Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwata, Y.
Right arrow Articles by Kobayashi, K.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwata, Y.
Right arrow Articles by Kobayashi, K.-i.
J Am Soc Nephrol 14:57-67, 2003
© 2003 American Society of Nephrology

p38 Mitogen-Activated Protein Kinase Contributes to Autoimmune Renal Injury in MRL-Faslpr Mice

Yasunori Iwata*, Takashi Wada{dagger}*, Kengo Furuichi*, Norihiko Sakai*, Kouji Matsushima{ddagger}, Hitoshi Yokoyama{dagger} and Ken-ichi Kobayashi*

*Department of Gastroenterology and Nephrology, {dagger}Division of Blood Purification, Graduate School of Medical Science, Kanazawa University, Kanazawa, Japan; and {ddagger}Department of Molecular Preventive Medicine, University of Tokyo, Tokyo, Japan.

Correspondence to Dr. Takashi Wada, Department of Gastroenterology and Nephrology, Kanazawa University Graduate School of Medical Science, 13-1 Takara-machi, Kanazawa 920-8641, Japan. Phone: 81-76-265-2000 ext. 3462; Fax: 81-76-234-4250;


   Abstract
Top
 Abstract
Introduction
 Material and Methods
 Results
 Discussion
 References
 
ABSTRACT. The phosphorylation of p38 mitogen-activated protein kinase (MAPK) is responsible for the production and signal transduction of cytokines and chemokines. This study hypothesized that p38 MAPK activation is required for spontaneous autoimmune renal injury in MRL-Faslpr mice, resembling human lupus erythematosus. FR167653, a specific inhibitor of p38 MAPK, is orally administrated from 3 or 4 mo of age in MRL-Faslpr mice (at doses of 10 or 32mg/kg per day) until 6 mo of age. The phosphorylated p38 MAPK in kidneys of MRL-Faslpr mice was evaluated. The number of phosphorylated p38 MAPK-positive cells was increased in diseased kidneys. The daily oral administration of FR167653 decreased p38 MAPK phosphorylation in kidneys, especially in a group of mice administered FR167653 (32 mg/kg per day) daily from 3 to 6 mo of age. FR167653 reduced the accumulation of macrophages and T cell and prevented kidney pathology, resulting in prolonged survival. In addition, FR167653 reduced expression of MCP-1 and TNF-{alpha} in the diseased kidneys and cultured tubular epithelial cells. Furthermore, FR167653 decreased IgG levels in the diseased kidneys and circulation. These results suggest that the phosphorylation of p38 MAPK is required for the pathogenesis of renal injury in MRL-Faslpr mice followed by subsequent expression of renal cytokine/chemokine and IgG production. This study provides evidence that the regulation of p38 MAPK is a novel target for the therapy of renal injury in systemic lupus erythematosus. twada@medf.m.kanazawa-u.ac.jp


   Introduction
Top
 Abstract
 Introduction
Material and Methods
 Results
 Discussion
 References
 
Mitogen-activated protein kinase (MAPK) signaling plays an important role in proliferation and apoptosis in the setting of inflammatory processes (1). The activation of MAPK isoform p38 is involved in apoptosis, stress responses, and inflammation (2). Recent studies revealed that p38 MAPK phosphorylation is essentially responsible for the production of C-C chemokine, monocyte chemoattractant protein (MCP)-1, also termed as monocyte chemotactic and activating factor (3,4), and for the signal transduction of chemokine receptor, CCR5 (5). Furthermore, p38 MAPK is activated and involved in the pathogenesis of human autoimmune diseases, including the sialoadenitis of Sjögren syndrome (6) and rheumatoid arthritis (7). Thus, the activation of p38 MAPK may contribute to the pathogenesis of autoimmune diseases via the activation of the signal transduction and expression of cytokines and chemokines. However, the role of p38 MAPK remains to be investigated in systemic lupus erythematosus, one of the major progressive autoimmune diseases.

Autoimmune diseases in MRL/MPJ-lpr/lpr (MRL-Faslpr) mice resemble human systemic lupus erythematosus, characterized by the dysregulation of both cellular and humoral immunity (8). This strain is particularly valuable for understanding the pathogenesis of autoimmune renal injury. Cytokines are evident before and during autoimmune tissue destruction in MRL-Faslpr( mice. It has been previously established that a macrophage (M{phi}) growth factor, colony stimulating factor-1 (CSF)-1, interleukin-1{beta} (IL)-1{beta} and tumor necrosis factor-{alpha} (TNF)-{alpha} levels are increased simultaneously in the kidney and circulation in MRL-Faslpr mice (9–11), which initiate and promote autoimmune organ destruction. Intrarenal gene transfer of CSF-1 or granulocyte-macrophage colony-stimulating factor (GM-CSF) elicited leukocyte infiltration (M{phi} and T cells) in MRL-Faslpr kidneys (12–14). The expression of these cytokines and growth factors are dependent on the activation of nuclear factors, including nuclear factor {kappa}B (NF-{kappa}B), possibly through activation of p38 MAPK (15). In addition, B cell activation is associated with the activation of p38 MAPK (16). These findings imply that activation of p38 MAPK may be instrumental in progressive autoimmune kidney destruction characteristic of the MRL-Faslpr strain. Thus, we hypothesize that p38 MAPK is responsible for the production and signal transduction of the cytokines and chemokines, thereby initiating and promoting autoimmune renal injury in MRL-Faslpr mice.

To test this hypothesis, we have examined the impacts of p38 MAPK phosphorylation on the systemic autoimmunity resulting in severe renal injury in MRL-Faslpr mice via the daily oral administration of a specific inhibitor of p38 MAPK, FR167653, (1-[7-(4-fluorophenyl)-1, 2, 3, 4-tetrahydro-8-(4-pyridyl)pyrazolo[5, 1-c] (1,2,4) triazin-2-yl]-2-phenylethanedione sulfate monohydrate) (17–21). We describe here that the inhibition of p38 MAPK reduced the expression of cytokine/chemokine and IgG levels, which is subsequently followed by a decrease in lethal autoimmune organ destruction, and prolonged survival.


