2007 JASN IMPACT FACTOR 7.111	HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP
advanced	CURRENT ISSUE	ARCHIVES	JASN Express	ONLINE SUBMISSION

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Stehberger, P. A. Articles by Wagner, C. A. Search for Related Content PubMed PubMed Citation Articles by Stehberger, P. A. Articles by Wagner, C. A.

Localization and Regulation of the ATP6V0A4 (a4) Vacuolar H⁺-ATPase Subunit Defective in an Inherited Form of Distal Renal Tubular Acidosis

Paul A. Stehberger^*, Nicole Schulz, Karin E. Finberg, Fiona E. Karet^||, Gerhard Giebisch^*, Richard P. Lifton, John P. Geibel^*, and Carsten A. Wagner^*,

Departments of *Cellular and Molecular Physiology, Genetics, and Surgery, Yale University School of Medicine, New Haven, Connecticut; Institute of Physiology, University of Zurich, Zurich, Switzerland; and ^||Department of Medical Genetics, Cambridge Institute for Medical Research and Division of Nephrology, Cambridge University, Cambridge, United Kingdom

Correspondence to Dr. Carsten A. Wagner, Institute of Physiology, University of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland. Phone: +41-1-6355032; Fax: +41-1-635814; E-mail: wagnerca{at}access.unizh.ch

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
ABSTRACT. Vacuolar-type H⁺-ATPases (V-H⁺-ATPases) are the major H⁺-secreting protein in the distal portion of the nephron and are involved in net H⁺ secretion (bicarbonate generation) or H⁺ reabsorption (net bicarbonate secretion). In addition, V-H⁺-ATPases are involved in HCO₃^- reabsorption in the proximal tubule and distal tubule. V-H⁺-ATPases consist of at least 13 subunits, the functions of which have not all been elucidated. Mutations in the accessory ATP6V0A4 (a4 isoform) subunit have recently been shown to cause an inherited form of distal renal tubular acidosis in humans. Here, the localization of this subunit in human and mouse kidney was studied and the regulation of expression and localization of this subunit in mouse kidney in response to acid-base and electrolyte intake was investigated. Reverse transcription-PCR on dissected mouse nephron segments amplified a4-specific transcripts in proximal tubule, loop of Henle, distal convoluted tubule, and cortical and medullary collecting duct. a4 protein was localized by immunohistochemistry to the apical compartment of the proximal tubule (S1/S2 segment), the loop of Henle, the intercalated cells of the distal convoluted tubule, the connecting segment, and all intercalated cells of the entire collecting duct in human and mouse kidney. All types of intercalated cells expressed a4. NH₄Cl or NaHCO₃ loading for 24 h, 48 h, or 7 d as well as K⁺ depletion for 7 and 14 d had no influence on a4 protein expression levels in either cortex or medulla as determined by Western blotting. Immunohistochemistry, however, demonstrated a subcellular redistribution of a4 in response to the different stimuli. NH₄Cl and K⁺ depletion led to a pronounced apical staining in the connecting segment, cortical collecting duct, and outer medullary collecting duct, whereas NaHCO₃ loading caused a stronger bipolar staining in the cortical collecting duct. Taken together, these results demonstrate a4 expression in the proximal tubule, loop of Henle, distal tubule, and collecting duct and suggest that under conditions in which increased V-H⁺-ATPase activity is required, a4 is regulated by trafficking but not protein expression. This may allow for the rapid adaptation of V-H⁺-ATPase activity to altered acid-base intake to achieve systemic pH homeostasis. The significance of a4 expression in the proximal tubule in the context of distal renal tubular acidosis will require further clarification.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The kidneys play a major role in the regulation and maintenance of body acid-base homeostasis. This is achieved by two mechanisms, the reabsorption of filtered bicarbonate in the proximal segments and the additional secretion of acid or base equivalents in the distal segments (1). All processes require the function of a V-type (vacuolar) H⁺-ATPase expressed in the plasma membrane (1,2). Approximately 70 to 80% of the total filtered bicarbonate is reabsorbed in the proximal tubule, an additional 15% is reabsorbed along the thick ascending loop (TAL) of Henle and the distal tubule, and only 5% is reabsorbed in the connecting segment (CNT) and cortical collecting duct (CCD) (1). In the proximal tubule, protons are secreted across the apical brush border membrane into urine, where they react with HCO₃^- to form CO₂, which then diffuses into the cells, is hydrated, and regenerates H⁺ and HCO₃^-. HCO₃^- is released into blood, whereas the H⁺ reenters the cycle across the apical membrane. The majority of H⁺ in the proximal tubule is secreted by several Na⁺/H⁺ exchanger isoforms, including NHE-3 (1). However, it has also been demonstrated that approximately 40% of the overall bicarbonate reabsorption in the proximal tubule is independent of lumenal Na⁺ and thus may reflect H⁺-ATPase-mediated H⁺ secretion (3). Reabsorption of bicarbonate in the TAL is also thought to depend on both Na⁺/H⁺ exchange and V-type H⁺-ATPase activity (4,5). In the CNT and collecting duct, bicarbonate reabsorption is driven and mediated mainly by the V-type H⁺-ATPase expressed in type A intercalated cells. V-type H⁺-ATPases also play an important role in the secretion of bicarbonate/base equivalents by type B intercalated cells of the CCD. There, V-H⁺-ATPases are expressed at the basolateral surface and mediate H⁺ secretion into blood; this H⁺ arises from the intracellular generation of HCO₃^-, which is released into urine through Cl^-/HCO₃^- exchange across the apical membrane. In addition, an H⁺/K⁺-ATPase is found in the collecting duct and may contribute to H⁺ excretion under certain circumstances, such as dietary K⁺ depletion (6).

The significance of V-H⁺-ATPases in renal H⁺ secretion is highlighted by two forms of inherited distal renal tubular acidosis (dRTA) (7,8). Mutations in the ATP6V1B1 gene cause dRTA combined with sensorineural deafness as a result of expression of the B1 V-H⁺-ATPase subunit in the intercalated cells of the collecting duct and some specialized cells of the inner ear (9,10). Recently, a second form of dRTA was identified, caused by mutations in the ATP6V0A4 gene coding for the a4 V-H⁺-ATPase subunit (11). This form of dRTA may also be associated with deafness in some cases (12).

V-type H⁺-ATPases consist of at least 13 subunits arranged in a peripheral V₁ and membrane-bound V₀ domain (for review, see (13,14)). For many of these subunits, organ- or cell-specific isoforms that may be involved in the cell-specific regulation or targeting of the pump complex exist as suggested by studies in yeast (14,15). Little is known about the function of the mammalian homologs of the yeast isoforms and the specific roles of cell-specific isoforms. For the a subunit, four isoforms have been identified in C. elegans, chicken, cow, mouse, and human, which display distinct organ expression patterns (11,16–23). On the basis of Northern blotting, the a1, a2, and a3 subunits are mainly found in extrarenal tissues but also show some expression in the kidney (16,17,20,21). In contrast, the a4 subunit has the most restricted expression and has been detected only in kidney, epididymis, and inner ear in human and mouse (11,12,18,22). However, differences in the localization of the a4 subunit in kidney were reported, with the initial report describing localization in only one subset of intercalated cells in human kidney (11). In mouse, Oka et al. (18) localized the a4 subunit to both type A and type B intercalated cells, whereas we recently demonstrated that the a4 subunit could be found in all types of intercalated cells and also with strong expression in the initial segment of the proximal tubule in mouse kidney (22). These discrepancies could reflect technical differences (e.g., use of antigen retrieval, fixation of the tissue) or species-specific expression patterns and need to be resolved to elucidate further the role of tissue-specific V-H⁺-ATPase isoforms as well as the particular role of this disease causing a4 V-H⁺-ATPase subunit. Therefore, we examined the localization of the a4 subunit in mouse and human kidney and, using antigen retrieval techniques, demonstrated expression in most nephron segments. In addition, we show that although the protein expression levels of the a4 subunit are not influenced by acid-base status, there is a marked subcellular redistribution of the a4 subunit in intercalated cells in response to acid-base changes and dietary potassium intake.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals
C57BL/6J mice (male, 25 to 30 g; Jackson Laboratories, Bar Harbor, ME) were maintained on a standard diet and had access to drinking water ad libitum. Mice were given either 2% sucrose/0.28 M NH₄Cl or 2% sucrose/0.28 M NaHCO₃ in the drinking water for 24 h, 48 h, or 7 d as described previously (24–26). These treatments have been shown to induce mild metabolic acidosis or alkalosis in rodents (26,27). The control group received only 2% sucrose in their drinking water. An additional group of mice was provided a K⁺-depleted diet for 7 or 14 d (Bio-serv, Frenchtown, NJ) as described previously (25,28). Each group consisted of 8 to 10 animals for each time point and treatment, respectively. Four animals of each group were used for Western blotting, and the remaining 4 to 6 were used for immunohistochemistry. For blood analysis, mice were anesthetized and heparinized venous blood was collected and analyzed immediately for blood gases and electrolytes on a Radiometer ABL 505 (Radiometer, Copenhagen, Denmark) blood gas analyzer. Urine was collected as spot urine, and pH was measured immediately using a pH microelectrode (Lazar Research Laboratories, CA) connected to Thermo Orion 290 pH meter. All studies were approved by the Yale Animal Care and Use Committee or the Swiss Veterinäramt (Zurich, Switzerland).

Western Blotting
Animals were killed, and kidneys were rapidly harvested. After homogenization in an ice-cold K-HEPES buffer (200 mM mannitol, 80 mM K-HEPES, 41 mM KOH [pH 7.5]) with pepstatin, leupeptin, K-EDTA, and PMSF as protease inhibitors, the samples were centrifuged at 1000 x g for 10 min at 4°C and the supernatant was saved. Subsequently, the supernatant was centrifuged at 100,000 x g for 1 h at 4°C, and the pellet was resuspended in K-HEPES buffer containing protease inhibitors. After measurement of the total protein concentration (Bio-Rad, Hercules, CA), 50 µg of crude membrane protein was solubilized in Laemmli sample buffer, and SDS-PAGE was performed on a 10% polyacrylamide gel. An initial gel was stained with Coomassie blue to confirm equal loading among samples. For immunoblotting, the proteins were transferred electrophoretically from unstained gels to polyvinylidene fluoride membranes (Immobilon-P, Millipore, Bedford, MA). After blocking with 5% milk powder for 60 min, the blots were incubated with the primary antibodies (rabbit anti-a4 raw serum 1:5000 [the anti-a4 serum had been produced in rabbit using a C-terminal peptide of the human sequence that had a N-terminally introduced cysteine for linkage to keyhole limpet hemocyanin (KLH; NH₂-CKFSPFSFKHILDGTAEE-COOH) (11)]) and mouse monoclonal anti-actin (42 kD; Sigma, St. Louis, MO) 1:500 either for 2 h at room temperature or overnight at 4°C. After washing off the primary antibody and subsequent blocking, blots were incubated with the secondary antibodies (donkey anti-rabbit 1:10,000 and sheep anti-mouse 1:5000 IgG-conjugated with horseradish peroxidase [Amersham Life Sciences]) for 1 h at room temperature. Antibody binding was detected with the enhanced chemiluminescence ECL kit (Amersham Pharmacia Biotech, UK) before exposure to x-ray film (Kodak). All films were scanned and analyzed using SCION Imaging software.

Immunohistochemistry
Human Kidney.
Three different human kidney specimens were obtained from Dr. K. Klingel (Department of Pathology, University of Tübingen, Tübingen, Germany), which originated from renal tumor resections but showed no tumor infiltration. The use of the tissue for research was approved by the local ethics commission. Sections were fixed with paraformaldehyde by immersion and embedded in paraffin. Five-micrometer sections were cut, deparaffinized with xylol, washed with decreasing ethanol concentrations, and subsequently rehydrated with PBS before immunohistochemistry was performed as described below.

Mouse Kidney.
C57BL/6J mice were anesthetized with ketamine and perfused through the left ventricle with PBS followed by paraformaldehyde-lysine-periodate fixative (29). Kidneys were removed and fixed overnight at 4°C by immersion in paraformaldehyde-lysine-periodate. Kidneys were washed three times with PBS, and 5-µm cryosections were cut after cryoprotection with 2.3 M sucrose in PBS for at least 12 h. Immunostaining was carried out as described previously (28,30). Sections were incubated with 1% SDS for 5 min, washed three times with PBS, and incubated with PBS containing 1% BSA for 15 min before the primary antibody. The primary antibodies (rabbit anti-ATP6V0A4 [a4] serum 1:500, rabbit anti-NCC serum [1:500; gift of J. Loffing, Institute of Anatomy, University of Zurich, Zurich, Switzerland], and goat anti-human AQP-2 [Santa Cruz Biotechnology, Santa Cruz, CA] 1:100, mouse monoclonal anti-calbindin-D 28k [Swant, Bellinzona, Switzerland] 1:10,000) were both diluted in PBS and applied either for 75 min at room temperature or overnight at 4°C. Sections were then washed twice for 5 min with high NaCl PBS (PBS + 2.7% NaCl), once with PBS, and incubated with dilutions of the secondary antibodies (donkey anti-rabbit 586 [1:1000], donkey anti-mouse 488 [1:400], donkey anti-goat 488 [1:200; Molecular Probes, Eugene, OR] or donkey anti-goat Cy5 [Jackson Immunolab]) at the given dilutions for 1 h at room temperature. Sections were again washed twice with high-NaCl PBS and once with PBS before mounting with VectaMount (Vector Laboratories, Burlingame, CA). Sections were viewed either with a Zeiss LSM 410 confocal microscope or with a Leica CLSM confocal microscope. Images were processed (overlays) using Adobe Photoshop. For cell counts, kidneys from four animals for each treatment were used and 5 to 10 pictures from at least two sections from each kidney were taken for each nephron segment analyzed. Cells were counted as being positive either for a4 (intercalated cells) or for AQP-2 (principal cells). Intercalated cells were further classified on the basis of the predominant subcellular distribution of a4 immunostaining as described previously (24).

Tubule Isolation and Reverse Transcription-PCR
C57BL/6J mice (male, 25 to 30 g; Jackson Laboratory) were anesthetized with ketamine and perfused through the left ventricle with PBS containing 250 µg/ml collagenase (Sigma C-9891). The kidneys were rapidly removed, and coronal slices 2 to 3 mm in thickness were cut and incubated in PBS/collagenase at 37°C for 15 min. After rinsing with ice-cold PBS several times, the different nephron segments were hand-dissected and transferred into Trizol. Total RNA was extracted, purified following the manufacturer’s protocol, and reverse-transcribed using oligo(dT)_12–18 as primer according to standard methods. Aliquots of the resulting DNA were amplified by PCR using three different pairs of specific primers, each spanning at least one intron. The primer sequences used for Figure 3 were gcagtgcatcatcgccgagatc (forward) and gaacataggctggacactccaag (reverse). Reactions (in a 20-µl volume) contained 1x buffer, 0.2 mM dNTPs, 1.5 mM MgCl₂, 1 µM primers, and 5 U TaqDNA polymerase (Roche). Cycling conditions were [95°C, 64°C, 72°C] x 38 cycles, preceded by denaturing at 95°C for 3 min and followed by final extension at 72°C for 10 min. Whole mouse cortex and water provided positive and negative controls, respectively. Products were resolved on a 2% agarose gel stained with ethidium bromide and photographed under ultraviolet light.

View larger version (53K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. Detection of a4 (Atp6n1b) mRNA in specific mouse nephron segments by reverse transcription–PCR (RT-PCR). Mouse kidney was hand-dissected, and total RNA was extracted from specific nephron segments and total mouse kidney. RT-PCR was performed with intron-spanning primers specific for mouse a4 (Atp6n1b) as described in Materials and Methods. A band of the expected size of approximately 500 bp was found on an ethidium bromide-stained gel for all segments and total kidney. Omitting RNA from the RT-PCR reaction yielded no bands. The lanes were loaded with RT-PCR products from the following samples: 1, proximal tubule; 2, loop of Henle; 3, distal tubule; 4, CCD; 5, medullary collecting duct; 6, no RNA (water); 7, total kidney.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

The specificity of the staining was demonstrated by preincubation of the antibody with the immunizing peptide, which abolished all staining (Figure 1, A and B). Also, no staining was observed when the preimmune serum or the secondary antibody alone was used (data not shown). a4-specific staining was observed in the brush border and in the subapical compartment of the proximal tubule, with more intense staining seen in the early segments (S1 and S2; Figure 1C). Furthermore, apical staining was seen in the thick ascending limb and the distal convoluted tubule (DCT; Figure 1D). Intercalated cells in the CNT, CCD and medullary collecting duct, particularly the outer medullary collecting duct (OMCD), showed strong labeling. The staining was restricted to intercalated cells as demonstrated by double labeling of the principal cell-specific water channel AQP-2. Triple labeling of the calcium-binding protein calbindin-D28k and the AQP-2 water channel was performed to confirm localization of a4 in the DCT. In human kidney, calbindin-D28k is expressed both in the DCT and in the CCD, whereas AQP-2 is only found in the principal cells of the CNT and collecting duct (31). As shown in Figure 1D, co-localization of calbindin-D28k with a4 was observed (green, calbindin-D28k; red, a4; blue, AQP-2) in nephron segments not expressing AQP-2, consistent with localization in the DCT. In the intercalated cells of the CNT and CCD, a4 expression was restricted to cells negative for AQP-2, thus indicating a4 expression in intercalated cells. Notably, all AQP-2–negative cells were positive for a4, consistent with a4 expression in all types of intercalated cells. Most intercalated cells in the CNT and CCD showed an apical localization of a4 (Table 1); cells with a bipolar, basolateral, or diffuse staining were only rarely observed. In the medullary collecting duct, a4 expression was confined to the apical side of all intercalated cells.

View larger version (97K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. Immunolocalization of a4 in human kidney. Human kidney sections were stained with anti-a4 antibodies after antigen retrieval. (A) No staining was observed in cortical sections incubated with the anti-a4 serum plus the immunizing peptide. (B) Phase contrast photo of the same region as in A. G, glomerulus; PT, proximal tubule; C, cortical collecting duct. (C) Immunolocalization of a4 in the brush border membrane of proximal tubules. (D) Triple labeling for a4 (red), the calcium-binding protein calbindin (green), and the AQP-2 water channel (blue; which is specifically expressed in the principal cells of the collecting duct). Co-localization of calbindin (green) and a4 (red) in the same cells are seen, whereas no blue staining was observed, indicating expression of a4 in the distal tubule. (E) Double labeling for a4 (red) and the water channel AQP-2 (green) in the cortical collecting duct (CCD), demonstrating expression of a4 in intercalated cells but not principal cells. Note that all cells are stained either for AQP-2 or for a4, suggesting a4 expression in all types of intercalated cells. (F) Double labeling of an outer medullary collecting duct (OMCD) for a4 (red) and AQP-2 (green). Note also apical staining in two adjacent loops of Henle. Magnification, x400.

View larger version (41K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. Specificity of the anti-a4 antibody and tissue distribution of a4 protein in mouse. (A) Western blotting using crude membrane fractions from three mouse kidneys prepared separately from cortex and medulla showed only one band of approximately 110 to 120 kD in both preparations. Preincubation of the anti-a4 serum with the immunizing peptide abolished this band, demonstrating the specificity of the anti-a4 serum. (B) Crude membrane fractions from various mouse tissues were prepared and tested for a4 expression by Western blotting. A specific band (peptide protectable) of the correct size (arrow) was seen only in kidney and epididymis, consistent with an earlier report demonstrating mRNA and protein expression in these organs (22). The bands of lower and higher molecular weights seen in the different organs were not peptide protectable and thus unspecific.

View larger version (92K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 4. Immunolocalization of a4 in mouse kidney. (A) Staining of mouse renal cortex with anti-a4 serum preincubated with the immunizing peptide (red) and the AQP-2 water channel (green) demonstrating specificity of the anti-a4 serum. (B) Phase contrast of the same region. (C) Overview picture over mouse kidney cortex, outer and inner medulla stained with the anti-a4 serum. Strong labeling was found in the cortex in the initial segments of the proximal tubule (S1, S2), in the distal tubule, and in distinct cells of the cortical and medullary collecting duct. A weak but distinct staining was also detected in the loop of Henle. Magnifications: x400 in B, x40 in C.

View larger version (59K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 5. Expression of a4 along the mouse nephron. (A) Labeling of mouse kidneys with anti-a4 serum (red) and the principal cell-specific water channel AQP-2 (green). Strong staining for a4 of the brush border membrane of the early proximal tubule segments (S1, S2) and of some distinct cells in an adjacent CCD was seen. (B) Connecting tubule with a4 (red) localized to the apical side of intercalated cells, principal cells were marked with the AQP-2 water channel (blue), the calcium-binding protein calbindin is marked in green. (C) Double labeling for a4 (red) and AQP-2 (green) showing a4 staining in a subset of cortical collecting cells negative for AQP-2 (principal cells). All cells negative for AQP-2 were positive for a4, demonstrating expression in all types of intercalated cells. Note that several patterns of subcellular a4 staining are visible as described previously for other H+-ATPase subunits in the CCD with apical (arrow head), bipolar (arrow), and basolateral (*) localization (2). (D) Expression of a4 (red) in the OMCD was seen only in cells devoid of the AQP-2 (green) water channel. (E) Localization of a4 in the early and late distal convoluted tubule (DCT1, DCT2) and CCD. Mouse kidneys were stained against a4 (red), the calcium-binding protein calbindin (green) expressed in both DCT and CCD and the AQP-2 water channel specifically expressed in the principal cells of the connecting segment (CNT) and collecting duct. a4 staining (red) is seen in proximal tubules, early and late DCT, and intercalated cells of the CNT and CCD. DCT1 and DCT2 are identified by calbindin staining (green) but the absence of AQP-2 (blue). Note the transition of the early DCT (DCT1) and late DCT (DCT2) marked by the appearance of calbindin and the a4 staining in both segments (arrowheads). (F and G) Localization of a4 in the distal tubule. Consecutive sections were stained against the thiazide-sensitive Na/Cl co-transporter NCC (red), specifically expressed in mouse distal tubule, and the AQP-2 water channel (green; F) or against the a4 vacuolar H+-ATPase subunit (red), calbindin (green), and AQP-2 (blue; G). Co-localization of NCC and a4 demonstrate expression of a4 also in distal tubule. Magnifications: x600 in B and C, x550 in D, x400 in E, x500 in G.

View larger version (58K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 6. Acid-base status does not alter a4 protein expression levels in mouse kidney. Mice were loaded with NH4Cl (0.28 M) or NaHCO3 (0.28 M) for 24 h, 48 h, or 7 d, and relative a4 protein expression levels were assessed by Western blotting of a crude membrane fraction prepared from total kidneys. Membranes were prepared from four mice for each dietary condition and time point. For controlling for protein loading, all Western blot membranes were stripped and reprobed for actin (42 kD), and the ratio of a4:actin was calculated as described in Materials and Methods. NH4Cl loading or NaHCO3 loading did not significantly alter the a4:actin ratio at any time point. Similar results were obtained for separate cortex and medulla preparations (data not shown).

View larger version (43K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 7. Chronic K+ depletion has no effect on a4 protein expression levels in mouse kidney. Mice were kept on a K+-deficient diet for 2 wk with free access to food and tap water. The relative a4 protein expression levels were assessed by Western blotting of a crude membrane fraction prepared from total kidney. For controlling for protein loading, all Western blot membranes were stripped and reprobed for actin (42 kD), and the ratio of a4:actin was calculated as described in Materials and Methods. The induction of K+ depletion had no influence on the a4:actin ratio in total kidney. Similar results were obtained after only 1 wk of a low-potassium diet (data not shown).

View larger version (79K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 8. Alterations in acid-base status and chronic K+ depletion led to changes in subcellular a4 localization in mouse kidney. Mouse kidneys were stained for a4 (red) and AQP-2 (green). (A) DCT and CCD after 2 d of NH4Cl loading showing in most intercalated cells a rim-like apical staining. Intercalated cells in the DCT2 were bulging into the lumen and appeared hypertrophic as described before for the intercalated cells of the medullary collecting duct under chronic potassium depletion (50). Only a few intercalated cells with diffuse or basolateral staining were visible (data not shown). (B) Medullary collecting duct from the transition of outer to inner medulla after 2 d of acid loading with prominent apical a4 staining in intercalated cells. (C) CCD after 1 wk of bicarbonate loading with most intercalated cells showing mainly cytosolic or bipolar staining typical for type B or non-type A/B bicarbonate secreting intercalated cells. (D) In the OMCD after 1 wk of bicarbonate loading, a4 protein was diffusely localized in the cytosol and on the apical side of intercalated cells, suggesting downregulation of proton secretion. (E) Chronic K+ depletion for 2 wk led to a strong apical a4 staining of intercalated cells in the CCD. Only very few intercalated cells with diffuse or basolateral staining could be found (data not shown). (F) In the same kidney, apical staining of intercalated cells in the convoluted (late) distal tubule seemed to be more enhanced. Magnifications: x400 in A through C, E, and F; x520 in D.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Vacuolar H⁺-ATPases are involved in a variety of cellular functions in the kidney, such as protein endocytosis from the lumen in the proximal tubule (35), recycling of transport proteins such as the water channel AQP-2 (36), insertion of vesicles into the membrane, and lysosomal degradation of proteins (2,37). Inborn defects of the ATP6V1B1 or ATP6V0A4 V-type H⁺-ATPase subunits have been shown to affect the kidney and to manifest themselves as syndromes of dRTA often associated with sensorineural deafness (8,9,11,12). Thus, for understanding the role of these subunits and the development of the syndromes caused by the loss of their activity, the tissue and cellular and subcellular distribution need to be determined. a-subunit homologs have recently been cloned from several species, including human (11), mouse (18,22), and C. elegans (19). Different patterns of a4 subunit expression in human and mouse kidney, however, have been reported (11,18,22). To resolve these discrepancies, we studied a4 expression in these two species and examined a4 regulation in response to acid-base status and electrolyte intake in mouse kidney.

Expression of the a4 subunit was found along the human and mouse nephron in all segments known to express V-H⁺-ATPases: the proximal tubule, loop of Henle, the CNT, CCD, OMCD, and initial inner medullary collecting duct (2). In the proximal tubule, expression was seen in the brush border and apical compartment, suggesting a role in bicarbonate reabsorption and involvement in receptor-mediated endocytosis. In the CCD, different subcellular localization patterns were found with apical, diffuse, bipolar, and basolateral localizations in intercalated cells only. This distribution has been previously described for the A (70 kD) and E (31 kD) subunits in kidney from different species (24,37,39) and may represent different states of differentiation or activity of type A, B, and non-type A/B intercalated cells. This interpretation is further supported by the fact that NH₄Cl loading led to the appearance of primarily apically stained intercalated cells in these segments, whereas HCO₃^- loading reversed the process and induced a predominantly basolateral staining, consistent with activation of type A or type B intercalated cells, respectively. In the medullary collecting duct, staining was also restricted to intercalated cells and was found only on the apical side, typical for type A intercalated cells in this segment. Surprising is that in human kidney, a mainly apical subcellular localization of the a4 subunit in all intercalated cells was observed. Even though this pattern was found in three human kidney samples from different patients, it cannot be ruled out that this result is influenced by special diets or drug treatments of these particular patients.

That a4 was found not only in the intercalated cells of the CCD and medullary collecting duct but in additional nephron segments and that mutations in the a4 coding gene ATP6VOA4 are associated with only distal renal tubular acidosis but not a more generalized tubular dysfunction raises several questions as to the function of the a4 subunit in the proximal tubule and loop of Henle. In the proximal tubule, V-H⁺-ATPases participate not only in proton extrusion/bicarbonate reabsorption but also in more complex cellular processes such as receptor-mediated endocytosis and lysosomal degradation of proteins and also may be involved in exocytotic processes (1,2,35,38). That dRTA patients do not show evidence of generalized proximal tubular dysfunction may reflect that these other V-H⁺-ATPase functions may be performed by other a isoforms under normal conditions. Indeed, a1, a2, and a3 transcripts have been detected by Northern blotting and reverse transcription-PCR of total kidney RNA preparations (16,20,21,23). However, the cellular and subcellular localizations of the a1, a2, and a3 proteins in kidney are unknown at present.

That a4 was previously not detected in human and mouse proximal tubule may reflect technical differences in immunostaining methods, as we were unable to detect significant and specific a4 immunostaining in the proximal tubule or loop of Henle without antigen retrieval. Similarly, other proteins such as the Na⁺/K⁺-ATPase have been detected only in intercalated cells after antigen retrieval (40).

Induction of metabolic acidosis or alkalosis as well as changes in the dietary intake of electrolytes are known to alter the activity and subcellular localization of the vacuolar H⁺-ATPase in different nephron segments (2,33,34,41–44). In the distal tubule and CCD, induction of metabolic acidosis leads to the activation of mainly type A acid-secretory intercalated cells, whereas metabolic alkalosis stimulates type B intercalated cells (2,24,45,46). Consistent with this change in intercalated cell appearance and function, the a4 subunit was found in the apical membrane of most intercalated cells in the late DCT, CNT, and CCD after NH₄Cl loading. Even though we did not correlate the subcellular localization of the a4 subunit with markers of type A and type B intercalated cells (e.g., AE1, pendrin), it is very likely that the redistribution of the a4 subunit to different subcellular localizations in the CCD is associated with the activation of acid and/or inactivation of bicarbonate secretion in this segment under the different conditions as previously shown (28,46–48). Similarly in chronic K⁺ depletion, a condition previously shown to induce metabolic alkalosis partly through increased reabsorption of bicarbonate and secretion of protons (1), prominent apical staining of intercalated cells in all segments was seen as described previously for the E (31 kD) subunit (34). Only a few intercalated cells with diffuse or basolateral staining could be observed under both conditions, acid loading or chronic K⁺ depletion (data not shown). In contrast, after alkali loading, most intercalated cells in the CCD showed a strong bipolar or basolateral labeling. These findings are in good agreement with earlier reports showing trafficking of other H⁺-ATPase subunits in response to metabolic acidosis or alkalosis or dietary electrolyte intake (2). In addition, Western blotting for the a4 subunit in separate cortical and medullary fractions under the different treatments showed no changes in the protein expression levels. In contrast, Fejes-Toth and Naray-Fejes-Toth (49) suggested changes in mRNA levels of the E (31 kD) subunit in response to metabolic acidosis or alkalosis. However, Bastani et al. (24) showed no changes in the E (31 kD) H⁺-ATPase subunit mRNA and protein levels under these conditions, consistent with observations obtained in our own laboratory (C. Wagner, unpublished results). Thus, the majority of observations suggest that regulation of H⁺-ATPase activity in response to acid-base status is mediated by trafficking of pumps or pump subunits, rather than changes in subunit expression levels.

In summary, we demonstrate expression of the a4 H⁺-ATPase subunit in different nephron segments of human and mouse kidney, namely proximal tubule, loop of Henle, DCT, CNT, CCD, and medullary collecting duct. a4 protein levels are not affected by changes in acid-base status or electrolyte intake. However, on a subcellular level, a4 subunits are redistributed to the apical side of intercalated cells after acid-loading or chronic K⁺ depletion or to the basolateral side in the CNT and CCD after alkali loading. That loss of a4 subunit function in a syndrome of inborn dRTA does not affect proximal tubular function will need further clarification but may suggest a compensatory role for other a subunit isoforms.

	Acknowledgments

 
This study was supported by a grant of the Swiss National foundation to CAW (31-68318.02), NIH grants (DK 50230,17433,14669) to JPG, and by a Wellcome Trust Senior Clinical Fellowship to FEK. KEF was an investigator of the National Institutes of Health Medical Scientist Training Program. RPL is an investigator of the Howard Hughes Medical Institute. We thank Dr. J. Loffing, Institute of Anatomy, Univ. of Zurich for valuable discussions and providing the anti-NCC antibody.

	Footnotes

 
P.A.S. and N.S. contributed equally to this work and therefore share first authorship.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Hamm LL, Alpern RJ: Cellular mechanisms of renal tubular acidification. In: The Kidney: Physiology and Pathophysiology, 3rd Ed., edited by Seldin DW, Giebisch G, Philadelphia: Lippincott Williams & Wilkins, 2000, pp 1935–1979
2. Brown D, Breton S: Structure, function and cellular distribution of the vacuolar H⁺-ATPase (H⁺V-ATPase/ proton pump). In: The Kidney: Physiology and Pathophysiology, 3rd Ed., edited by Seldin DW, Giebisch G, Philadelphia: Lippincott Williams & Wilkins, 2000, pp 171–191
3. Chan YL, Giebisch G: Relationship between sodium and bicarbonate transport in the rat proximal convoluted tubule. Am J Physiol 240: F222–F230, 1981
4. Borensztein P, Leviel F, Froissart M, Houillier P, Poggioli J, Marty E, Bichara M, Paillard M: Mechanisms of H⁺/HCO₃^- transport in the medullary thick ascending limb of rat kidney. Kidney Int Suppl 33: S43–S46, 1991[Medline]
5. Capasso G, Unwin R, Agulian S, Giebisch G: Bicarbonate transport along the loop of Henle. I. Microperfusion studies of load and inhibitor sensitivity. J Clin Invest 88: 430–437, 1991
6. Silver RB, Soleimani M: H⁺-K⁺-ATPases: Regulation and role in pathophysiological states. Am J Physiol 276: F799–F811, 1999
7. Alper SL: Genetic diseases of acid-base transporters. Annu Rev Physiol 64: 899–923, 2002[CrossRef][Medline]
8. Karet FE: Inherited distal renal tubular acidosis. J Am Soc Nephrol 13: 2178–2184, 2002[Free Full Text]
9. Karet FE, Finberg KE, Nelson RD, Nayir A, Mocan H, Sanjad SA, Rodriguez-Soriano J, Santos F, Cremers CW, Di Pietro A, Hoffbrand BI, Winiarski J, Bakkaloglu A, Ozen S, Dusunsel R, Goodyer P, Hulton SA, Wu DK, Skvorak AB, Morton CC, Cunningham MJ, Jha V, Lifton RP: Mutations in the gene encoding B1 subunit of H⁺-ATPase cause renal tubular acidosis with sensorineural deafness. Nat Genet 21: 84–90, 1999[CrossRef][Medline]
10. Nelson RD, Guo XL, Masood K, Brown D, Kalkbrenner M, Gluck S: Selectively amplified expression of an isoform of the vacuolar H⁺-ATPase 56-kilodalton subunit in renal intercalated cells. Proc Natl Acad Sci U S A 89: 3541–3545, 1992[Abstract/Free Full Text]
11. Smith AN, Skaug J, Choate KA, Nayir A, Bakkaloglu A, Ozen S, Hulton SA, Sanjad SA, Al-Sabban EA, Lifton RP, Scherer SW, Karet FE: Mutations in ATP6N1B, encoding a new kidney vacuolar proton pump 116-kD subunit, cause recessive distal renal tubular acidosis with preserved hearing. Nat Genet 26: 71–75, 2000[CrossRef][Medline]
12. Stover EH, Borthwick KJ, Bavalia C, Eady N, Fritz DM, Rungroj N, Giersch AB, Morton CC, Axon PR, Akil I, Al-Sabban EA, Baguley DM, Bianca S, Bakkaloglu A, Bircan Z, Chauveau D, Clermont MJ, Guala A, Hulton SA, Kroes H, Li Volti G, Mir S, Mocan H, Nayir A, Ozen S, Rodriguez Soriano J, Sanjad SA, Tasic V, Taylor CM, Topaloglu R, Smith AN, Karet FE: Novel ATP6V1B1 and ATP6V0A4 mutations in autosomal recessive distal renal tubular acidosis with new evidence for hearing loss. J Med Genet 39: 796–803, 2002[Abstract/Free Full Text]
13. Forgac M: Structure and properties of the vacuolar (H⁺)- ATPases. J Biol Chem 274: 12951–12954, 1999[Free Full Text]
14. Nishi T, Forgac M: The vacuolar (H+)-ATPases—Nature’s most versatile proton pumps. Nat Rev Mol Cell Biol 3: 94–103, 2002[CrossRef][Medline]
15. Merzendorfer H, Graf R, Huss M, Harvey WR, Wieczorek H: Regulation of proton-translocating V-ATPases. J Exp Biol 200: 225–235, 1997[Abstract]
16. Mattsson JP, Li X, Peng SB, Nilsson F, Andersen P, Lundberg LG, Stone DK, Keeling DJ: Properties of three isoforms of the 116-kDa subunit of vacuolar H⁺-ATPase from a single vertebrate species. Cloning, gene expression and protein characterization of functionally distinct isoforms in Gallus gallus. Eur J Biochem 267: 4115–4126, 2000[Medline]
17. Nishi T, Forgac M: Molecular cloning and expression of three isoforms of the 100-kDa a subunit of the mouse vacuolar proton-translocating ATPase. J Biol Chem 275: 6824–6830, 2000[Abstract/Free Full Text]
18. Oka T, Murata Y, Namba M, Yoshimizu T, Toyomura T, Yamamoto A, Sun-Wada GH, Hamasaki N, Wada Y, Futai M: a4, a unique kidney-specific isoform of mouse vacuolar H⁺-ATPase subunit a. J Biol Chem 276: 40050–40054, 2001[Abstract/Free Full Text]
19. Oka T, Toyomura T, Honjo K, Wada Y, Futai M: Four subunit a isoforms of Caenorhabditis elegans vacuolar H⁺-ATPase. Cell-specific expression during development. J Biol Chem 276: 33079–33085, 2001[Abstract/Free Full Text]
20. Peng SB, Crider BP, Xie XS, Stone DK: Alternative mRNA splicing generates tissue-specific isoforms of 116-kDa polypeptide of vacuolar proton pump. J Biol Chem 269: 17262–17266, 1994[Abstract/Free Full Text]
21. Peng SB, Li X, Crider BP, Zhou Z, Andersen P, Tsai SJ, Xie XS, Stone DK: Identification and reconstitution of an isoform of the 116-kDa subunit of the vacuolar proton translocating ATPase. J Biol Chem 274: 2549–2555, 1999[Abstract/Free Full Text]
22. Smith AN, Finberg KE, Wagner CA, Lifton RP, Devonald MA, Su Y, Karet FE: Molecular cloning and characterization of Atp6n1b: A novel fourth murine vacuolar H⁺-ATPase a-subunit gene. J Biol Chem 276: 42382–42388, 2001[Abstract/Free Full Text]
23. Toyomura T, Oka T, Yamaguchi C, Wada Y, Futai M: Three subunit a isoforms of mouse vacuolar H⁺-ATPase. Preferential expression of the a3 isoform during osteoclast differentiation. J Biol Chem 275: 8760–8765, 2000[Abstract/Free Full Text]
24. Bastani B, Purcell H, Hemken P, Trigg D, Gluck S: Expression and distribution of renal vacuolar proton-translocating adenosine triphosphatase in response to chronic acid and alkali loads in the rat. J Clin Invest 88: 126–136, 1991
25. Laghmani K, Richer C, Borensztein P, Paillard M, Froissart M: Expression of rat thick limb Na/H exchangers in potassium depletion and chronic metabolic acidosis. Kidney Int 60: 1386–1396, 2001[CrossRef][Medline]
26. Sabolic I, Brown D, Gluck SL, Alper SL: Regulation of AE1 anion exchanger and H(+)-ATPase in rat cortex by acute metabolic acidosis and alkalosis. Kidney Int 51: 125–137, 1997[Medline]
27. Bushinsky DA, Chabala JM, Gavrilov KL, Levi-Setti R: Effects of in vivo metabolic acidosis on midcortical bone ion composition. Am J Physiol 277: F813–F819, 1999
28. Wagner CA, Finberg KE, Stehberger PA, Lifton RP, Giebisch GH, Aronson PS, Geibel JP: Regulation of the expression of the Cl^-/anion exchanger pendrin in mouse kidney by acid-base status. Kidney Int 62: 2109–2117, 2002[CrossRef][Medline]
29. McLean IW, Nakane PK: Periodate-lysine-paraformaldehyde fixative. A new fixation for immunoelectron microscopy. J Histochem Cytochem 22: 1077–1083, 1974[Abstract]
30. Brown D, Lydon J, McLaughlin M, Stuart-Tilley A, Tyszkowski R, Alper S: Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate (SDS). Histochem Cell Biol 105: 261–267, 1996[CrossRef][Medline]
31. Biner HL, Arpin-Bott MP, Loffing J, Wang X, Knepper M, Hebert SC, Kaissling B: Human cortical distal nephron: Distribution of electrolyte and water transport pathways. J Am Soc Nephrol 13: 836–847, 2002[Abstract/Free Full Text]
32. Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert SC, Rossier BC, Hoenderop JG, Bindels RJ, Kaissling B: Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am J Physiol Renal Physiol 281: F1021–F1027, 2001[Abstract/Free Full Text]
33. Bailey MA, Fletcher RM, Woodrow DF, Unwin RJ, Walter SJ: Upregulation of H⁺-ATPase in the distal nephron during potassium depletion: Structural and functional evidence. Am J Physiol 275: F878–F884, 1998
34. Silver RB, Breton S, Brown D: Potassium depletion increases proton pump (H⁺-ATPase) activity in intercalated cells of cortical collecting duct. Am J Physiol Renal Physiol 279: F195–F202, 2000[Abstract/Free Full Text]
35. Marshansky V, Ausiello DA, Brown D: Physiological importance of endosomal acidification: Potential role in proximal tubulopathies. Curr Opin Nephrol Hypertens 11: 527–537, 2002[CrossRef][Medline]
36. Gustafson CE, Katsura T, McKee M, Bouley R, Casanova JE, Brown D: Recycling of AQP2 occurs through a temperature- and bafilomycin-sensitive trans-Golgi-associated compartment. Am J Physiol Renal Physiol 278: F317–F326, 2000[Abstract/Free Full Text]
37. Kim J, Kim YH, Cha JH, Tisher CC, Madsen KM: Intercalated cell subtypes in connecting tubule and cortical collecting duct of rat and mouse. J Am Soc Nephrol 10: 1–12, 1999[Abstract/Free Full Text]
38. Peters C, Bayer MJ, Bühler S, Andersen JS, Mann M, Mayer A: Trans-complex formation by proteolipid channels in the terminal phase of membrane fusion. Nature 409: 581–588, 2001[CrossRef][Medline]
39. Teng-umnuay P, Verlander JW, Yuan W, Tisher CC, Madsen KM: Identification of distinct subpopulations of intercalated cells in the mouse collecting duct. J Am Soc Nephrol 7: 260–274, 1996[Abstract]
40. Sabolic I, Herak-Kramberger CM, Breton S, Brown D: Na/K-ATPase in intercalated cells along the rat nephron revealed by antigen retrieval. J Am Soc Nephrol 10: 913–922, 1999[Abstract/Free Full Text]
41. Eiam-Ong S, Kurtzman NA, Sabatini S: Regulation of collecting tubule adenosine triphosphatases by aldosterone and potassium. J Clin Invest 91: 2385–2392, 1993
42. Eiam-ong S, Laski ME, Kurtzman NA, Sabatini S: Effect of respiratory acidosis and respiratory alkalosis on renal transport enzymes. Am J Physiol 267: F390–F399, 1994
43. Gluck SL, Underhill DM, Iyori M, Holliday LS, Kostrominova TY, Lee BS: Physiology and biochemistry of the kidney vacuolar H⁺-ATPase. Annu Rev Physiol 58: 427–445, 1996[CrossRef][Medline]
44. Khadouri C, Marsy S, Barlet-Bas C, Cheval L, Doucet A: Effect of metabolic acidosis and alkalosis on NEM-sensitive ATPase in rat nephron segments. Am J Physiol 262: F583–F590, 1992
45. Schwartz GJ, Barasch J, Al-Awqati Q: Plasticity of functional epithelial polarity. Nature 318: 368–371, 1985[CrossRef][Medline]
46. Verlander JW, Madsen KM, Cannon JK, Tisher CC: Activation of acid-secreting intercalated cells in rabbit collecting duct with ammonium chloride loading. Am J Physiol 266: F633–F645, 1994
47. Frische S, Kwon TH, Frokiaer J, Madsen KM, Nielsen S: Regulated expression of pendrin in rat kidney in response to chronic NH₄Cl or NaHCO₃ loading. Am J Physiol Renal Physiol 284: F584–F593, 2003[Abstract/Free Full Text]
48. Verlander JW, Madsen KM, Tisher CC: Axial distribution of band 3-positive intercalated cells in the collecting duct of control and ammonium chloride-loaded rabbits. Kidney Int Suppl 57: S137–S147, 1996[CrossRef][Medline]
49. Fejes-Toth G, Naray-Fejes-Toth A: Effect of acid/base balance on H-ATPase 31 kD subunit mRNA levels in collecting duct cells. Kidney Int 48: 1420–1426, 1995[Medline]
50. Stetson DL, Wade JB, Giebisch G: Morphologic alterations in the rat medullary collecting duct following potassium depletion. Kidney Int 17: 45–56, 1980[Medline]

This article has been cited by other articles:

				Y. Su, K. G. Blake-Palmer, S. Sorrell, B. Javid, K. Bowers, A. Zhou, S. H. Chang, S. Qamar, and F. E. Karet Human H+ATPase a4 subunit mutations causing renal tubular acidosis reveal a role for interaction with phosphofructokinase-1 Am J Physiol Renal Physiol, October 1, 2008; 295(4): F950 - F958. [Abstract] [Full Text] [PDF]

				M. Nowik, M. R. Lecca, A. Velic, H. Rehrauer, A. W. Brandli, and C. A. Wagner Genome-wide gene expression profiling reveals renal genes regulated during metabolic acidosis Physiol Genomics, February 19, 2008; 32(3): 322 - 334. [Abstract] [Full Text] [PDF]

				N. Mohebbi, J. Kovacikova, M. Nowik, and C. A. Wagner Thyroid hormone deficiency alters expression of acid-base transporters in rat kidney Am J Physiol Renal Physiol, July 1, 2007; 293(1): F416 - F427. [Abstract] [Full Text] [PDF]

				A. C. Fry and F. E. Karet Inherited Renal Acidoses Physiology, June 1, 2007; 22(3): 202 - 211. [Abstract] [Full Text] [PDF]

				P. A. Stehberger, B. E. Shmukler, A. K. Stuart-Tilley, L. L. Peters, S. L. Alper, and C. A. Wagner Distal Renal Tubular Acidosis in Mice Lacking the AE1 (Band3) Cl-/HCO3- Exchanger (slc4a1) J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1408 - 1418. [Abstract] [Full Text] [PDF]

				C. Moret, M. H. Dave, N. Schulz, J. X. Jiang, F. Verrey, and C. A. Wagner Regulation of renal amino acid transporters during metabolic acidosis Am J Physiol Renal Physiol, February 1, 2007; 292(2): F555 - F566. [Abstract] [Full Text] [PDF]

				L. Cheval, L. Morla, J.-M. Elalouf, and A. Doucet Kidney collecting duct acid-base "regulon" Physiol Genomics, November 21, 2006; 27(3): 271 - 281. [Abstract] [Full Text] [PDF]

				N. Ochotny, A. Van Vliet, N. Chan, Y. Yao, M. Morel, N. Kartner, H. P. von Schroeder, J. N. M. Heersche, and M. F. Manolson Effects of Human a3 and a4 Mutations That Result in Osteopetrosis and Distal Renal Tubular Acidosis on Yeast V-ATPase Expression and Activity J. Biol. Chem., September 8, 2006; 281(36): 26102 - 26111. [Abstract] [Full Text] [PDF]

				S. Petrovic, H. Amlal, X. Sun, F. Karet, S. Barone, and M. Soleimani Vasopressin induces expression of the Cl-/HCO3- exchanger SLC26A7 in kidney medullary collecting ducts of Brattleboro rats Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1194 - F1201. [Abstract] [Full Text] [PDF]

A. N. Smith, F. Jouret, S. Bord, K. J. Borthwick, R. S. Al-Lamki, C. A. Wagner, D. C. Ireland, V. Cormier-Daire, A. Frattini, A. Villa, et al. Vacuolar H+-ATPase d2 Subunit: Molecular Characterization, Developmental Regulation, and Localization to Specialized Proton Pumps in Kidney and Bone J. Am. Soc. Nephrol., May 1, 2005; 16(5): 1245 - 1256. [Abstract] [Full Text] [PDF]