Journal of the American Society of Nephrology
2008 JASN IMPACT FACTOR 7.505 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santer, R.
Right arrow Articles by Klaerke, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santer, R.
Right arrow Articles by Klaerke, D.
J Am Soc Nephrol 14:2873-2882, 2003
© 2003 American Society of Nephrology


CLINICAL SCIENCE

Molecular Analysis of the SGLT2 Gene in Patients with Renal Glucosuria

René Santer*,{dagger}, Martina Kinner*,{dagger}, Christoph L. Lassen*, Reinhard Schneppenheim{ddagger}, Paul Eggert*, Martin Bald§, Johannes Brodehl||, Markus Daschner, Jochen H.H. Ehrich||, Markus Kemper{dagger},#, Salvatore Li Volti**, Thomas Neuhaus#, Flemming Skovby{dagger}{dagger}, Peter G.F. Swift{ddagger}{ddagger}, Jürgen Schaub* and Dan Klaerke§§

*Department of Pediatrics, University of Kiel, Kiel, Germany; {dagger}Department of Pediatrics, University of Hamburg, Hamburg, Germany; {ddagger}Department of Pediatric Hematology and Oncology, University of Hamburg, Hamburg, Germany; §Department of Pediatrics, University of Essen, Essen, Germany; ||Department of Pediatrics, Medical School Hannover, Hanover, Germany; Department of Pediatrics, University of Heidelberg, Heidelberg, Germany; #Department of Pediatrics, University of Zurich, Zurich, Switzerland; **Department of Pediatrics, University of Catania, Catania, Italy; {dagger}{dagger}Department of Clinical Genetics, University Hospital of Copenhagen, Copenhagen, Denmark; {ddagger}{ddagger}Department of Pediatrics, University of Leicester, Leicester, United Kingdom; and §§The Panum Institute, University of Copenhagen, Copenhagen, Denmark

Correspondence to Dr. René Santer, Department of Pediatrics, University Children’s Hospital, Martini Strasse 52, D-20246 Hamburg, Germany. Phone: +49-40-42803-3710; Fax: +49-40-42803-5107;


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. The role of SGLT2 (the gene for a renal sodium-dependent glucose transporter) in renal glucosuria was evaluated. Therefore, its genomic sequence and its intron-exon organization were determined, and 23 families with index cases were analyzed for mutations. In 21 families, 21 different SGLT2 mutations were detected. Most of them were private; only a splice mutation was found in 5 families of different ethnic backgrounds, and a 12-bp deletion was found in two German families. Fourteen individuals (including the original patient with ’renal glucosuria type 0') were homozygous or compound heterozygous for an SGLT2 mutation resulting in glucosuria in the range of 14.6 to 202 g/1.73 m2/d (81 - 1120 mmol/1.73 m2/d). Some, but not all, of their heterozygous family members had an increased glucose excretion of up to 4.4 g/1.73 m2/d (24 mmol/1.73 m2/d). Likewise, in index cases with glucosuria below 10 g/1.73 m2/d (55 mmol/1.73 m2/d) an SGLT2 mutation, if present, was always detected in the heterozygous state. We conclude that SGLT2 plays an important role in renal tubular glucose reabsorption. Inheritance of renal glucosuria shows characteristics of a codominant trait with variable penetrance. E-mail: r.santer@uke.uni-hamburg.de


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The molecular bases of three congenital defects of cellular glucose transport, affecting either facilitative ("passive") or sodium-dependent ("active") transport, have been elucidated in recent years (1–3). In addition, a defect of the renal low-affinity sodium/glucose cotransporter SGLT2 gene (also referred to as SLC5A2, [OMIM 182381]) has long been proposed to cause renal glucosuria (OMIM 233100) (4).

Renal glucosuria is a "nondisease"; the great majority of affected individuals do not have any complaints, and only very rarely a propensity to hypovolemia and hypoglycemia has been described. Renal glucosuria is defined by urinary glucose excretion in the presence of a normal blood glucose concentration and the absence of any signs of a general renal tubular dysfunction. Renal glucosuria may vary from few grams to >100 g (556 mmol) per day. Mild glucosuria has been known for decades; it is relatively common and often inherited as an autosomal dominant trait (5). Severe glucosuria is rare, and the first patient with virtual absence of tubular glucose reabsorption, termed renal glucosuria type 0, was not reported until 1987. The pedigree of this patient’s family suggested autosomal recessive inheritance (6).

The purpose of this study was to define the molecular basis of renal glucosuria. Therefore, we first characterized the genomic structure of the human SGLT2 gene, which we reported to GenBank in 2000 (accession no. AF307340). We then performed mutation analysis in patients with isolated, massive glucosuria. It turned out that homozygosity or compound heterozygosity for SGLT2 mutations may account for this condition, which was reported in abstract form in the same year (7). On the basis of these reports, a single patient with glucosuria and homozygosity for an SGLT2 mutation has meanwhile been published (8). Here, we summarize our results of the characterization of the SGLT2 gene and present our data on 23 consecutive families with index patients with renal glucosuria, including the original patient with renal glucosuria type 0.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects
Ninety-three individuals from 23 unrelated families with at least one index patient with renal glucosuria were investigated. In general, urinary glucose concentration had been repeatedly determined by dipstick before it was quantified by the glucose oxidase method in aliquots of 24-h urine collected on a free diet. It ranged from a minimal elevation of <1 g/1.73 m2 per d (5.5 mmol/1.73 m2 per d) to a maximum of 202 g/1.73 m2 per d (1120 mmol/1.73 m2 per d; Table 1; normal range, 0.13 to 0.32 g/1.73 m2 per d [0.72 to 1.8 mmol/1.73 m2 per d] (9)). None of these subjects had any signs of a generalized tubular dysfunction or of any other type of renal disease. The families originated from Germany, Switzerland, England, Italy, former Yugoslavia, Turkey, and Pakistan. Patient 01-1 was originally described by Oemar et al. (6) in 1987 in the first report of an individual with virtually absent renal glucose reabsorption (renal glucosuria type 0). This individual, now 32 yr old, has had entirely normal renal function parameters so far; a detailed follow-up report of this case is currently in preparation.


View this table:
[in this window]
[in a new window]

 
Table 1. Results of glucose excretion studies and mutation analysis in patients with isolated glucosuria and their family members. Index patients with severe glucosuria and SGLT2 mutations on both chromosomes are indicated by boldfacea
 
Molecular Genetic Studies
High molecular genomic DNA was prepared from leukocytes from individuals with renal glucosuria and their parents and siblings and control subjects according to standard protocols (10). Determination of the genomic sequence of human SGLT2 was accomplished by primer walking starting from a previously reported human SGLT2 cDNA (11) with the assumption of similar intron-exon boundaries when compared with the genomic structure of SGLT1, the homologous glucose transporter of intestinal cells (12). The 5'-untranslated region of SGLT2 was determined by a two-step PCR technique using random primers according to the manufacturer’s instructions (Dynal A.S, Nordic, Oslo, Norway). The primer pair (with the annealing temperature given in parentheses) used for the first step was sn 5'-CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNGGCCT-3' and asn (biotin)-5'-GGTTTCTCCTTCAAAGATCCAA-3' (62°C); the one for the second step was sn (biotin)-5'-CAGTTCAAGCTTGTCCAGGAATTC-3' and asn 5'- CCAGCAGCCACCAGCAGCACA -3' (62°C).

For mutation analysis in renal glucosuria families, the entire coding region and adjacent intronic segments were sequenced in as many family members as possible. PCR products including exons 1 to 14 of SGLT2 with flanking intron sequences were generated on the basis of the newly determined intronic sequences. Primer pairs used in this study are given in Table 2. PCR was carried out in a T3 Thermocycler (Biometra, Göttingen, Germany) with reagents and Taq polymerase (Invitrogen, Karlsruhe, Germany). Double-stranded PCR products were analyzed by nondenaturing PAGE combined with silver and ethidium bromide staining, respectively. Purified samples were then analyzed by direct cycle sequencing of double-stranded DNA according to the protocol for 33P-labeled terminators provided with the Thermo Sequenase cycle sequencing kit (Amersham Buchler, Freiburg, Germany). When necessary, sequencing was performed after cloning the respective PCR product into a phagemid vector according to the PCR Script Amp Cloning kit (Stratagene, Heidelberg, Germany). All detected mutations were confirmed by restriction enzyme digest (in some cases, after the use of a mismatch primer) and/or detection of heteroduplex formation on a polyacrylamide gel. Nucleotides of the human SGLT2 cDNA are numbered from 1 to 2019 for the first bp of the ATG initiation codon and the last bp of the TAA stop codon; amino acids are numbered from 1 to 672 for methionine and alanine, respectively.


View this table:
[in this window]
[in a new window]

 
Table 2. Oligonucleotide sequencesa
 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genomic Organization of the Human SGLT2 Gene
As a first result, our studies confirmed that the human SGLT2 coding sequence consists of 2019 bp predicting a 672–amino acid protein. This human renal glucose carrier shows 58% amino acid identity on Clustal W multiple sequence alignment (clustalw.genome.ad.jp) with the SGLT1 protein and the degree of homology is even higher in central domains of the polypeptide. Analysis of the genomic structure of human SGLT2 revealed an 8.0-kb gene with an intron-exon organization that also shows high similarity to SGLT1 (Figure 1). The coding sequence of SGLT2, however, is interrupted by only 13 introns that, with one exception, are located at homologous positions in SGLT1. Intron sizes in general are remarkably smaller in SGLT2 and at the position of intron 4 of SGLT1, an intron is absent in SGLT2. All 13 introns of SGLT2 show the consensus sequence ag...gt. A highly polymorphic marker that has not previously been described in the literature with a variable number of CA repeats is present in intron 1 of SGLT2.



View larger version (19K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Comparison of the genomic structure of SGLT1 and SGLT2. Exons are presented as boxes and are drawn to scale. Numbers give the different intron sizes.

 
Mutation Analysis in Patients with Renal Glucosuria
The degree of urinary glucose excretion and the results of SGLT2 mutation analysis for individual family members who participated in this study are presented in Table 1. With the exception of two families (14 and 19), SGLT2 mutations were detected in all families investigated. The 14 individuals who were found to be carriers of two mutated alleles (boldface in Table 1) showed "severe" glucosuria, here defined by a cutoff of urinary glucose of >10 g/1.73 m2 per d (55 mmol/1.73 m2 per d). Among them is the patient in whom glucosuria type 0 was originally described. He was found to be homozygous for a 5-bp deletion within exon 8 of the SGLT2 gene (Figure 2).



View larger version (52K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Detection of an SGLT2 mutation in family 01. (A) DNA sequence in the region of codon 324. The patient shows a homozygous 5-bp deletion (c.973-7 del ATGTT) causing a frameshift and the introduction of a premature stop codon at position 347. In both parents, a complex banding pattern starts at the position of the deletion, which is due to sequencing of both the wild-type (wt) and the deletion allele (mut) in a heterozygous carrier. (B) Confirmation of the c.973-7 del ATGTT mutation by Mnl I digestion. Both the wild-type (218 bp) and the mutated (213 bp) PCR product of exon 8 carry an Mnl I restriction site that results in the cleavage of 23 bp and predicts the generation of digestion products of 195 and 190 bp, respectively. As a result of the 5-bp deletion, however, an additional Mnl I site is introduced into the 190-bp fragment, which results in the formation of two 95-bp fragments. bpl, bp ladder.

 
As expected, family members of these cases of severe glucosuria were shown to be heterozygous carriers of SGLT2 mutations. Investigations for glucose excretion showed that some but not all of them had glucosuria in a range of up to 4.4 g/1.73 m2 per d (24 mmol/1.73 m2 per d). Likewise, index patients who presented with "mild" renal glucosuria (here defined by a glucose excretion <10 g/1.73 m2 per d [55 mmol/1.73 m2 per d]), all were heterozygous for an SGLT2 mutation, if detected.

The study detected a total of 21 different SGLT2 mutations, which are summarized in Table 3. Nonsense mutations, missense mutations, and small deletions were scattered over the SGLT2 coding sequence. Most of them were confined to a single pedigree. Only the {Delta}385–8 mutation was found in two unrelated German patients, and five individuals who originated from Pakistan, former Yugoslavia, Italy, and Switzerland carried the same intron 7 donor splice site mutation.


View this table:
[in this window]
[in a new window]

 
Table 3. Twenty-one different SGLT2 mutations detected in 23 families with renal glucosuria
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The studies reported here led to the description of SGLT2 mutations in patients with isolated renal glucosuria (7). As a first step, we characterized the human SGLT2 gene at the genomic level. We assumed that SGLT2, which has previously been reported to be located in the chromosomal region 16 p11.2 (13), not only has a high sequence similarity to the best characterized member of the SGLT family, human SGLT1, but also shows a high degree of similarity regarding its structural organization. We could demonstrate that most of the SGLT1 intron-exon boundaries are located at corresponding positions in SGLT2 (Figure 1). On the basis of these results and a primer walking technique, it was easy to determine the genomic sequence of SGLT2, which we reported to GenBank in 2000 (accession no. AF307340).

One difference between SGLT1 and SGLT2 is noteworthy: The absence of an intron at the position of intron 4 in SGLT1. This is an interesting finding in regard to the structural organization of two novel members of the SGLT family that have recently been reported. In one of them, SGLT3, the gene for another renal low-affinity glucose transporter with 659 amino acids that, like SGLT1, is located on chromosome 22 and probably is the product of an ancient gene duplication; this intron is present (14,15). In contrast, in SGLT4, a novel member that predicts a protein of 674 amino acids and that has been detected during systematic sequencing of the chromosomal region 1p32.1 to 33, an intron is missing at this position (15,16). Thus, both SGLT2 and SGLT4 have only 14 exons and 13 introns with a very similar intron-exon structure, and, possibly, SGLT2 is more closely related to this gene than to SGLT1. Not surprising, SGLT1 and SGLT3 have the highest alignment score (69%); for comparison, the score for SGLT2 is 53% when aligned to SGLT4 and 58% when aligned to SGLT1. SGLT1 and SGLT3 have the same sodium-to-sugar stoichiometry (2:1) (17), whereas there is a hint that sodium-glucose coupling in SGLT2 is 1:1 (4,11,18). It will be interesting to know these and other transport properties for SGLT4.

With the knowledge of the genomic structure and sequence of human SGLT2, we were able to screen patients with isolated renal glucosuria for SGLT2 mutations. That we detected SGLT2 mutations in 21 of 23 consecutively investigated families clearly shows the importance of the SGLT2 protein in renal tubular glucose reabsorption. After some ambiguity about the identity of the major renal sodium-glucose co-transporter, our results are in line with the accepted dogma that the bulk of filtered glucose is reabsorbed in segments S1 and S2 of the proximal convoluted tube by the low-affinity, high-capacity carrier SGLT2 (15). They further demonstrate that other sodium-dependent transporters cannot be upregulated to compensate for a nonfunctional SGLT2 protein.

All cases with SGLT2 mutations on both chromosomes showed "severe" glucosuria; none of these individuals had a glucose excretion <10 g/1.73 m2 per d (55 mmol/1.73 m2 per d). The well-documented case of glucosuria type 0 (patient 01-1 in Table 1 (6)) with a daily glucose excretion in excess of 100 g/1.73 m2 per d demonstrates that a truncating mutation on both chromosomes may result in virtual absence of glucose reabsorption. If transferred to the brush border membrane at all, then the protein predicted by this mutation would have only the seven N-terminally located transmembranous domains, whereas domains 8 to 14 would be missing. Such a mutation has been shown to result in a nonfunctional glucose transporter because it lacks the transmembranous domains 10 to 13 that have been demonstrated to be essential for sugar binding and sugar translocation (15,19,20). It is interesting, however, that one patient (patient 06-1) homozygous for a truncating mutation showed a considerably lower glucose excretion, suggesting some glucose reabsorption by an unknown alternative mechanism.

Cases of "severe" glucosuria show the characteristics of autosomal recessive inheritance. The parents were consanguineous in a significant proportion of the families (seven of 12), suggesting that SGLT2 mutations are rare in the populations from which our cases originated. Some of these cases had homozygous or compound heterozygous mutations that might have resulted in some residual activity of the transporter: patients with two mutated alleles and glucosuria in the range of 10 to 50 g/1.73 m2 per d (55 to 280 mmol/1.73 m2 per d) carried at least one mutation that could explain some residual activity (Table 1), i.e., these patients carried at least one missense or a splice site mutation. An example is the relatively common SGLT2 IVS7 +5 g>a mutation, a donor splice site mutation that was found to be associated with some residual glucose reabsorption and comparably low glucose excretion. It is well known that this type of mutation results in both abnormally and normally spliced mRNA with the effect of a decreased amount of the gene product with normal kinetic properties (21–23).

Among the patients with "mild" glucosuria, here defined by a glucose excretion <10 g/1.73 m2 per d (55 mmol/1.73 m2 per d), SGLT2 mutations, if present at all, were found in the heterozygous state. However, not in all individuals heterozygous for a specific mutation was an increased glucose excretion observed, and even among family members with identical SGLT2 mutations, only some had mild glucosuria. This suggests that other genetic or nongenetic factors have to be present before heterozygosity for an SGLT2 mutation results in mild glucosuria. Therefore, inheritance of renal glucosuria can best be described to follow a codominant trait with variable penetrance.

These results of our molecular genetic study are in accordance with earlier clinical observations. Before quantification of glucose excretion in urine became a clinical routine, renal glucosuria was generally considered to follow a dominant trait (5). Further studies have shown that mild glucosuria is relatively frequent and that cases of "heavy glucosuria" are extremely rare (9,24). Furthermore, it has already been reported that parents of patients with severe glucosuria may or may not show an abnormality of renal glucose transport (9).

Our results also provide an explanation for titration studies performed in the 1950s defining the classical types of renal glucosuria (25,26). A diminished amount of the normal SGLT2 protein should result in type A glucosuria, characterized by a lowered renal transport maximum for glucose (TmG). However, patients with certain SGLT2 missense mutations resulting in a diminished affinity of the transporter for its substrate may belong to type B for which a normal TmG and an exaggerated splay is characteristic. TmG and renal threshold for glucose will have to be determined for patients characterized at the molecular genetic level to determine whether these assumptions are correct. Compound heterozygosity for SGLT2 mutations, however, is probably the reason that many cases of severe glucosuria could not be clearly classified into type A or B in the past and that a broad spectrum of impairment of tubular glucose transport has been found in such patients (27).

Heterozygosity for an SGLT2 mutation can result in mild glucosuria, and both nonsense and missense mutations may have this effect. It is interesting that this is in contrast to recent observations in individuals heterozygous for a mutation of GLUT2, the gene of the basolateral glucose carrier of tubular cells. Whereas GLUT2 missense mutations were associated with mild glucosuria, nonsense mutations were reported not to result in an increased glucose excretion (28). This was explained by a dominant negative effect of the missense mutation on the GLUT2 hexamer. Such an effect might not play a role in sodium-dependent transporters because freeze-fracture electron microscopic studies have suggested that they function as monomers (29).