   Material and Methods
Top
 Abstract
 Introduction
 Material and Methods
Results
 Discussion
 References
 
Mice
MRL-Faslpr mice aged 1 mo were obtained from Charles River Japan Inc., Atsugi, Japan. All procedures employed in the animal experiments complied with the standards set out in the Guideline for the Care and Use of Laboratory Animals in Takara-machi Campus of Kanazawa University. MRL-Faslpr mice were divided into five groups, and experimental design was described in Figure 1. FR167653 (10 or 32 mg/kg per day), dissolved in drinking water, was orally administrated from 3 or 4 mo of age. Mice in any group were sacrificed at 6 mo of age. Ten MRL/MpJ++ (MRL++) mice were used as negative controls.



View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Experimental design FR167653 is orally administrated from 3 or 4 mo of age in MRL-Faslpr mice (group A, at doses of 32 mg/kg per day; groups B, at doses of 10 mg/kg per day) until 6 months of age. All mice were sacrificed at 6 months.

 
Proteinuria
We assessed urinary protein levels monthly using dipstick analysis (Bayer Medicals, Tokyo, Japan) and graded them semiquantitatively (0, none; 0.5, 30 to 100 mg/dl; 1, 100 to 300 mg/dl; 2, 300 to 1000 mg/dl; 3, >1000 mg/dl).

Lymphadenopathy
Protruding lymph nodes (cervical, brachial, and inguinal) were assessed monthly. Lymph node score based on palpable nodes: 0, none; 1, small, at one site; 2, moderate, at two different sites; and 3, large, at three or more different sites.

Histopathology
Kidneys were either snap-frozen in OCT compound for cryostat sectioning or fixed in 10% neutral-buffered formalin. Formalin-fixed tissue was embedded in paraffin, and 4-µm sections were stained with periodic acid-Schiff (PAS) and evaluated by a light microscopy. We evaluated the glomerular, periglomerular, interstitial, and perivascular pathology morphometically. Glomeruli and periglomeruli were assessed by counting intraglomerular and perigolmerular cells at 50 glomerular cross-sections (gcs) per kidney. We evaluated the interstitial pathology by counting the number of infiltrating cells in 20 random interstitial fields (magnification, x400). The extent of renal pathology was assessed by determining (1) the percentage of crescents at 50 gcs (defined as thickening of Bowman’s capsule wall with two or more cell layers; (2) the percentage of segmental lesions at 50 gcs (exhibiting at least one of the following: necrosis, proliferation, hyalinosis) in glomeruli; (3) the percentage of damaged tubuli (consisting of at least one of the following: dilatation, atrophy, necrosis) in randomly 20 selected microscopic fields (magnification, x400). The perivascular cell accumulation was determined by scoring the number of cell layers surrounding ten random interlobular and intralobular arteries (0, none; 1, <5 layers surrounding more than half of the vessel; 2, 5 to 10 layers surrounding more than half of the vessel; 3, >10 layers surrounding more than half of the vessel). Scoring was evaluated using uncoded slides.

Antibodies
The following primary antibodies were used for immunostaining: rat anti-mouse CD4 IgG2a clone RM4–5 (PharMigen, San Diego, CA) to detect CD4 T cells; rat anti-mouse CD8a (Ly-2) IgG2a clone 53 to 6.7 (PharMigen) to detect CD8 T cells; rat anti-mouse CD45R/B220 IgG2a clone RA3–6B2 (PharMigen) to detect CD4/CD8-negative T cells and B cells; rat anti-mouse monocyte/macrophage IgG2b clone MOMA-2 (BMA biomedicals AG, Augst, Switzerland) to detect M{phi}; rabbit anti-phosphorylated p38 MAPK polyclonal antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), which react with both {alpha} and {beta} isoforms of p38 MAPK as described previously (22); FITC-conjugated anti mouse IgG (Cappel, Durham, NC) to detect mouse IgG. The secondary antibodies for immunostaining were biotin-conjugated rabbit anti-rat IgG and biotin-conjugated goat anti-rabbit IgG (Vector Labs, Burlingame, CA). ELISA analysis, including serum total IgG, IgG subclasses (Bethyl, Montgomery, TX), and anti-ds DNA antibodies (Alpha Diagnostic, San Antonio, TX), was performed using isotype-specific standards, goat anti-mouse capture antibodies, and horseradish peroxidase-conjugated goat anti-mouse detection antibodies.

Immunohistochemical Examination
Tissues for immunoperoxidase staining were snap-frozen in OCT (Miles Scientific, Naperville, IL) and stored at -80°C. We located M{phi}, CD4-, CD8-, and B220-positive cells, characteristics of MRL-Faslpr mice using monoclonal antibodies. These cells were identified using the avidin-biotin complex immunoperoxidase technique. Using a light microscope, we counted M{phi}-, CD4-, and CD8-positive T cells and B220-positive cells in periglomerular areas of 20 randomly selected glomeruli that were expressed as cells/glomerulus (gcs). Interstitial M{phi}-, CD4-, CD8-positive T cells and B220-positive cells were counted in 10 randomly selected fields of cortical interstitium with a light microscopic (magnification, x400) and described as cells/field. Similarly, we graded the perivascular M{phi}, CD4-, and CD8-positive T cells in 10 interlobular and intralobular arteries.

In addition, we detected phosphorylated p38 MAPK within the kidneys. The presence of phosphorylated p38 MAPK was demonstrated immunohistochemically in paraffin-embedded tissue specimens at 6 mo of age by the indirect avidin-biotinylated peroxidase complex method with rabbit anti-phosphorylated p38 MAPK polyclonal antibodies (10 µg/ml). A normal rabbit serum was used as a negative control.

To evaluate the phosphorylated p38 MAPK-positive cells in the kidneys, we counted phosphorylated p38 MAPK-positive cells in glomerular areas of 20 randomly selected glomeruli that were expressed as cells/glomerulus (gcs). Interstitial phosphorylated p38 MAPK-positive cells were counted in ten randomly selected fields of cortical interstitium with a light microscopy (magnification, x400) and described as cells/field.

The Deposition of IgG
To determine IgG deposits in diseased kidneys, 4-µm frozen sections were stained with FITC-conjugated antibodies detecting murine IgG at 37°C for 30 min. The amount and extent of fluorescence was evaluated in at least 50 glomeruli graded from 0 to 3 (0, none; 1, mild; 2, moderate; 3, severe).

Profile of Serum Immunoglobulins and anti-ds DNA Antibodies
ELISA plates were coated overnight at 4°C with 5 µg/ml goat anti-mouse Ig capture antibodies (against total IgG and IgG subclasses) in 0.1 M carbonate buffer, pH 9.4 (mouse IgG ELISA quantification kit, Bethyl Laboratories, Inc., Montgomery, TX; Mouse anti-ds DNA antibodies ELISA quantification kit, Alpha Diagnostic, San Antonio, TX). Wells were blocked for 1 h with assay diluent (0.5% BSA in 0.1 M borate buffer, pH 8.0). We added standards of IgG, IgG subclasses, or anti-ds DNA antibodies to the plates (100 µl/well), performing a series of threefold dilutions, and assessed serum samples. Standards and serum samples were incubated overnight at 4°C, and bound IgG was detected with goat anti-mouse detection antibodies conjugated with horseradish peroxydase and enzymatically developed. Absorbance was measured at 450 nm. Serum anti-ds DNA antibodies were showed OD index (sample OD/standard OD).

Intrarenal Transcripts of MCP-1 and TNF-{alpha}
Total RNA was extracted from the cortices, and analyses were performed using reverse transcriptase PCR (RT-PCR), as described previously (22). Reverse transcription was performed using a RT-PCR kit (Perkin Elmer, Foster City, CA) for total RNA obtained and combined from mice in each group (1 µg of RNA per mouse). The complementary DNA product (1 µg) was amplified by PCR. Primers (5' primer TCTCATCAGTTCTATGGCCC; 3' primer GGGAGTAGACAAGGTACAAC) and (5' primer CCTCTCTCTTGAGCTTGGTG; 3' primer AAGCCAGCTCTCTCTTCCTC) were used to detect TNF-{alpha} and MCP-1. Ten microliters of PCR products were analyzed using 2% agarose gel electrophoresis and stained with ethidium bromide. The housekeeping gene GAPDH was used for PCR controls. Transcripts (TNF-{alpha}, MCP-1)/GAPDH ratios were evaluated.

Cell Culture and Treatment by IL-1{beta} and TNF-{alpha}
Human renal proximal tubular epithelial cells (TEC) (lot No. CC-2553; Cambrex, East Rutherford, NJ) were grown in Renal Epithelial Cell Growth Medium (REGM) BulletKit (Cambrex) with 100 µg/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere (5% CO2/95% air) at 37°C. Cultured TEC were trypsinized, suspended in REGM, and seeded onto six-well collagen type-IV-coated plates (Asahi Technoglass Co., Tokyo, Japan). TEC were pretreated with or without FR167653 (1 x 10-6 M or 3 x 10-7 M) for 1 h, followed by the stimulation with both IL-1{beta} (10 ng/ml) and TNF-{alpha} (20 ng/ml). TEC were harvested 24 h and 48 h after the stimulation of IL-1{beta} and TNF-{alpha}. Total RNA was extracted from TEC using RNAzol B (Tel-Test, Friendswood, TX), a modification of the acid guanidium isothiocyanate-phenolchloroform method (23).

Detection of MCP-1 Transcripts in Cultured TEC
To determine the effects of FR167653 on MCP-1 transcripts, total RNA was analyzed by reverse transcription PCR (RT-PCR). cDNA was reverse-transcribed from total RNA (1 µg RNA per mouse) using an RT-PCR kit (Takara Shuzo Co. Ltd, Tokyo, Japan). The cDNA product was amplified by PCR. Primers for MCP-1 (5' primer TTCTGTGCCTGCTGCTGCTCATA; 3' primer GAGTGAGTGTTCAAG-TCTTCG) were used. Ten microliters of PCR products were analyzed using 2.0% agarose gel electrophoresis and stained with ethidium bromide. The housekeeping gene GAPDH was used for PCR products.

Detection of MCP-1 in Supernatants of Cultured TEC by ELISA
MCP-1 levels in supernatants of cultured TEC were determined by ELISA when stimulated by the combination of IL-1{beta} and TNF-{alpha} with or without FR167653 treatment (24).

Statistical Analyses
The data represent the means ± SEM. Statistical significance was determined by ANOVA and Kruskal-Wallis analyses. Data was analyzed using Kaplan-Meier life table method for survival curves.


   Results
Top
 Abstract
 Introduction
 Material and Methods
 Results
Discussion
 References
 
FR167653-Treated MRL-Faslpr Mice Survive Longer than the Untreated
Survival in the FR167653-treated MRL-Faslpr mice (groups 1 to 4) was extended as compared with untreated MRL-Faslpr mice (Figure 2). The 50% mortality in untreated MRL-Faslpr mice was 6 mo of age. In comparison, FR167653-treated MRL-Faslpr mice in groups 1 to 4 had a prolonged lifespan.



View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. FR167653-treated mice survive longer than untreated MRL-Faslpr mice. Survival in the FR167653-treated MRL-Faslprmice (groups 1 to 4) was extended as compared with untreated MRL-Faslpr mice (group 5).

 
FR167653-Treated MRL-Faslpr Mice Are Protected from Proteinuria
Proteinuria was prevented in FR167653 treated MRL-Faslprmice (Figure 3). From 3 to 6 mo of age, increase in proteinuria was diminished in mice of group 1, whereas levels of proteinuria were elevated in untreated MRL-Faslpr mice. In group 2, proteinuria, which was already evoked at the initiation time of administration of FR167653, was also significantly reduced by the administration of FR167653 at 6 mo of age. In addition, at 6 mo, urinary protein excretion was significantly reduced in group 1 than that in group 2 (P < 0.05). In group 3, proteinuria was also significantly prevented.



View larger version (16K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. FR167653-treated mice are protected from proteinuria. Proteinuria was prevented in the FR167653-treated MRL-Faslpr mice. *P < 0.05 versus untreated MRL-Faslpr mice.

 
Lymphadenopathy Is Ameliorated in FR167653-Treated MRL-Faslpr Mice
Untreated MRL-Faslpr mice showed severe lymphadenopathy at 6 mo of age. The incidence and severity of lymphadenopathy remained diminished in FR167653-treated MRL-Faslpr mice as compared with these of untreated MRL-Faslpr mice (Figure 4).



View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Lymphadenopathy is reduced in FR167653-treated MRL-Faslpr mice. Lymphadenopathy was developed in untreated MRL-Faslpr mice; however, lymphadenopathy remains diminished in all treated groups. * P < 0.05 versus untreated MRL-Faslprmice.

 
Renal Pathology Is Reduced in FR167653-Treated MRL-Faslpr Mice
To determine the impact of p38 MAPK inhibition, we evaluated the extent of renal pathology in FR167653-treated MRL-Faslpr mice in comparison with untreated MRL-Faslpr mice at 6 mo of age (Figures 5, 6, and 7). Renal pathology in untreated mice consisted of severe proliferative glomerulonephritis, interstitial/perivascular damage. In contrast, renal pathologic changes were attenuated but not abrogated in FR167653-treated MRL-Faslpr mice (Figure 5), as compared with that of MRL++ mice (Figures 5, 6, and 7). We noted reductions in the numbers of glomerular, periglomerular, interstitial, and perivascular cells. In particular, mice in group 1 exhibited a diminishment in glomerular and interstitial cell infiltration as compared with untreated MRL-Faslpr mice (23.7% reduction in glomuruli, 43.8% in periglomuruli, 41.7% in interstitium, and 24% in perivascular region; P < 0.05, respectively) (Figure 6, a, b, c, and d). We also noted reductions in glomerular crescents and segmental lesions, tubular damage (Figure 6, e, f, and g). Kidney disease in MRL-Faslpr mice consists of the infiltration of leukocytes including M{phi} (MOMA-2), CD4, CD8 T cells and B220-positive cells. We evaluated the number of these infiltrates in the diseased kidneys (Figure 7). There was a significant reduction in the number of M{phi}, CD4, and CD8 T cells as compared with those of untreated MRL-Faslpr mice (Figure 7). However, the number of these cells in diseased kidney remained still increased, when compared with those of MRL++ mice.



View larger version (142K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Renal pathology is reduced in FR167653-treated MRL-Faslpr mice. MRL-Faslpr mice developed severe proliferative glomerulonephritis and interstitial/perivascular damage (group 5). Renal pathology was decreased in FR167653-treated MRL-Faslpr mice, particularly in group 1. PAS staining; original magnification, x200.

 


View larger version (49K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. FR167653 protects cell infiltration and reduces renal damage in MRL-Faslpr mice. We noted reduction in the number of glomerular (a), periglomerular (b), interstitial (c), and perivascular (d) cells. In particular, mice in groups 1 and 2 diminished glomerular and interstitial cell infiltration as compared with untreated MRL-Faslpr mice at 6 mo of age. Glomerular crescents (e), segmental lesions (f), and tubular damage (g) were reduced in FR167653 treated MRL-Faslpr mice at 6 mo of age. * P < 0.05 versus untreated MRL-Faslpr mice at 6 mo of age.

 


View larger version (44K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. FR167653-treated mice are protected from kidney-infiltrating macrophages and T cells in MRL-Faslpr mice. There was a significant reduction in the number of M{phi}, CD4, and CD8 T cells but not B220 in periglomerular (a), interstitial (b), and perivascular (c) lesions in FR167653-treated MRL-Faslpr mice. * P < 0.05 versus untreated MRL-Faslpr mice at 6 mo of age.

 
Reduced Number of Phosphorylated p38 MAPK-Positive Cells in Kidney
We evaluated the number of phosphorylated p38 MAPK-positive cells in kidneys from MRL-Faslpr mice. Phosphorylated p38-positive cells were detected in glomeruli (Figure 8a) and interstitium. Phosphorylated p38-positive cells were already detected in kidneys of MRL-Faslpr mice at 1 mo of age, when autoimmune organ diseases were hardly observed (data not shown). At 6 mo of age, the number of phosphorylated p38-positive cells was 39.6 ± 3.8 in glomeruli (Figure 8c) and 79.7 ± 3.3 in interstitium (Figure 8d) in untreated MRL-Faslpr mice. Glomerular phosphorylated p38 MAPK-positive cells decreased in groups 1 (Figure 8b) and 2 as compared with untreated MRL-Faslpr mice (24.8 ± 1.3 in group 1, 26.8 ± 1.4 in group 2; P < 0.05, respectively) (Figure 8c). In interstitium, phosphorylated p38 MAPK-positive cells also significantly decreased in group 1 (46.6 ± 2.6; P < 0.05) and 2 (51.6 ± 1.4; P < 0.05) as compared with untreated MRL-Faslpr mice (Figure 8d). In groups 3 and 4, glomerular and interstitial phosphorylated p38 MAPK-positive cells also significantly decreased (Figure 8, c and d).



View larger version (57K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 8. Reduced number of phosphorylated p38 MAPK-positive cells in FR167653-treated MRL-Faslpr mice in glomeruli and interstitium. We evaluated phosphorylated p38 MAPK-positive cells in glomeruli and interstitium from MRL-Faslpr mice. A representative photograph showed severe cell proliferation in glomeruli, many of which were phosphorylated p38 MAPK-positive in untreated MRL-Faslpr mice at 6 mo of age (a). Phosphorylated p38 MAPK-positive cells were reduced in FR167653-treated MRL-Faslpr mice (b and c). Also in interstitium, phosphorylated p38 MAPK-positive cells were reduced in FR167653-treated MRL-Faslpr mice in group 1 (d). * P < 0.05 versus untreated MRL-Faslpr mice at 6 mo of age. Original magnification, x400.

 
Reduced TNF-{alpha} and MCP-1 Transcripts in FR167653-Treated MRL-Faslpr Mice Kidneys
It is previously reported that TNF-{alpha} and MCP-1 transcripts that are upregulated with the deposition of renal injury in MRL-Faslpr mice are required for autoimmune kidney disease (10,25). In kidneys of FR167653 treated MRL-Faslpr mice in groups 1 to 4, TNF-{alpha} and MCP-1 transcripts were reduced as compared with untreated MRL-Faslpr mice (Figure 9).



View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 9. FR167653 treatment reduces TNF-{alpha} and MCP-1 transcripts in MRL-Faslpr mice. TNF-{alpha} (a) and MCP-1 (b) transcripts in the diseased kidneys were upregulated MRL-Faslpr mice, which were reduced in mice treated with FR167653. Results are represented of three experiments. * P < 0.05 versus untreated MRL-Faslpr mice at 6 mo of age. # P < 0.05 versus FR167653-treated MRL-Faslpr mice from 4 mo of age.

 
FR167653 Reduced Serum IgG and Anti-ds DNA Antibodies in MRL-Faslpr Mice
To determine whether the inhibition of p38 MAPK also reduced the production of IgG and anti-ds DNA antibodies resulted from B cell activation, we evaluated serum levels of IgG and anti-ds DNA antibodies. As compared with untreated MRL-Faslpr mice, serum levels of total IgG, IgG subclasses, and anti-ds DNA antibodies were significantly reduced in FR167653-treated MRL-Faslpr mice in groups 1, 2 and 3 (Figure 10). In addition to IgG levels, anti-ds DNA antibodies remained significantly lower in groups 1 and 3.



View larger version (58K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 10. Serum levels of IgG and anti-ds DNA antibodies are decreased by FR167653 treatment in MRL-Faslprmice. Serum levels of total IgG (a) and IgG subclasses (b through e). In addition, anti-ds DNA antibodies remained low in FR167653-treated MRL-Faslpr mice (f). * P < 0.05 versus untreated MRL-Faslpr mice at 6 mo of age. # P < 0.05 versus FR167653-treated MRL-Faslpr mice from 4 mo of age.

 
FR167653 Reduced Glomerular IgG Deposition
The amounts of glomerular IgG deposition were also reduced in FR167653-treated MRL-Faslpr mice in groups 1 and 2 (Figure 11). However, their IgG levels in circulation and glomeruli were still higher than those of MRL++ mice (Figures 10 and 11). These results suggest FR167653 treatment may inhibit the B cell activation, characteristic to autoimmune disorder of MRL-Faslpr mice.



View larger version (37K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 11. Intraglomerular IgG deposition is reduced in FR167653-treated MRL-Faslpr mice. Significant amounts of IgG were detected in diseased glomeruli in MRL-Faslpr mice, which were reduced by treatment of FR167653. * P < 0.05 versus untreated MRL-Faslprmice at 6 mo of age. # P < 0.05 versus FR167653-treated MRL-Faslpr mice from 4 mo of age.

 
Transcripts and Protein Levels of MCP-1 Were Diminished by FR167653 Treatment in TEC
The simultaneous stimulation of IL-1{beta} and TNF-{alpha} enhanced MCP-1 transcripts in cultured human TEC (Figure 12a). However, the enhanced transcripts of MCP-1 were decreased by treatment with FR167653 (Figure 12a). In addition, MCP-1 levels in supernatants were also diminished by the simultaneous incubation of FR167653. In contrast, cultured TEC with media alone faintly expressed MCP-1 (Figure 12, a and b).



View larger version (32K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 12. MCP-1 transcripts and MCP-1 protein are suppressed by FR167653 treatment. Total RNA was extracted from IL-1{beta}- and TNF- {alpha}-stimulated TEC. IL-1{beta} and TNF-{alpha} enhanced the transcription of MCP-1 in cultured human TEC. However, the enhanced m RNA expression of MCP-1 was decreased by the treatment with FR167653 (a). In addition, elevated MCP-1 levels in supernatants were significantly decreased by FR167653 (b). Results are representative of three experiments. * P < 0.05 versus IL-1{beta}- and TNF-{alpha}-stimulated TEC without FR167653 treatment at the same hour in cultured period.

 

   Discussion
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
References
 
In this report, we have tested the roles of p38 MAPK in autoimmune renal injury in MRL-Faslpr mice. We herein report that the inhibition of p38 MAPK reduced autoimmune diseases resulting in a prolonged life span in MRL-Faslpr mice. We also noted that the protection against renal injury in MRL-Faslpr mice resulted from a reduced infiltration of leukocytes, a diminished expression of cytokines known to promote renal injury, and a reduced production of Ig. Thus, we conclude that the activation of p38 MAPK is required to promote cytokine/chemokine and Ig production, which in turn result in lethal autoimmune renal injury in MRL-Faslpr mice.

During inflammation, p38 MAPK, activated in various cell types, is closely related to apoptosis, stress responses, and inflammation (2). In addition, p38 MAPK phosphorylation participates in the production of MCP-1, IL-1{beta}, and TNF-{alpha} for examples, in human mesangial cells (3) and human endothelial cells (4), which are known to promote autoimmune organ destruction in MRL-Faslpr mice (9,10). We report here that activated p38 MAPK-positive cells, increased in the diseased kidneys, were reduced by the administration of FR167653, concomitantly with the reduction of severity of autoimmune renal injury. Moreover, intrarenal transcripts of MCP-1 and TNF-{alpha} were diminished through FR167653 treatment. Therefore, p38 MAPK signaling-dependent chemokine/cytokine production may be responsible for the recruitment and activation of leukocytes in diseased kidneys in MRL-Faslpr mice. In addition to induction of the recruitment of leukocytes to the sites of inflammation, p38 MAPK is presumed to be involved in cell proliferation where transforming growth factor-{beta} or platelet-derived growth factor may work (26). In this study, the long-term administration of FR167653 had impacts on the prevention of end-stage organ damage. We recently reported that the administration of FR167653 at the onset of glomerulonephritis ameliorated glomerulosclerosis and interstitial fibrosis via the inhibition of MCP-1 (22). In addition, a recent study revealed that MCP-1 mediates collagen deposition in experimental glomerulonephritis by TGF-{beta} (27). In turn, TGF-{beta} may contribute to the secretion of tubular MCP-1 in nephrotic syndrome (28). Thus, once the activation of p38 MAPK is inhibited by FR167653, the upregulation of TNF-{alpha} and MCP-1 is reduced, possibly thereby leading to the prevention of cell infiltration and proliferation and long-term organ injury.

To understand whether the effects of p38 MAPK are directly on renal cells or whether this is indirectly due to a reduction in IgG levels, we investigated (1) serum levels of immunoglobulins and anti-ds DNA antibodies and IgG depositions in diseased kidneys and (2) the inhibitory impacts on MCP-1 production in cultured TEC. We detected reduced serum levels of Ig and anti-ds DNA antibodies and a decrease in the amount of Ig deposition in the kidney. Moreover, the inhibition of p38 MAPK resulted in reduction of subclasses of immunoglobulins in serum. Supporting this notion, a recent study revealed that p38 MAPK activation is indispensable for B cell activation leading to Ig production (29). In addition, Ig deposition in the kidney promotes and accelerates autoimmune renal destruction (30). In addition to reduction of B cell activation, FR167653 exhibited direct effects on tubular epithelial cells, resulting in reduction of chemokine, MCP-1. Thus, our data suggest that inhibition of p38 MAPK activation via FR167653 is effective for autoimmune renal injury through the decrease both in Ig production and activation of renal resident cells, such as TEC.

We have uncovered the therapeutic effects of p38 MAPK, responsible for promoting and escalating autoimmune renal injury. We report the inhibition of p38 MAPK from 3 mo of age, the onset of autoimmune disease in MRL-Faslpr mice, and reduced autoimmune renal injury. Moreover, FR167653 treatment begun from 4 mo of age was less effective compared with those begun from 3 mo of age, but it still significantly reduced escalating renal injury. These suggest that p38 MAPK inhibition may dampen the promotion and escalation of autoimmune attack in kidneys, even when tissue damage had been already commenced. This implies a possible impact on already-established human autoimmune diseases where p38 MAPK activation followed by upregulation of cytokines and/or chemokines plays an important role in the pathogenesis. Collectively, these data suggest that p38 MAPK has a promising future for the therapeutic target in human autoimmune renal injury.

To understand the time course of autoimmunity, we assessed protruding lymph nodes monthly (Figure 4). Massively enlarged lymph nodes reflect the activation of systemic autoimmunity in MRL-Faslprmice. Lymphadenopathy appeared from 2 mo of age and increased until 6 mo of age. The incidence and severity of lymphadenopathy diminished in FR167653-treated MRL-Faslpr mice as compared with those of untreated MRL-Faslpr mice during the time course examined. This means that the activity of systemic autoimmunity remained low by FR167653 treatment.

These studies further support the concept that the inhibition of 38 MAPK is still insufficient to completely prevent autoimmune renal injury. Other MAPK may be responsible for recruiting infiltrating cells and cellular proliferation. For example, the classic extracellular signal-regulated kinases (ERK) are identified in the context of growth factor-related signaling in the various types of cultured renal cells (31). In addition, increased renal ERK activation is associated with proliferative anti-glomerular basement membrane glomerulonephritis in vivo (32). Therefore, we would identify most important therapeutic targets in systemic autoimmunity MRL-Faslpr mice to achieve complete protection from renal injury.

FR167653 was originally developed as an inhibitor of IL-1{beta} and TNF-{alpha} (17–20); however, the precise molecular pharmacologic actions of FR167653 remain still unclear. In this study, we showed that FR167653 inhibited p38 MAPK activation. We previously reported that FR167653 does not affect the activation of other MAPK, such as ERK and JNK (22). Supporting this notion, a recent study showed that FR167653 specially inhibited p38 MAPK activation, especially p38{alpha} using an immune-complex kinases assay (20). Moreover, the well-identified specific p38 MAPK inhibitor SB203580 is structurally similar to FR167653, and the structural basis for the specificity of pyridinil-imidazole inhibitors of p38 MAPK is noted (33). In addition, SB242235 specifically inhibits p38{alpha} and p38{beta} (34). Concomitantly, we showed the reduction of p38 MAPK phosphorylation, especially p38{alpha} and p38{beta}, through FR167653, because antibodies that used for p38 MAPK react with both {alpha} and {beta} isoforms of p38 MAPK. Therefore, we speculate that FR167653 may specifically inhibit p38 MAPK activation in this model. However, the inhibitory effects of FR167653 on cyclooxygenases (COX) still remain uncertain. Takahashi et al. (20) reported FR167653 did not have inhibitory effects of COX-2, while Kawano et al. (35) described the suppressive effects of FR167653 on prostaglandin synthesis via the inhibit of COX-2, which may play a role in active lupus nephritis (36). Therefore, further studies will be required to determine the detailed molecular mechanisms of FR167653.

In conclusion, we have determined that autoimmune renal injury and Ig production in MRL-Faslpr mice is dependent on p38 MAPK activation. The activation of p38 MAPK upregulates cytokines/chemokines and Ig production in MRL-Faslpr mice. In turn, these recruit T cells and M{phi} into kidneys, thereby perpetuating progressive autoimmune tissue destruction. Thus we suggest that p38 MAPK is an appealing therapeutic target for combating autoimmune renal injury in systemic lupus erythematosus.


   References
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 References
 

  1. Herlaar E, Brown Z: p38 MAPK signaling cascades in inflammatory disease. Mol Medicine Today 5: 439–447, 1999
  2. Wang XS, Diener K, Manthey CL, Wang S, Rosenzweig B, Bray J, Delaney J, Cole CN, Chan-Hui PY, Mantlo N, Lichenstein HS, Zukowski M, Yao Z: Molecular cloning and characterization of a novel p38 mitogen-activated protein kinase. J Biol Chem 272: 23668–23674, 1997[Abstract/Free Full Text]
  3. Rovin GH, Wilmer WA, Danne M, Dickerso JA, Dixon CL, Lu L: The mitogen-activated protein kinase p38 is necessary for interleukin 1{beta}-induced monocyte chemoattractant protein 1 expression by human mesangial cells. Cytokine 11: 118–126, 1999[CrossRef][Medline]
  4. Goebeler M, Kilian K, Gillizer R, Kunz M, Yoshimura T, Broecker EB, Rapp UR, Ludwig S: The MKK6/p38 stress kinase cascade is critical for tumor necrosis factor-{alpha}-induced expression of monocyte-chemoattractant protein-1 in endothelial cells. Blood 93: 857–865, 1999[Abstract/Free Full Text]
  5. Ganju RK, Dutt P, Wu L, Newman W, Avraham H, Avraham S, Groopman JE: {beta}-chemokine receptor CCR5 signals via the novel tyrosine kinase RAFTK. Blood 91: 791–797, 1998[Abstract/Free Full Text]
  6. Nakamura H, Kawakami A, Yamasaki S, Kawabe Y, Nakamura T, Eguchi K: Expression of mitogen activated protein kinases in labial salivary glands with Sjögren’s syndrome. Ann Rheum Dis 58: 382–385, 1999[Abstract/Free Full Text]
  7. Schett G, Tohidast-Akrad M, Smolen JS, Schmid BJ, Steiner CW, Bitzan P, Zenz P, Redlich K, Xu Q, Steiner G: Activation, differential localization, and regulation of the stress-activated protein kinases, extracellular signal regulated kinases, c-JUN N terminal kinase, and p38 mitogen activated protein kinase, in sinovial tissue and cells in rheumatoid arthritis. Arthritis Rheum 43: 2501–2512, 2000[CrossRef][Medline]
  8. Theophiloulos AN, Dixon FJ: Murine models of systemic erythematosus. Adv Immunol 37: 269–290, 1985[Medline]
  9. Yui MA, Brissette WH, Brennan DC, Wuthrich RP, Kelley VR: Increased macrophage colony-stimulating factor in neonatal and adult autoimmune MRL-lpr mice. Am J Patho 139: 255–261, 1991[Abstract]
  10. Yokoyama H, Kreft B, Kelley VR: Biphasic increase in circulating and renal TNF-{alpha} in MRL-lpr mice with differing regulatory mechanisms. Kidney Int 47: 122–130, 1995[Medline]
  11. Wada T, Naito T, Griffiths RS, Coffman TM, Kelley VR: Systemic autoimmune nephritogenic components induce CSF-1 and TNF-{alpha} in MRL kidneys. Kidney Int 52: 934–941, 1997[Medline]
  12. Naito T, Yokoyama H, Moore KJ, Dranoff G, Mulligan RC, Kelley VR: Macrophage growth factors introduced into the kidney initiate renal injury. Mol Med 2: 297–312, 1996[Medline]
  13. Moore KJ, Yeh K, Naito T, Kelley VR: TNF-{alpha} enhances colony-stimulating factor-1 induced macrophage accumulation in autoimmune renal disease. J Immunol 157: 427–432, 1996[Abstract]
  14. Wada T, Shwarting A, Chesnutt MS, Wofsy D, Kelley VR: Nephritogenic cytokines and disease in MRL-Faslpr kidneys are dependent on multiple T-cell subsets. Kidney Int 59: 565–578, 2001[CrossRef][Medline]
  15. Nick JA, Avdi NJ, Young SK, Lehman LA, McDonald PP, Frasch SC, Billstrom MA, Henson PM, Johnson GL, Worthen GS: Selective activation and functional significance of p38 alpha mitogen-activated protein kinase in lipopolysaccharide-stimulated neutrophils. J Clin Invest 103: 851–868, 1999[Medline]
  16. Campell KS: Signal transduction from the B cell antigen-receptor. Curr Opin Immunol 3: 256–264, 1999
  17. Yamamoto N, Sakai F, Yamazaki H, Nakahara K, Okuhara M: Effect of FR167653, a cytokine suppressive agent, on endotoxin-induced disseminated intravascular coagulation. Eur J Phamacol 314: 137–142, 1996[CrossRef][Medline]
  18. Yamamoto N, Sakai F, Yamazaki H, Sato N, Nakahara K, Okuhara M: FR167653, a dual inhibitor of interleukin-1 and tumor necrosis factor-{alpha}, ameliorates endotoxin-induced shock. Eur J Phamacol 327: 169–75, 1997[CrossRef][Medline]
  19. Kobayashi J, Takeyoshi I, Ohwada S, Iwanami K, Matsumoto K, Muramoto M, Morishita Y: The effects of FR167653 in extended liver resection with ischemia in dogs. Hepatology 28: 459–465, 1998[CrossRef][Medline]
  20. Takahashi S, Keto Y, Fujita T, Uchiyama T, Yamamoto A: FR167653, a p38 mitogen-activated protein kinase inhibitor, prevents: Helicobacter pylori-induced gastritis in Mongolian gerbils. J Pharmacol Exp Ther 296: 48–56, 2001[Abstract/Free Full Text]
  21. Wada T, Furuichi K, Sakai N, Iwata Y, Yoshimoto K, Shimizu M, Kobayashi K, Mukaida N, Matushima K, Yokoyama H: A new anti-inflammatory compound, FR167653, ameliorates crescentic glomerulonephritis in Wister-Kyoto rats. J Am Soc Nphrol 11: 1534–1541, 2000[Abstract/Free Full Text]
  22. Wada T, Furuichi K, Sakai N, Hisada Y, Kobayashi K, Mukaida N, Tomosugi N, Matushima K, Yokoyama H: Involvement of p38 mitogen-activated protein kinase followed by chemokine expression in crescentic glomerulonephritis. Am J Kidney Dis 38: 1169–1177, 2001[Medline]
  23. Pertosa G, Grandaliano G, Gesualdo L, Ranieri E, Monno R, Schena FP: Interleukin-6, interleukin-8 and monocyte chemotactic peptide-1 gene expression and protein synthesis are independently modulated by hemodialysis membranes. Kidney int 54: 570–579, 1998[CrossRef][Medline]
  24. Wada T, Yokoyama H, Su SB, Mukaida N, Iwano M, Dohi K, Takahashi Y, Sasaki T, Furuichi K, Segawa C, Hisada Y, Ohta S, Tkasawa K, Kobayashi K: Monitoring urinary levels of monocyte chemoattractant and activating factor reflects disease activity of lupus nephritis. Kidney Int 49: 761–767, 1996[Medline]
  25. Tesch GH, Maifert S, Schwarting A, Rollins BJ, Kelly VR: Monocyte chemoattractant protein-1 dependent leukocytic infiltrations are responsible for autoimmune disease in MRL-Faslpr mice. J Exp Med 190: 1813–24, 1999[Abstract/Free Full Text]
  26. Terada Y, Nakashima O, Inoshita S, Kuwahara M, Sasaki S, Marumo F: Mitogen-activated protein kinase cascade and transcription factors: the opposite role of MKK3/6-p38K and MKK1-MAPK. Nephrol Dial Transplant 14 [Suppl 1]: 45–47, 1999[Free Full Text]
  27. Schneider A, Panzer U, Zahner G, Wenzel U, Wolf G, Thaiss F, Helmchen U, Stahl RAK: Monocyte chemoattractant protein-1 mediates collagen deposition in experimental glomerulonephritis by transforming growth factor-{beta}. Kidney Int 56: 135–144, 1999[CrossRef][Medline]
  28. Wang SN, Lapage J, Hirschberg R: Glomerular ultrafiltration and apical tubular action of IGF-1, TGF-beta, and HGF in nephrotic syndrome. Kidney Int 56: 1247–1251, 1999[CrossRef][Medline]
  29. Bishop GA, Hsing Y Hostiger BS, Jalukar SV, Ramirez LM, Tomai MA: Molecular mechanism of B lymphocyte activation by the immune response modifier R-848. J Immunol 165: 5552–5557, 2000[Abstract/Free Full Text]
  30. Chan OT, Madio MP, Sclomchik MJ: The central and multiple roles of B cells in lupus pathogenesis. Immunol Rev 169: 107–121, 1999[CrossRef][Medline]
  31. Tian, Wei, Zhang Z, Cohen DM: MAPK signaling and the kidney. Am J Phisyol Renal Physiol 279: F593–604, 2000
  32. Bokemeyer D, Gugllelmi KE, McGinty A, Sorokin A, Lianos EA, Dunn MJ: Activation of extracellular signal-regulated kinase in proliferative glomerulonephritis in rats. J Clin Invest 100: 582–588, 1997[Medline]
  33. Wilson KP: The structural basis for the specificity of pyridinil-imidazole inhibitors of p38 MAP kinase. Chem. Biol 4: 423–431, 1997[CrossRef][Medline]
  34. Bardger AM, Griswold DE, Kapadia R, Blake S, Swift BA, Hoffman SJ, Stroup GB, Webb E, Rieman DJ, Gowen M, Boehm JC, Adams JL, Lee JC: Disease-modifying activity of SB 242235, a selective inhibitor of p38 mitogen-activated protein kinase, in rat adjuvant-induced arthritis. Arthritis Rheum 43: 175–183, 2000[CrossRef][Medline]
  35. Kawano T, Ogushi F, Tani K, Endo T, Ohmoto Y, Hayashi Y, Sone S: Comparison of suppressive effects of a new anti-inflammatoru compaund, FR167653, on production of PGE2 and inflammatory cytokines, human monocytes, and alveolar macrophages in response to endotoxin. J Leukoc Biol 65: 80–86, 1999[Abstract]
  36. Tomosoni S, Noris M, Zapela S, Gotti E, Casiraghi F, Bonazzola S, Benigni A, Remmuzzi G: Upregulation of renal systemic cyclooxygenase-2 in patients with active lupus nephritis. J Am Soc Nephrol 9: 1202–1212, 1998[Abstract]
Received for publication March 25, 2002. Accepted for publication August 19, 2002.




This article has been cited by other articles:


Home page
 J. Pharmacol. Exp. Ther.Home page
R. J. Hill, K. Dabbagh, D. Phippard, C. Li, R. T. Suttmann, M. Welch, E. Papp, K. W. Song, K.-c. Chang, D. Leaffer, et al.
Pamapimod, a Novel p38 Mitogen-Activated Protein Kinase Inhibitor: Preclinical Analysis of Efficacy and Selectivity
J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 610 - 619.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
D.-S. Jung, J. J. Li, S.-J. Kwak, S. H. Lee, J. Park, Y. S. Song, T.-H. Yoo, S. H. Han, J. E. Lee, D. K. Kim, et al.
FR167653 inhibits fibronectin expression and apoptosis in diabetic glomeruli and in high-glucose-stimulated mesangial cells
Am J Physiol Renal Physiol, August 1, 2008; 295(2): F595 - F604.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
A. Sheryanna, G. Bhangal, J. McDaid, J. Smith, A. Manning, B. M.J. Foxwell, M. Feldmann, H. T. Cook, C. D. Pusey, and F. W.K. Tam
Inhibition of p38 Mitogen-Activated Protein Kinase Is Effective in the Treatment of Experimental Crescentic Glomerulonephritis and Suppresses Monocyte Chemoattractant Protein-1 but Not IL-1beta or IL-6
J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1167 - 1179.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
K.-i. Watanabe, M. Ma, K.-i. Hirabayashi, N. Gurusamy, P. T. Veeraveedu, P. Prakash, S. Zhang, A. J. Muslin, M. Kodama, and Y. Aizawa
Swimming stress in DN 14-3-3 mice triggers maladaptive cardiac remodeling: role of p38 MAPK
Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1269 - H1277.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
G. Ramesh, S. R. Kimball, L. S. Jefferson, and W. B. Reeves
Endotoxin and cisplatin synergistically stimulate TNF-{alpha} production by renal epithelial cells
Am J Physiol Renal Physiol, February 1, 2007; 292(2): F812 - F819.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
G. Ramesh and W. B. Reeves
p38 MAP kinase inhibition ameliorates cisplatin nephrotoxicity in mice
Am J Physiol Renal Physiol, July 1, 2005; 289(1): F166 - F174.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
C. Stambe, D. J. Nikolic-Paterson, P. A. Hill, J. Dowling, and R. C. Atkins
p38 Mitogen-Activated Protein Kinase Activation and Cell Localization in Human Glomerulonephritis: Correlation with Renal Injury
J. Am. Soc. Nephrol., February 1, 2004; 15(2): 326 - 336.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
R. Ohashi, T. Nakagawa, S. Watanabe, J. Kanellis, R. G. Almirez, G. F. Schreiner, and R. J. Johnson
Inhibition of p38 Mitogen-Activated Protein Kinase Augments Progression of Remnant Kidney Model by Activating the ERK Pathway
Am. J. Pathol., February 1, 2004; 164(2): 477 - 485.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
L. Aoudjit, M. Stanciu, H. Li, S. Lemay, and T. Takano
p38 Mitogen-activated protein kinase protects glomerular epithelial cells from complement-mediated cell injury
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F765 - F774.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwata, Y.
Right arrow Articles by Kobayashi, K.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwata, Y.
Right arrow Articles by Kobayashi, K.-i.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP