2-T125M (G-AQP2-T125M), or AQP2-R187C (G-AQP2-R187C) and grown to confluence on semipermeable filters. Following fixation and embedding in VectaShield, XY and XZ images of the localization of the AQP2 proteins were made using confocal laser scanning microscopy.
Trafficking and Glycosylation Forms of AQP2
AQP2, like other glycosylated membrane proteins, is synthesizedin the ER, where it is folded and assembled into a homotetramer.In addition, in this organelle, high-mannose sugar moietiesare attached to Asn123 of AQP2, which is part of a canonicalN-glycosylation consensus site (N123-X-T125; Figure 2). En routeto the plasma membrane, the high-mannose sugar groups are removedin the Golgi complex, after which these AQP2 molecules are complexglycosylated. In line with other AQPs (30,31) but in contrastto most glycosylated proteins, only one or two monomers withinan AQP2 tetramer are glycosylated (32). The mass of complexglycosylated AQP2 ranges from 40 to 45 kD; these AQP2 formsare therefore only detected on immunoblots when high amountsare loaded.
Proteins that are not properly folded in the ER are thoughtto have extended interaction times with the ER folding proteins,named molecular chaperones (33). As such, misfolded AQP2 mutantsare usually detected as high-mannose glycosylated proteins of32 kD on immunoblots, in addition to the unglycosylated 29-kDform (6,1518). The sensitivity of the 32-kD bands forcleavage by endoglycosidase H, which specifically removes high-mannosesugar moieties, strongly indicate that these AQP2 forms areER-retained proteins (15). In contrast, proteins that are properlyprocessed, as is the case for wt-AQP2 in oocytes, the ER retentiontime is very short and, therefore, only the 29-kD band is detected(Figure 4). The high-mannose glycosylated form of wt-AQP2 (32kD) is usually only observed when wt-AQP2 is expressed at highlevels and with a long exposure time of the film to the blot(e.g., Figure 5).
Cell Biologic Phenotype of Missense AQP2 Mutants Underlying NDI in Families 1 to 4
Except for AQP2-V194I, the AQP2 missense mutants studied hereare no exception to the general defect described above. Whenexpressed at a higher level than wt-AQP2 (Figure 4A), whichis the result of the injection of higher amounts of mutant AQP2cRNAs, all mutants conferred reduced water permeability to oocytes(Figure 3) and were partly expressed as high-mannose glycosylated32-kD proteins (Figure 4, A and B), which is indicative of retentionin the ER. As reported before by Goji et al. (19), the absenceof a 32-kD band in the lane of AQP2-T125M is caused by the lossof the AQP2 N-glycosylation consensus sequence due to the introducedmutation. Additional evidence that all these mutants are retainedin the cell is provided by the fact that, compared with wt-AQP2,much less of the AQP2 mutants is expressed in the plasma membranes(Figure 4) and that all these mutants show a dispersed immunocytochemicalstaining in oocytes (Figure 7).
Besides the 29- and 32-kD bands, a 27-kD AQP2 band was observed,which must be an AQP2 degradation product that misses about20 amino acids from the N-terminus, because the used antibodiesare directed against the AQP2 C-terminus. Although it was seenfor all AQP2 mutant proteins and wt-AQP2 (Figures 4A and 5),it was most prominent for AQP2-T125M. This mutant lacks N-linkedglycosylation, and the interaction of the sugar moieties ofseveral proteins with the ER molecular chaperones calnexin,calreticulin, and glucosidases I and II has been shown to providestability (34,35); the presence of relatively high amounts of27-kD AQP2 in oocytes expressing AQP2-T125M might thereforeindicate that N123 glycosylation of AQP2 is needed for its stabilityand further cellular processing. Immunoblots of renal AQP2,however, did not reveal a 27-kD AQP2 band (not shown); it istherefore unclear whether such a product exists and has a functionin vivo.
In unstimulated polarized MDCK cells, G-AQP2 was mainly expressedin the apical plasma membrane (Figure 8), which is differentfrom the vesicular localization of untagged AQP2 in MDCK cells(29). Although this indicated that the N-terminal GFP interferedwith a proper shuttling of AQP2 between vesicles and the apicalplasma membrane, the plasma membrane localization also revealedthat G-AQP2 was properly folded at the ER and therefore couldbe used as a control to analyze the distribution pattern ofAQP2-T125M in more detail. In contrast to G-AQP2, G-AQP2-T125Mshowed a dispersed staining pattern in MDCK cells, which wassimilar to that of G-AQP2R187C, of which the untaggedform is a classical AQP2 mutant in recessive NDI (Figure 8).Such a dispersed expression pattern has also been observed formisfolded and ER-retained mutants of AQP2 and other proteinsin different cell types (17,36). Therefore, these results supportour data in oocytes that AQP2-T125M is also retained in theER.
Our data for AQP2-T125M and AQP2-G175R are in contrast to thoseof Goji et al. (19), who used similar techniques but reportedthat these mutants were only expressed in the plasma membraneand were nonfunctional water channels. According to our resultsAQP2-T125M is partially functional (Figure 6). The absence ofan increased Pf for AQP2-T125M observed by Goji et al. mightbe due to the lower amount of injected cRNAs (3 ng comparedwith 10 ng in this study). Their immunoblots appear to showa reduced level of expression in plasma membrane compared withtotal membrane expression for both mutants compared with wt-AQP2,which indicates that both mutants were retained in the cell.In addition, a 32-kD band was visible for AQP2-G175R in totaland plasma membranes, but not for wt-AQP2, which also indicatesthat AQP2-G175R is ER retained in their oocytes. The relativelystrong immunocytochemical staining in the plasma membranes ofAQP2-T125M and AQP2-G175R reported by Goji et al. seems to contradictretention of these mutants in the ER. An explanation for thismight be that their AQP2 antibodies are less sensitive for high-mannoseglycosylated AQP2 than the antibodies used in our experiments,because (1) with ER-retained mutants the plasma membrane containsrelatively more 29-kD AQP2 than 32-kD AQP2 compared with theproportions found in intracellular organelles (Figure 4: comparelanes A and B [27]) and (2) the AQP2 antibodies used by Gojiet al. did not detect a 32-kD band or show dispersed immunocytochemicalstaining for AQP2-T126M, in contrast to what we previously reported(16).
Cell Biologic Basis for NDI in Family 5
Our expression studies in oocytes revealed that the functionand routing of AQP2-V194I were similar to those obtained forwt-AQP2, which suggests that the V194I mutation does not resultin an AQP2 protein that is involved in NDI. Instead, NDI infamily 5 is most likely caused by the splice site mutation (c606+1G>A),which involves a highly conserved nucleotide (37) inheritedfrom the father and the single nucleotide deletion (c652delC)inherited from the mother, because the mutations are predictedto result in two different truncated proteins that are misfoldedand retained in the ER.
Functionality of AQP2 Missense Mutants
High expression levels in oocytes and in CHO cells of threeAQP2 mutants (AQP2-T126M, AQP2-A147T, and AQP2-L22V) indicatedthat they are functional water channels (16,17). The extentof functionality, however, differs between mutants, becauseat high expression levels, AQP2-A147T was as functional as wt-AQP2while AQP2-T126M and AQP2-G64R retained 20% of the permeabilityof wt-AQP2 (27). Similarly it was found in this study that AQP2-L28P,AQP2-V71M, AQP2-G175R, and AQP2-P185A are nonfunctional, whereasAQP2-A47V and AQP2-T125M retained 40 and 25% of the single channelpermeability of wt-AQP2, respectively. As has been shown invitro, treatment of cells expressing AQP2-T126M or AQP2-A147Twith chemical chaperones facilitated the translocation of thesemutants to the plasma membrane (17). Chemical chaperones mightbe of therapeutic value for the subset of NDI patients withmutant AQP2 proteins that retain a sufficient level of functionalityand are retained in the ER.
AQP2 Mutants in Recessive NDI: Reduced Functionality or Just ER Retention?
The Xenopus oocyte has a large translational capacity (similarto that of 5 x 104 somatic cells [38]); therefore, high expressionlevels can be obtained. As is also well known for proteins transientlyexpressed in mammalian cells, high expression levels lead toa "storage saturation" in the organelle where the protein wouldonly be localized when expressed at low levels, resulting inthe appearance of the protein in other organelles. In this study,this feature of organelle overloading was used to determinethe water permeability of mutants AQP2 proteins relative tothat of wt-AQP2. Thus, we were able to show the presence ofhigh-mannose glycosylated AQP2 in the plasma membrane fraction(Figure 4B). In contrast, endogenously expressed proteins, whichare expressed at a level that is manageable for the cell, havenever been detected in plasma membranes of cells. Similarly,at moderate expression levels, ER-retained AQP2 mutants do notappear in the plasma membrane of oocytes (28). Furthermore,whereas other ER-retained proteins expressed in mammalian cellsin vitro or in vivo were completely retained in the ER (36,3943),it has been shown that such ER-retained proteins are often transportedto and function in the plasma membrane of oocytes to some extent.For example, the ER-retained but functional cystic fibrosistransmembrane conductance regulator lacking Phe508 (CFTR-F508)confers chloride conductance in oocytes, but it does not exitthe ER in mammalian cells (4447). Similar observationshave been made for mutants of the HERG voltage-gated potassiumchannel that cause hereditary long QT syndrome (43) and mutantsof tyrosinase in albinism (36). The high levels of expressionof mutant proteins in oocyte plasma membranes has been attributedto a reduced level of degradation, because they appear to betemperature-sensitive and oocytes are cultured at 18°C,whereas mammalian cells are cultured at 37°C (36,43,46).Although it cannot be excluded that reduced water channel functionmay contribute to NDI, these studies strongly indicate thatER retention and subsequent degradation are the major, and presumablyonly, reason why missense AQP2 mutations cause autosomal recessiveNDI. This hypothesis is corroborated by the absence of mutantAQP2 proteins in urine of patients with autosomal recessiveNDI, whereas AQP2 is easily detected in urine of healthy individuals(48,49). However, only analysis of the expression of such AQP2mutants in renal principal cells would definitively establishtheir cellular fate.
In conclusion, we identified seven new AQP2 mutations and determinedthe cell-biologic cause of five AQP2 missense mutations identifiedin patients with autosomal recessive NDI. Our experiments showthat the cell-biologic phenotype in oocytes of AQP2 missensemutations in autosomal recessive and dominant NDI is now consistentlydifferent, because all 20 AQP2 missense mutations that causeautosomal recessive NDI (6,15,16,50,51) are class II mutations(i.e., leading to misfolding and ER retention). Some of thesemutants appear to be able to function as water channels; therefore,the challenge of the future is to find chemical chaperones totreat NDI patients by restoring the routing of partially functionalwater channels to the plasma membrane.
Acknowledgments
We are indebted to Drs. Heye Arends (Deggendorf, Germany), UlrikeMau, and Peter Kaiser (Tübingen, Germany) for providingblood samples and to Erhard Klauschenz and John Dickson forsequence analysis of the AQP2 gene in family five. This studywas supported by grants from the Dutch Kidney Foundation (C95.5001)and European Community (FMRX-CT970128) to PMTD and CHvO,the Dutch Organization for Scientific Research (902-18292P), University Medical Center, Nijmegen and European Community(QLK3-CT-200100987) to PMTD, the Canadian Institutesof Health Research (MOP-8126) and the Canadian Kidney Foundationto DGB, the Chemischen Industrie and Verbund Klinische PharmacologieBerlin-Brandenburg to AO and WR, and the Deutsche Forschungsgemeinschaft(MU 1497 21) to DM. PMTD is an investigator of the RoyalNetherlands Academy of Arts and Sciences, and DGB is a Chercheurde Carrière of Le Fonds de la Recherche en Santédu Québec.
Deen PMT, Verdijk MAJ, Knoers NVAM, Wieringa B, Monnens LAH, van Os CH, van Oost BA: Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science 264: 9295, 1994[Abstract/Free Full Text]
van Os CH, Deen PMT: Aquaporin-2 water channel mutations causing nephrogenic diabetes insipidus. Proc Assoc Am Physicians 110: 395400, 1998[Medline]
Nielsen S, Chou CL, Marples D, Christensen EI, Kishore BK, Knepper MA: Vasopressin increases water permeability of kidney collecting duct by inducing translocation of aquaporin-CD water channels to plasma membrane. Proc Natl Acad Sci USA 92: 10131017, 1995[Abstract/Free Full Text]
Rosenthal W, Seibold A, Antaramian A, Lonergan M, Arthus M-F, Hendy GN, Birnbaumer M, Bichet DG: Molecular identification of the gene responsible for congenital nephrogenic diabetes insipidus. Nature 359: 233235, 1992[CrossRef][Medline]
Van den Ouweland AM, Dreesen JC, Verdijk MAJ, Knoers NVAM: Mutations in the vasopressin type 2 receptor gene (AVPR2) associated with Nephrogenic Diabetes Insipidus. Nat Genet 2: 99102, 1992[CrossRef][Medline]
van Lieburg AF, Verdijk MAJ, Knoers NVAM, van Essen AJ, Proesmans W, Mallmann R, Monnens LAH, van Oost BA, van Os CH, Deen PMT: Patients with autosomal nephrogenic diabetes insipidus homozygous for mutations in the aquaporin 2 water-channel gene. Am J Hum Genet 55: 648652, 1994[Medline]
Mulders SM, Bichet DG, Rijss JPL, Kamsteeg EJ, Arthus MF, Lonergan M, Fujiwara M, Morgan K, Leijendekker R, van der Sluijs P, van Os CH, Deen PMT: An aquaporin-2 water channel mutant which causes autosomal dominant nephrogenic diabetes insipidus is retained in the Golgi complex. J Clin Invest 102: 5766, 1998[Medline]
Kamsteeg EJ, Wormhoudt TA, Rijss JPL, van Os CH, Deen PMT: An impaired routing of wild-type aquaporin-2 after tetramerization with an aquaporin-2 mutant explains dominant nephrogenic diabetes insipidus. EMBO J 18: 23942400, 1999[CrossRef][Medline]
Kuwahara M, Iwai K, Ooeda T, Igarashi T, Ogawa E, Katsushima Y, Shinbo I, Uchida S, Terada Y, Arthus MF, Lonergan M, Fujiwara TM, Bichet DG, Marumo F, Sasaki S: Three families with autosomal dominant nephrogenic diabetes insipidus caused by aquaporin-2 mutations in the C-terminus. Am J Hum Genet 69: 738748, 2001[CrossRef][Medline]
Marr N, Bichet DG, Lonergan M, Arthus MF, Jeck N, Seyberth HW, Rosenthal W, van Os CH, Oksche A, Deen PM: Heteroligomerization of an Aquaporin-2 mutant with wild-type Aquaporin- 2 and their misrouting to late endosomes/lysosomes explains dominant nephrogenic diabetes insipidus. Hum Mol Genet 11: 779789, 2002[Abstract/Free Full Text]
Deen PMT, Brown D: Trafficking of native and mutant mammalian MIP proteins. In: Aquaporins, edited by Hohmann S, Agre P, Nielsen S, San Diego, CA, Academic Press, 2001, pp 235276
Kuznetsov G, Nigam SK: Folding of secretory and membrane proteins. N Engl J Med 339: 16881695, 1998[Free Full Text]
Pind S, Riordan JR, Williams DB: Participation of the endoplasmic reticulum chaperone calnexin (p88, IP90) in the biogenesis of the cystic fibrosis transmembrane conductance regulator. J Biol Chem 269: 1278412788, 1994[Abstract/Free Full Text]
Deen PMT, Croes H, van Aubel RA, Ginsel LA, van Os CH: Water channels encoded by mutant aquaporin-2 genes in nephrogenic diabetes insipidus are impaired in their cellular routing. J Clin Invest 95: 22912296, 1995
Mulders SM, Knoers NVAM, van Lieburg AF, Monnens LAH, Leumann E, Wuhl E, Schober E, Rijss JPL, van Os CH, Deen PMT: New mutations in the AQP2 gene in nephrogenic diabetes insipidus resulting in functional but misrouted water channels. J Am Soc Nephrol 8: 242248, 1997[Abstract]
Tamarappoo BK, Verkman AS: Defective aquaporin-2 trafficking in nephrogenic diabetes insipidus and correction by chemical chaperones. J Clin Invest 101: 22572267, 1998[Medline]
Canfield MC, Tamarappoo BK, Moses AM, Verkman AS, Holtzman EJ: Identification and characterization of aquaporin-2 water channel mutations causing nephrogenic diabetes insipidus with partial vasopressin response. Hum Mol Genet 6: 18651871, 1997[Abstract/Free Full Text]
Goji K, Kuwahara M, Gu Y, Matsuo M, Marumo F, Sasaki S: Novel mutations in aquaporin-2 gene in female siblings with nephrogenic diabetes insipidus: Evidence of disrupted water channel function. J Clin Endocrinol Metab 83: 32053209, 1998[Abstract/Free Full Text]
Oksche A, Dickson J, Schulein R, Seyberth HW, Muller M: Two novel mutations in the vasopressin V2 receptor gene in patients. Biochem Biophys Res Commun 205: 552557, 1994[CrossRef][Medline]
Bichet DG, Arthus M-F, Lonergan M, Hendy GN, Paradis AJ, Fujiwara TM, Morgan K, Gregory MC, Rosenthal W, Didwania A, et al: X-linked nephrogenic diabetes insipidus mutations in North America and the Hopewell hypothesis. J Clin Invest 92: 12621268, 1993
Kamsteeg EJ, Deen PMT: Detection of aquaporin-2 in the plasma membranes of oocytes: a novel isolation method with improved yield and purity. Biochem Biophys Res Commun 282: 683690, 2001[CrossRef][Medline]
McLean IW, Nakane PK: Periodate-lysine-paraformaldehyde fixative. A new fixation for immunoelectron microscopy. J Histochem Cytochem 22: 10771083, 1974[Abstract]
Richardson JC, Scalera V, Simmons NL: Identification of two strains of MDCK cells which resemble separate nephron tubule segments. Biochim Biophys Acta 673: 2636, 1981[Medline]
Deen PMT, Nielsen S, Bindels RJM, van Os CH: Apical and basolateral expression of Aquaporin-1 in transfected MDCK and LLC-PK cells and functional evaluation of their transcellular osmotic water permeabilities. Pflugers Arch 433: 780787, 1997[CrossRef][Medline]
Deen PMT, van Balkom BW, Savelkoul PJ, Kamsteeg EJ, Van Raak M, Jennings ML, Muth TR, Rajendran V, Caplan MJ: Aquaporin-2: COOH terminus is necessary but not sufficient for routing to the apical membrane. Am J Physiol Renal Physiol 282: F330F340, 2002[Abstract/Free Full Text]
Marr N, Kamsteeg EJ, Van Raak M, van Os CH, Deen PMT: Functionality of aquaporin-2 missense mutants in recessive nephrogenic diabetes insipidus. Pflugers Arch 442: 7377, 2001[CrossRef][Medline]
Kamsteeg EJ, Deen PMT: Importance of aquaporin-2 expression levels in genotype -phenotype studies in nephrogenic diabetes insipidus. Am J Physiol Renal Physiol 279: F778F784, 2000[Abstract/Free Full Text]
Deen PMT, Rijss JPL, Mulders SM, Errington RJ, van Baal J, van Os CH: Aquaporin-2 transfection of Madin-Darby canine kidney cells reconstitutes vasopressin-regulated transcellular osmotic water transport. J Am Soc Nephrol 8: 14931501, 1997[Abstract]
Smith BL, Agre P: Erythrocyte Mr 28,000 transmembrane protein exists as a multisubunit oligomer similar to channel proteins. J Biol Chem 266: 64076415, 1991[Abstract/Free Full Text]
Verbavatz JM, Brown D, Sabolic I, Valenti G, Ausiello DA, Van Hoek AN, Ma T, Verkman AS: Tetrameric assembly of CHIP28 water channels in liposomes and cell membranes: A freeze-fracture study. J Cell Biol 123: 605618, 1993[Abstract/Free Full Text]
Baumgarten R, Van De Pol MH, Wetzels JF, van Os CH, Deen PMT: Glycosylation is not essential for vasopressin-dependent routing of aquaporin-2 in transfected Madin-Darby canine kidney cells. J Am Soc Nephrol 9: 15531559, 1998[Abstract]
Kim PS, Arvan P: Endocrinopathies in the family of endoplasmic reticulum (er) storage diseases: Disorders of protein trafficking and the role of er molecular chaperones. Endocr Rev 19: 173202, 1998[Abstract/Free Full Text]
Gardner TG, Franklin RA, Robinson PJ, Pederson NE, Howe C, Kearse KP: T cell receptor assembly and expression in the absence of calnexin. Arch Biochem Biophys 378: 182189, 2000[CrossRef][Medline]
Kosuge T, Toyoshima S: Increased degradation of newly synthesized interferon-gamma (IFN-gamma) in anti CD3-stimulated lymphocytes treated with glycoprotein processing inhibitors. Biol Pharm Bull 23: 545548, 2000[Medline]
Halaban R, Svedine S, Cheng E, Smicun Y, Aron R, Hebert DN: Endoplasmic reticulum retention is a common defect associated with tyrosinase-negative albinism. Proc Natl Acad Sci USA 97: 58895894, 2000[Abstract/Free Full Text]
Rogan PK, Faux BM, Schneider TD: Information analysis of human splice site mutations [published erratum appears in Hum Mutat 13: 82, 1999]. Hum Mutat 12: 153171, 1998[CrossRef][Medline]
Roeder RG: Multiple forms of deoxyribonucleic acid-dependent ribonucleic acid polymerase in Xenopus laevis. Levels of activity during oocyte and embryonic development. J Biol Chem 249: 249256, 1974[Abstract/Free Full Text]
Pathak RK, Merkle RK, Cummings RD, Goldstein JL, Brown MS, Anderson RG: Immunocytochemical localization of mutant low density lipoprotein receptors that fail to reach the Golgi complex. J Cell Biol 106: 18311841, 1988[Abstract/Free Full Text]
Lloyd ML, Olsen WA: A study of the molecular pathology of sucrase-isomaltase deficiency. A defect in the intracellular processing of the enzyme. N Engl J Med 316: 438442, 1987[Abstract]
Waheed A, Parkkila S, Zhou XY, Tomatsu S, Tsuchihashi Z, Feder JN, Schatzman RC, Britton RS, Bacon BR, Sly WS: Hereditary hemochromatosis: Effects of C282Y and H63D mutations on association with beta(2)-microglobulin, intracellular processing, and cell surface expression of the HFE protein in COS- 7 cells. Proc Natl Acad Sci USA 94: 1238412389, 1997[Abstract/Free Full Text]
Hory B, Roussanne MC, Drueke TB, Bourdeau A: The calcium receptor in health and disease. Exp Nephrol 6: 171179, 1998[CrossRef][Medline]
Ficker E, Thomas D, Viswanathan PC, Dennis AT, Priori SG, Napolitano C, Memmi M, Wible BA, Kaufman ES, Iyengar S, Schwartz PJ, Rudy Y, Brown AM: Novel characteristics of a misprocessed mutant HERG channel linked to hereditary long QT syndrome. Am J Physiol Heart Circ Physiol 279: H1748H1756, 2000[Abstract/Free Full Text]
Drumm ML, Wilkinson DJ, Smit LS, Worrell RT, Strong TV, Frizzell RA, Dawson DC, Collins FS: Chloride conductance expressed by delta F508 and other mutant CFTRs in Xenopus oocytes. Science 254: 17971799, 1991[Abstract/Free Full Text]
Makhina EN, Nichols CG: Independent trafficking of KATP channel subunits to the plasma membrane. J Biol Chem 273: 33693374, 1998[Abstract/Free Full Text]
Denning GM, Anderson MP, Amara JF, Marshall J, Smith AE, Welsh MJ: Processing of mutant cystic fibrosis transmembrane conductance regulator is temperature-sensitive. Nature 358: 761764, 1992[CrossRef][Medline]
Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA: Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63: 827834, 1990[CrossRef][Medline]
Deen PMT, van Aubel RA, van Lieburg AF, van Os CH: Urinary content of aquaporin 1 and 2 in nephrogenic diabetes insipidus. J Am Soc Nephrol 7: 836841, 1996[Abstract]
Kanno K, Sasaki S, Hirata Y, Ishikawa S, Fushimi K, Nakanishi S, Bichet DG, Marumo F: Urinary excretion of aquaporin-2 in patients with diabetes insipidus. N Engl J Med 332: 15401545, 1995[Abstract/Free Full Text]
Tamarappoo BK, Yang B, Verkman AS: Misfolding of mutant aquaporin-2 water channels in nephrogenic diabetes insipidus [In Process Citation]. J Biol Chem 274: 3482534831, 1999[Abstract/Free Full Text]
Canfield M, Tamarappoo BK, Moses AM, Verkman AS, Holtzman EJ: Novel AQP2 mutations as a cause of partially dDAVP-responsive post V2 receptor congenital nephrogenic diabetes insipidus (CNDI). J Am Soc Nephrol 7: 1611, 1996
LeBlanc Straceski JM, Montgomery KT, Kissel H, Murtaugh L, Tsai P, Ward DC, Krauter KS, Kucherlapati R: Twenty-one polymorphic markers from human chromosome 12 for integration of genetic and physical maps. Genomics 19: 341349, 1994[CrossRef][Medline]
Received for publication October 18, 2001.
Accepted for publication June 3, 2002.
This article has been cited by other articles:
G. Akabane, Y. Ogushi, T. Hasegawa, M. Suzuki, and S. Tanaka Gene cloning and expression of an aquaporin (AQP-h3BL) in the basolateral membrane of water-permeable epithelial cells in osmoregulatory organs of the tree frog
Am J Physiol Regulatory Integrative Comp Physiol,
June 1, 2007;
292(6):
R2340 - R2351.
[Abstract][Full Text][PDF]
G. Chen, O. Frohlich, Y. Yang, J. D. Klein, and J. M. Sands Loss of N-Linked Glycosylation Reduces Urea Transporter UT-A1 Response to Vasopressin
J. Biol. Chem.,
September 15, 2006;
281(37):
27436 - 27442.
[Abstract][Full Text][PDF]
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus.
Am J Physiol Renal Physiol,
August 1, 2006;
291(2):
F257 - F270.
[Abstract][Full Text][PDF]
L. M. Russo, M. McKee, and D. Brown Methyl-beta-cyclodextrin induces vasopressin-independent apical accumulation of aquaporin-2 in the isolated, perfused rat kidney
Am J Physiol Renal Physiol,
July 1, 2006;
291(1):
F246 - F253.
[Abstract][Full Text][PDF]
F. J. M. Detmers, B. L. de Groot, E. M. Muller, A. Hinton, I. B. M. Konings, M. Sze, S. L. Flitsch, H. Grubmuller, and P. M. T. Deen Quaternary Ammonium Compounds as Water Channel Blockers: SPECIFICITY, POTENCY, AND SITE OF ACTION
J. Biol. Chem.,
May 19, 2006;
281(20):
14207 - 14214.
[Abstract][Full Text][PDF]
V. Bernier, J.-P. Morello, A. Zarruk, N. Debrand, A. Salahpour, M. Lonergan, M.-F. Arthus, A. Laperriere, R. Brouard, M. Bouvier, et al. Pharmacologic Chaperones as a Potential Treatment for X-Linked Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol.,
January 1, 2006;
17(1):
232 - 243.
[Abstract][Full Text][PDF]
F. de Mattia, P. J.M. Savelkoul, E.-J. Kamsteeg, I. B.M. Konings, P. van der Sluijs, R. Mallmann, A. Oksche, and P. M.T. Deen Lack of Arginine Vasopressin-Induced Phosphorylation of Aquaporin-2 Mutant AQP2-R254L Explains Dominant Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol.,
October 1, 2005;
16(10):
2872 - 2880.
[Abstract][Full Text][PDF]
F. de Mattia, P. J.M. Savelkoul, D. G. Bichet, E.-J. Kamsteeg, I. B.M. Konings, N. Marr, M.-F. Arthus, M. Lonergan, C. H. van Os, P. van der Sluijs, et al. A novel mechanism in recessive nephrogenic diabetes insipidus: wild-type aquaporin-2 rescues the apical membrane expression of intracellularly retained AQP2-P262L
Hum. Mol. Genet.,
December 15, 2004;
13(24):
3045 - 3056.
[Abstract][Full Text][PDF]
M. A.J. Devonald and F. E. Karet Renal Epithelial Traffic Jams and One-Way Streets
J. Am. Soc. Nephrol.,
June 1, 2004;
15(6):
1370 - 1381.
[Full Text][PDF]
C. Boccalandro, F. de Mattia, D.-C. Guo, L. Xue, P. Orlander, T. M. King, P. Gupta, P. M.T. Deen, V. R Lavis, and D. M. Milewicz Characterization of an Aquaporin-2 Water Channel Gene Mutation Causing Partial Nephrogenic Diabetes Insipidus in a Mexican Family: Evidence of Increased Frequency of the Mutation in the Town of Origin
J. Am. Soc. Nephrol.,
May 1, 2004;
15(5):
1223 - 1231.
[Abstract]
<