The 21 SGLT2 mutations detected during the course of this study are summarized in Table 3. All of the nonsense and frameshift mutations predict proteins that lack the previously mentioned transmembranous domains 10 to 13 essential for sugar binding and sugar transport of SGLT proteins. Many of the missense mutations (T51P, R137H, G272R, K311R, and R499C) affect residues that are highly conserved across the human SGLT family and across SGLT of other species (Mus musculus [mouse], Rattus norvegicus [rat], Oryctolagus cuniculus [rabbit]), which underlines their pathogenic role. Other missense mutations (G449D and F453L) lie in very close vicinity to Q457, the residue interacting with O1 and O5 of the pyranose in SGLT1 (30). SGLT2 mutations seem to be randomly distributed along the coding sequence of the gene, but, interestingly, no SGLT2 mutation was detected in regions 289 to 304 and 369 to 405,1 considered to be mutational hot spots in SGLT1 (31). The only locations where naturally occurring mutations have been observed both in SGLT1 and SGLT2 are R137 and R499.2 A patient with glucose-galactose malabsorption and compound heterozygosity for SGLT1 R499H (together with R379X) was severely affected clinically, and the functional expression of this mutant in oocytes has been shown to result in a significant decrease of sugar affinity and trafficking to the membrane. It has been reported, however, that replacing this residue by cysteine restored trafficking and resulted in a functional sugar transporter (32). This stands in contradiction to our observation of an individual with compound heterozygosity for SGLT2 R499C (together with Y150H) and significant renal glucosuria, which cannot be solely explained by the other mutated allele (see patients 20-1 and 20-3, Table 1).

How SGLT2 missense mutations result in an impairment of glucose transport is still unclear. However, as a result of the great sequence and structure homology of SGLT, it is tempting to suppose that disturbed trafficking shown to play a major role for SGLT1 mutations also is an important factor in SGLT2 (31). Unequivocally, it is a drawback of our study that we were not able to express SGLT2 mutants in heterologous expression systems to investigate the effect of mutations in comparison with the wild-type glucose carrier. Although we spent particular efforts in expression studies both in Xenopus laevis oocytes and in isolated vesicles, techniques that have worked perfectly in our hands when expressing SGLT1 and other transporters (33,34), we were not successful expressing SGLT2 (data not shown). However, it has previously been noticed that human SGLT2, unlike SGLT1 and SGLT3, expresses very poorly in oocytes and COS-7 cells (15,35). The sodium-dependent uptake of sugar and the sodium-sugar currents in SGLT2 oocytes were, at most, 3.5 times greater than those in controls (4), whereas expression of SGLT1 or SGLT3 in oocytes resulted in sugar fluxes and currents up to 2000 times greater than controls. Whether additional posttranslational modification is required before SGLT2 expresses in oocytes is uncertain. An important role of protein kinases for sodium-glucose co-transporters has been demonstrated for SGLT1, and it has been suggested that despite that SGLT show high sequence homology, minor differences in amino acid sequence may dramatically change the regulation of trafficking by protein kinases (36). The ultimate reason for poor expression of SGLT2 in heterologous systems, however, has remained unclear.

Two of our index patients with renal glucosuria (patients 14-1 and 19-1 in Table 1) did not have any detectable SGLT2 mutation, and in one of the cases with relatively severe glucosuria, we would have expected to find a second SGLT2 mutation (patient 07-1). This can of course be the result of technical problems. Some SGLT2 mutations may not be detectable with the PCR-based technique applied in this study, and SGLT2 mutations outside the coding region, e.g., within the promotor region, would have escaped our analysis. In that context, it is interesting that the transcription of mouse SGLT2 is regulated by hepatic nuclear factor (HNF)-1{alpha} (37), and, at least for human SGLT1, the binding domain for this transcription factor has recently been characterized (38). Only limited information on transcriptional regulation is available for human SGLT2.

Despite the important role of SGLT2, other genes may be involved in renal glucose transport to varying degrees and may be mutated in patients with renal glucosuria. Intestinal glucose-galactose malabsorption, a congenital defect of SGLT1, is well known to be accompanied by glucosuria, but there were no intestinal symptoms in our patients. Other members of the SGLT family (SGLT3, SGLT4, and SMIT2), however, are candidates that should be investigated. Furthermore, a defect of HNF-1{alpha}, known to cause maturity-onset diabetes in the young type 3, has been reported to be accompanied by a diminished renal threshold for glucose. Such a defect is unlikely in our patients because other signs of maturity-onset diabetes in the young were absent. The possibility of a heterozygous GLUT2 missense mutation has been discussed above; therefore, we will have to investigate glucosuria patients for GLUT2 mutations even though we have not observed glucosuria in patients heterozygous for a GLUT2 missense mutation (unpublished data). Finally, mutations in other genes, such as a hypothetical locus termed GLYS1 detected by linkage studies on chromosome 6 (39), cannot be ruled out. However, because both of our index patients without an SGLT2 mutation showed only mild to moderate glucosuria, this does not challenge the major result of our study. The detection of SGLT2 mutations in all patients with severe renal glucosuria and that virtual absence of glucose reabsorption in some of the patients was associated with a mutation predicting a nonfunctioning SGLT2 protein are evidence that SGLT2 plays a very important role in renal tubular glucose transport.


    Acknowledgments
 
We thank S. Haas (Heidelberg, Germany), J. Holm (Copenhagen, Denmark), G. LiVolti (Catania, Italy), A. Löchelt-Göksu (Ludwigs- hafen, Germany), S. Bianca (Catania, Italy), and S. Scholl (Hannover, Germany) for efforts to provide blood and urine samples of the patients. R. Siebert (Kiel, Germany) is kindly acknowledged for help with multiple sequence alignment of SGLT by the Clustal W (1.82) method.


    Footnotes
 
M.B.’s current affiliation is Olgahospital, Stuttgart, Germany.

1Note that from SGLT2 C255 to S605, numbering is identical for corresponding codons in SGLT1 and SGLT2. Back

2Homozygosity for SGLT1 R140Q (corresponding to R137 in SGLT2) has recently been found in an unpublished case of glucose-galactose malabsorption in our laboratory. Back


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Turk E, Zabel B, Mundlos S, Dyer J, Wright EM: Glucose/galactose malabsorption caused by a defect in the Na+/glucose cotransporter. Nature 350: 354–356, 1991[CrossRef][Medline]
  2. Santer R, Schneppenheim R, Dombrowski A, Götze H, Steinmann B, Schaub J: Mutations in GLUT2, the gene for the liver-type glucose transporter, in patients with Fanconi-Bickel syndrome. Nat Genet 17: 324–326, 1997[CrossRef][Medline]
  3. Seidner G, Alvarez MG, Yeh JI, O’Driscoll KR, Klepper J, Stump TS, Wang D, Spinner NB, Birnbaum MJ, De Vivo DC: GLUT-1 deficiency syndrome caused by haploinsufficiency of the blood-brain barrier hexose carrier. Nat Genet 18: 188–191, 1998[CrossRef][Medline]
  4. Kanai Y, Lee WS, You G, Brown D, Hediger MA: The human kidney low affinity Na+/glucose cotransporter SGLT2. Delineation of the major renal reabsorptive mechanism for D-glucose. J Clin Invest 93: 397–404, 1994
  5. Hjärne U: Study of orthoglycaemic glycosuria with particular reference to its hereditability. Acta Med Scand 67: 422–571, 1927
  6. Oemar BS, Byrd DJ, Brodehl J: Complete absence of tubular glucose reabsorption: A new type of renal glucosuria (type 0). Clin Nephrol 27: 156–160, 1987[Medline]
  7. Santer R, Kinner M, Schneppenheim R, Hillebrand G, Kemper M, Ehrich J, Swift P, Skovby F, Schaub J: The molecular basis of renal glucosuria: Mutations in the gene for a renal glucose transporter (SGLT2) [Abstract]. J Inherit Metab Dis 23 [Suppl 1]: 178, 2000
  8. van den Heuvel LP, Assink K, Willemsen M, Monnens L: Autosomal recessive renal glucosuria attributable to a mutation in the sodium glucose cotransporter (SGLT2). Hum Genet 111: 544–547, 2002[CrossRef][Medline]
  9. Elsas LJ, Rosenberg LE: Familial renal glycosuria: A genetic reappraisal of hexose transport by kidney and intestine. J Clin Invest 48: 1845–1854, 1969
  10. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989
  11. Wells RG, Pajor AM, Kanai Y, Turk E, Wright EM, Hediger MA: Cloning of a human kidney cDNA with similarity to the sodium-glucose cotransporter. Am J Physiol 263: F459–465, 1992
  12. Turk E, Martin MG, Wright EM: Structure of the human Na+/glucose cotransporter gene. J Biol Chem 269: 15204–15209, 1994[Abstract/Free Full Text]
  13. Wells RG, Mohandas TK, Hediger, MA: Localization of the Na+/glucose cotransporter gene SGLT2 to human chromosome 16 close to the centromere. Genomics 17: 787–789, 1993[CrossRef][Medline]
  14. Dunham I, Shimizu N, Roe BA, Chissoe S, Hunt AR, Collins JE, Bruskiewich R, Beare DM, Clamp M, Smink LJ, Ainscough R, Almeida JP, Babbage A, Bagguley C, Bailey J, Barlow K, Bates KN, Beasley O, Bird CP, Blakey S, Bridgeman AM, Buck D, Burgess J, Burrill WD, O’Brien KP, et al: The DNA sequence of human chromosome 22. Nature 402: 489–495, 1999[CrossRef][Medline]
  15. Wright EM: Renal Na(+)-glucose cotransporters. Am J Physiol Renal Physiol 280: F10–F18, 2001[Abstract/Free Full Text]
  16. Coville G, for the Sanger Centre Chromosome 1 Mapping Group: www.ncbi.n/m.nih.gov, accession CAC00574, gene dJ1024N4, GenBank accession AL109659
  17. Diez-Sampedro A, Eskandari S, Wright EM, Hirayama BA: Na+-to-sugar stoichiometry of SGLT3. Am J Physiol Renal Physiol 280: F278–F282, 2001[Abstract/Free Full Text]
  18. You G, Lee WS, Barros EJ, Kanai Y, Huo TL, Khawaja S, Wells RG, Nigam SK, Hediger MA: Molecular characteristics of Na(+)-coupled glucose transporters in adult and embryonic rat kidney. J Biol Chem 270: 29365–25371, 1995[Abstract/Free Full Text]
  19. Panayotova-Heiermann M, Loo DD, Kong CT, Lever JE, Wright EM: Sugar binding to Na+/glucose cotransporters is determined by the carboxyl-terminal half of the protein. J Biol Chem 271: 10029–10034, 1996[Abstract/Free Full Text]
  20. Panayotova-Heiermann M, Eskandari S, Turk E, Zampighi GA, Wright EM: Five transmembrane helices form the sugar pathway through the Na+/glucose cotransporter. J Biol Chem 272: 20324–20327, 1997[Abstract/Free Full Text]
  21. Shapiro MB, Senapathy P: RNA splice junctions of different classes of eukaryotes: Sequence statistics and functional implications in gene expression. Nucleic Acids Res 15: 7155–7174, 1987[Abstract/Free Full Text]
  22. Highsmith WE, Burch LH, Zhou Z, Olsen JC, Strong TV, Smith T, Friedman KJ, Silverman LM, Boucher RC, Collins FS, Knowles MR: Identification of a splice site mutation (2789 +5 G>A) associated with small amounts of normal CFTR mRNA and mild cystic fibrosis. Hum Mutat 9: 332–338, 1997[CrossRef][Medline]
  23. Sakamoto O, Suzuki Y, Li X, Aoki Y, Hiratsuka M, Holme E, Kudoh J, Shimizu N, Narisawa K: Diagnosis and molecular analysis of an atypical case of holocarboxylase synthetase deficiency. Eur J Pediatr 159: 18–22, 2000[CrossRef][Medline]
  24. Khachadurian AK, Khachadurian LA: The inheritance of renal glycosuria. Am J Hum Genet 16: 189–194, 1964[Medline]
  25. Bradley SE, Bradley GP, Tyson CJ, Curry JJ, Blake WD: Renal function in renal disease. Am J Med 9: 766–798, 1950
  26. Reubi F: Glucose titration in renal glucosuria. In The Kidney, a Ciba Foundation Symposium. London, Churchill, 1954
  27. Brodehl J, Oemar BS, Hoyer PF: Renal glucosuria. Pediatr Nephrol 1: 502–508, 1987[CrossRef][Medline]
  28. Sakamoto O, Ogawa E, Ohura T, Igarashi Y, Matsubara Y, Narisawa K, Iinuma K: Mutation analysis of the GLUT2 gene in patients with Fanconi-Bickel syndrome. Pediatr Res 48: 586–589, 2000[Medline]
  29. Eskandari S, Wright EM, Kreman M, Starace DM, Zampighi G: A structural analysis of cloned plasma membrane proteins by freeze-fracture electron microscopy. Proc Natl Acad Sci U S A 95: 11235–11240, 1998[Abstract/Free Full Text]
  30. Diez-Sampedro A, Wright EM, Hirayama BA: Residue 457 controls sugar binding and transport in the Na(+)/glucose cotransporter. J Biol Chem 276: 49188–49194, 2001[Abstract/Free Full Text]
  31. Martin MG, Turk E, Lostao MP, Kerner C, Wright EM: Defects in Na+/glucose cotransporter (SGLT1) trafficking and function cause glucose-galactose malabsorption. Nat Genet 12: 216–220, 1996[CrossRef][Medline]
  32. Wright EM: Genetic disorders of membrane transport. I. Glucose galactose malabsorption. Am J Physiol 275: G879–G882, 1998
  33. Grunnet M, Jensen BS, Olesen SP, Klaerke DA: Apamin interacts with all subtypes of cloned small-conductance Ca2+-activated K+ channels. Pflugers Arch 441: 544–550, 2001[CrossRef][Medline]
  34. Zeuthen T, Zeuthen E, Klaerke DA: Mobility of ions, sugar, and water in the cytoplasm of Xenopus oocytes expressing Na(+)-coupled sugar transporters (SGLT1). J Physiol 542: 71–87, 2002[Abstract/Free Full Text]
  35. Ikari A, Suketa Y: Expression of GFP-tagged low affinity Na+-dependent glucose transporter in Xenopus oocytes and CHO cells. Jpn J Physiol 52: 395–398, 2002[CrossRef][Medline]
  36. Hirsch JR, Loo DDF, Wright EM: Regulation of Na+/glucose cotransporter expression by protein kinases in Xenopus laevis oocytes. J Biol Chem 271: 14740–14746, 1996[Abstract/Free Full Text]
  37. Pontoglio M, Prie D, Cheret C, Doyen A, Leroy C, Froguel P, Velho G, Yaniv M, Friedlander G: HNF1{alpha} controls renal glucose reabsorption in mouse and man. EMBO Rep 1: 359–365, 2000[CrossRef][Medline]
  38. Martin MG, Wang J, Solorzano-Vargas RS, Lam JT, Turk E, Wright EM: Regulation of the human Na(+)-glucose cotransporter gene SGLT 1 by HNF-1 and Sp1. Am J Physiol Gastrointest Liver Physiol 278: G591–G603, 2000[Abstract/Free Full Text]
  39. De Marchi S, Cecchin E, Basile A, Proto G, Donadon W, Jengo A, Schinella D, Jus A, Villalta D, De Paoli P, Santini G, Tesio F: Close genetic linkage between HLA and renal glycosuria. Am J Nephrol 4: 280–286, 1984[Medline]
  40. Turk E, Wright EM: Membrane topology motifs in the SGLT cotransporter family. J Membr Biol 159: 1–20, 1997[CrossRef][Medline]
  41. Wright EM, Loo DD, Panayotova-Heiermann M, Hirayama BA, Turk E, Eskandari S, Lam JT: Structure and function of the Na+/glucose cotransporter. Acta Physiol Scand Suppl 643: 257–264, 1998[Medline]
Received for publication June 17, 2003. Accepted for publication July 24, 2003.




This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
S. Nair and J. P. H. Wilding
Sodium Glucose Cotransporter 2 Inhibitors as a New Treatment for Diabetes Mellitus
J. Clin. Endocrinol. Metab., January 1, 2010; 95(1): 34 - 42.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
R. Santer and J. Calado
Familial Renal Glucosuria and SGLT2: From a Mendelian Trait to a Therapeutic Target
Clin. J. Am. Soc. Nephrol., January 1, 2010; 5(1): 133 - 141.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
J. F. List, V. Woo, E. Morales, W. Tang, and F. T. Fiedorek
Sodium-Glucose Cotransport Inhibition With Dapagliflozin in Type 2 Diabetes
Diabetes Care, April 1, 2009; 32(4): 650 - 657.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Calado, Y. Sznajer, D. Metzger, A. Rita, M. C. Hogan, A. Kattamis, M. Scharf, V. Tasic, J. Greil, F. Brinkert, et al.
Twenty-one additional cases of familial renal glucosuria: absence of genetic heterogeneity, high prevalence of private mutations and further evidence of volume depletion
Nephrol. Dial. Transplant., December 1, 2008; 23(12): 3874 - 3879.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Fujimori, K. Katsuno, I. Nakashima, Y. Ishikawa-Takemura, H. Fujikura, and M. Isaji
Remogliflozin Etabonate, in a Novel Category of Selective Low-Affinity Sodium Glucose Cotransporter (SGLT2) Inhibitors, Exhibits Antidiabetic Efficacy in Rodent Models
J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 268 - 276.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Han, D. L. Hagan, J. R. Taylor, L. Xin, W. Meng, S. A. Biller, J. R. Wetterau, W. N. Washburn, and J. M. Whaley
Dapagliflozin, a Selective SGLT2 Inhibitor, Improves Glucose Homeostasis in Normal and Diabetic Rats
Diabetes, June 1, 2008; 57(6): 1723 - 1729.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. M. Pajor, K. M. Randolph, S. A. Kerner, and C. D. Smith
Inhibitor Binding in the Human Renal Low- and High-Affinity Na+/Glucose Cotransporters
J. Pharmacol. Exp. Ther., March 1, 2008; 324(3): 985 - 991.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. S. Freitas, G. F. Anhe, K. F. S. Melo, M. M. Okamoto, M. Oliveira-Souza, S. Bordin, and U. F. Machado
Na+-Glucose Transporter-2 Messenger Ribonucleic Acid Expression in Kidney of Diabetic Rats Correlates with Glycemic Levels: Involvement of Hepatocyte Nuclear Factor-1{alpha} Expression and Activity
Endocrinology, February 1, 2008; 149(2): 717 - 724.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
E. M. Wright, D. D. F. Loo, B. A. Hirayama, and E. Turk
Surprising Versatility of Na+-Glucose Cotransporters: SLC5
Physiology, December 1, 2004; 19(6): 370 - 376.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Francis, J. Zhang, A. Farhi, H. Carey, and D. S. Geller
A novel SGLT2 mutation in a patient with autosomal recessive renal glucosuria
Nephrol. Dial. Transplant., November 1, 2004; 19(11): 2893 - 2895.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
S. Scholl-Burgi, R. Santer, and J. H. H. Ehrich
Long-term outcome of renal glucosuria type 0: the original patient and his natural history
Nephrol. Dial. Transplant., September 1, 2004; 19(9): 2394 - 2396.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
A. Sarkissian, R. Santer, B. Steinmann, G. Amaryan, and E. Leumann
The boy with massive glucosuria
Nephrol. Dial. Transplant., May 1, 2004; 19(5): 1319 - 1320.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santer, R.
Right arrow Articles by Klaerke, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santer, R.
Right arrow Articles by Klaerke, D.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP