Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muller, O. G.
Right arrow Articles by Horisberger, J.-D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muller, O. G.
Right arrow Articles by Horisberger, J.-D.
J Am Soc Nephrol 14:1107-1115, 2003
© 2003 American Society of Nephrology

Mineralocorticoid Effects in the Kidney: Correlation between {alpha}ENaC, GILZ, and Sgk-1 mRNA Expression and Urinary Excretion of Na+ and K+

Olivier G. Muller*, Rimma G. Parnova{dagger}, Gabriel Centeno*, Bernard C. Rossier*, Dmitri Firsov* and Jean-Daniel Horisberger*

*Institute of Pharmacology and Toxicology, University of Lausanne, Switzerland; {dagger}Sechenov Institute of Evolutionary Physiology and Biochemistry of the Russian Academy of Sciences, Saint-Petersburg, Russia.

Correspondence to Dr. Jean-Daniel Horisberger, Institut de Pharmacologie et de Toxicologie, Bugnon 27, CH-1005 Lausanne, Switzerland. Phone: 41-21-692-5362; Fax: 41-21-692-5355;


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. Aldosterone exerts its effects through interactions with two types of binding sites, the mineralocorticoid (MR) and the glucocorticoid (GR) receptors. Although both receptors are known to be involved in the anti-natriuretic response to aldosterone, the mechanisms of signal transduction leading to modulation of electrolyte transport are not yet fully understood. This study measured the Na+ and K+ urinary excretion and the mRNA levels of three known aldosterone-induced transcripts, the serum and glucocorticoid-induced kinase (Sgk-1), the {alpha} subunit of the epithelial Na+ channel ({alpha}ENaC), and the glucocorticoid-induced-leucine-zipper protein (GILZ) in the whole kidney and in isolated cortical collecting tubules of adrenalectomized rats treated with low doses of aldosterone and/or dexamethasone. The resulting plasma concentrations of both steroids were close to 1 nmol/L. Aldosterone, given with or without dexamethasone, induced anti-natriuresis and kaliuresis, whereas dexamethasone alone did not. GILZ and {alpha}ENaC transcripts were higher after treatment with either or both hormones, whereas the mRNA abundance of Sgk-1 was increased in the cortical collecting tubule by aldosterone but not by dexamethasone. We conclude the increased expression of Sgk-1 in the cortical collecting tubules is a primary event in the early antinatriuretic and kaliuretic responses to physiologic concentrations of aldosterone. Induction of {alpha}ENaC and/or GILZ mRNAs may play a permissive role in the enhancement of the early and/or late responses; these effects may be necessary for a full response but do not by themselves promote early changes in urinary Na+ and K+ excretion. E-mail: Jean-Daniel.Horisberger@ipharm.unil.ch


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Transepithelial Na+ and K+ transport is regulated by mineralocorticoid hormones in the distal nephron and other "tight" epithelia. The resulting changes in urinary Na+ and K+ excretion are responsible for the regulation of the sodium and potassium balance of the organism. Although the effects of mineralocorticoid hormones have been well described for about 50 yr, their underlying molecular mechanisms are only beginning to be understood in detail (1,2).

In its target tissues, aldosterone is known to bind to two types of receptor (3), a high-affinity type I receptor with a Kd = 0.5 to 3 nmol/L and a lower-affinity (Kd = 14 to 60 nmol/L) type II receptor, which have been identified with the proteins known as the cloned mineralocorticoid (MR) (4) and glucocorticoid (GR) (5) receptors, respectively (6–9).

Mineralocorticoid receptors, like GR and other steroid hormones receptors, are transcriptional regulators that, upon ligand binding, induce or repress the transcription of specific genes, which are transcribed into the so called aldosterone-induced (AIT) and aldosterone-repressed transcripts (ART), respectively. A number of AIT have been identified. These include subunits of the epithelial Na+ channel (ENaC) and of the Na,K-ATPase, which have obvious roles in Na+ transport as well as the small G-protein K-Ras2 (10), whose role in sodium transport is not yet fully understood (1,2). The serum and glucocorticoid-regulated kinase (Sgk-1) has been shown to be a major effector of the aldosterone action (11,12) by controlling the surface density of ENaC through phosphorylation of the ubiquitin-ligase Nedd4–2 (13). Recently, serial analysis of gene expression (SAGE) in an aldosterone-responsive CCD cell line has allowed the identification of many potential AIT and ART and particularly the mRNA of the protein GILZ (14). This mRNA was shown to be increased by more than tenfold within 4 h of aldosterone treatment (15), although the effect of this protein on Na+ or K+ transport is not yet understood.

In most of the studies in which these AIT have been identified, rather large concentrations of aldosterone have been used, concentrations that may have resulted in the occupancy of both type I and type II receptors. Thus it is not clear if the induction of the various known AIT are related to the occupancy of type I, type II, or both mineralocorticoid receptors. The high affinity of type I MR and the rather low concentrations of mineralocorticoid hormones measured under physiologic conditions suggest that day-to-day Na+ balance regulation might be affected by variation of the aldosterone level in the sub-nanomolar range.

Previously, we have shown that concentrations of a few nanomolar of aldosterone were able to induce large effects on the urinary Na+ and K+ excretion in adrenalectomized rats, even in the presence of a background level of glucocorticoid (16). The effect of such aldosterone levels on the expression of AIT in vivo have not yet been reported, and the relationship between the molecular (AIT expression) and the physiologic effects of aldosterone is still unclear. In this study, we have used the same experimental model to assess the effect of nanomolar aldosterone on the mRNA level of three known AIT, namely {alpha}ENaC, Sgk-1, and GILZ, at the level of the whole kidney and in isolated cortical collecting ducts to correlate the modulation of these transcripts with physiologic effects.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Urinary Na+ and K+ Excretion Studies
Urinary electrolyte excretion was measured in a similar manner to the protocol described in Horisberger and Diezi (16). Briefly, male Wistar rats were adrenalectomized under pentobarbital (50 mg/kg) anesthesia. Upon recovery, they were allowed free access to a drinking solution of NaCl 35 mM + sucrose 50 g/L but were deprived of solid food. Twenty-four hours after adrenalectomy, the animals were anesthetized with pentobarbital. Four groups of animals were studied: one group received no steroid hormone (CONTROL), a second group received only aldosterone (ALDO), a third group was treated with dexamethasone (DEX), and a fourth group received both (ALDO+DEX). The animals in the DEX and ALDO+DEX groups received 5 µg/kg of dexamethasone intraperitoneally at the time of anesthesia. Surgical preparation included tracheotomy, cannulation of a jugular vein for intravenous infusion, cannulation of a femoral artery for BP monitoring through a mercury manometer and blood sampling, and suprapubic cannulation of the urinary bladder for urine collection. After cannulation of the jugular vein, an intravenous infusion was started at the rate of 0.72 ml · kg-1 · min-1 for 30 min and then maintained at the rate of 0.36 ml · kg-1 · min-1 for the rest of the experiment. For the DEX and ALDO+DEX groups, the infused solution contained 49 nmol/L (23 µg/L) dexamethasone, resulting in a steady-state delivery of 1.04 µg · kg-1 · h-1 (2.12 nmol · kg-1 · h-1) for the first 30 min and 0.57 µg · kg-1 · h-1 (1.06 nmol · kg-1 · h-1) throughout the rest of the experiment.

A scheme of the experimental protocol is presented in Figure 1. Two hours after the infusion was started (t = 120 min), urine was collected for six 30-min periods. At time t = 150 min (end of the control period), aldosterone was added to the perfusion solution at a concentration of 129 nmol/L (46 µg/L), resulting in a constant delivery of 1 µg · kg-1 · h-1 (or 2.78 nmol · kg-1 · h-1). Blood samples were collected as shown in Figure 1A. Plasma and urinary Na+ and K+ concentrations were measured using a flame spectrometer (Instrument Laboratory IL943).



View larger version (16K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Experimental design. Rats were adrenalectomized 24 h before the start of the experiment. At the start of the experiment, the animals were anesthetized and prepared surgically with cannulation of the jugular vein, femoral artery, and urinary bladder. Time t = 0 was set at the start of the intravenous infusion.

 
Aldosterone and Dexamethasone Plasma Concentrations
The plasma concentrations of aldosterone and dexamethasone resulting from the administration scheme described above were evaluated in another set of experiments. Six rats were prepared exactly according to the same protocol and administered the same amounts of aldosterone and dexamethasone as described for the ALDO group or DEX group, except that radiolabeled steroids were used. The total concentration and specific activity in the infusion solution was 129 nmol/L and 4.94 · 106 DPM/nmol, respectively, for aldosterone. For dexamethasone, the total concentration and specific activity in the infusion solution was 49 nmol/L and 115.8 · 106 DPM/nmol, respectively. After 150 min, 210 min, and 270 min, blood was collected for analysis. Two hundred microliters of serum or 200 µl of the infused solution were added to 5 ml of scintillation liquid and counted in a Packard {beta} counter. Mean aldosterone counts were at 210 min 1604 ± 186 DPM and at 270 min 1569 ± 167 DPM. Mean dexamethasone count was 14187 ± 267 DPM at 150 min, 14944 ± 54 DPM at 210 min, and 15690 ± 194 DPM at 270 min after a mean background value of 28 (± 3) DPM had been subtracted. The plasma steroid concentrations were calculated from known concentrations in the infused solutions and the ratio of the CPM counted in the blood to the CPM counted in the infused solution.

Whole Organ Northern Blot
At the end of the experiment (t = 300 min), animals were killed and the kidneys were removed. Total RNA from frozen kidneys was purified according to Chomczynski and Sacchi (17). Twenty micrograms of RNA was separated on a 1.2% agarose-formaldehyde gel, transferred to a nylon membrane (Ambion), UV cross-linked, and hybridized with the PCR-amplified randomly radiolabeled cDNA probe. cDNA probes for {alpha}ENaC, GILZ, and Sgk-1 were amplified with same primers as for the RT-PCR (Table 1), and GAPDH probe was amplified with the following primers 5': cgtcttcaccaccatggaga and 3' cggccatcacgccacagttt. GAPDH was used as a loading control. The blot was then exposed to MolecularImager screen (BioRad). Signals were quantified using an PhosphoImager (BioRad).


View this table:
[in this window]
[in a new window]

  		Table 1. Primers used for the RT-PCR study
 
Quantitative PCR on Dissected Tubules
For isolation of cortical collecting ducts (CCD), the left kidney was perfused with Dulbecco modified Eagle medium:Ham’s F12 (1:1) (Life Technologies) and 0.07% collagenase (Roche). Microdissection and RNA extraction were performed exactly as described by Elalouf et al. (18). CCD samples were identified by the presence of branching connections, which define the end of the connecting tubule and the start of the CCD. Semiquantitative RT-PCR analysis was carried out on RNA amounts corresponding to 1 mm of CCD. ENaC, GILZ, and Sgk-1 were co-amplified with Dodecenoyl-CoA {delta} Isomerase (DCI) as an internal standard, using the One-Step RT-PCR system (Roche). This gene was selected as an internal standard because it was found to be expressed at about the same transcript copy level as the three genes of interest in CCD cells (15). We also verified by Northern blot that the GAPDH/DCI ratio was not altered by either steroid treatment (see Results). All experimental conditions, including isotope and nucleotide concentrations, were exactly as described by Elalouf et al. (18). Details of the used primers are shown in Table 1. All amplifications were performed at 32 cycles. The amplified PCR fragments were electrophoresed through a 3% agarose vertical slab gel in TBE. The gel was fixed in 10% acetic acid, dried, and exposed with the same screen as the Northern blot.

Data Presentation and Statistical Analyses
Data are presented as mean ± SEM (n = number of observations). Unless stated otherwise, the difference between mean values were analyzed by the two-sided t test for unpaired data.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Aldosterone and Dexamethasone Concentrations
As the purpose of these experiments was to investigate the mechanism of action of mineralocorticoid hormones at physiologic concentrations, we first assessed the steroid plasma concentrations that resulted from our administration scheme. Figure 2 shows the concentration of aldosterone and dexamethasone measured at 150, 210, and 270 min. Dexamethasone, which was administered from the start of the experiment, had already reached a steady state at the time of the first measurement, whereas aldosterone reached its steady state level about 1 h after the start of the infusion. Thus, for both experimental groups receiving dexamethasone, it can be assumed that all the urine collection periods occurred under conditions of a steady approximately 1 nmol/L plasma level of dexamethasone. For the two experimental groups receiving aldosterone, the plasma level of this hormone was zero until the end of the control period, then it rapidly rose during the first hour, reaching a steady state level of approximately 1 nmol/L by the end of the third urine collection period (t = 210 min). It then stayed at this level for the rest of the experiment. It should be noted that the steroid concentrations estimated by DPM counting include metabolites; therefore, the reported values are upper limits rather than absolute values. This experimental model allows one to explore the effects of aldosterone in vivo at a physiologically appropriate range of concentrations (19).



View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Plasma concentrations of aldosterone and dexamethasone. Mean ± SE of the aldosterone (n = 3) and dexamethasone (n = 3) concentrations in plasma collected at the indicated time (see Figure 1). Plasma concentrations were estimated using DPM counts from radiolabeled steroids as described in the Materials and Methods section. The first administration of dexamethasone occurred at the time of anesthesia, i.e., shortly before time t = 0. The administration of aldosterone was started a time t = 150 min (some SE values are smaller than the symbols and cannot be seen).

 
Effect of Aldosterone and Dexamethasone on the Urinary Excretion of Na+ and K+
The effects of aldosterone on urinary Na+ and K+ excretion are described in Figure 3. After the 120-min equilibration period, the rats in all groups had a urinary sodium excretion rate (UNa · V) of about 60 µmol · kg-1 · min-1 and a urinary potassium excretion rate (UK · V) between 5 and 9 µmol · kg-1 · min-1. Except for a slightly lower value of UK · V in the CONTROL group, there were no significant differences between the groups during the two first 30-min periods, i.e., before and during the first period after the addition of aldosterone.



View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. Effects of aldosterone and dexamethasone on urinary sodium and potassium excretion. The mean results of the rate of urinary Na+ (UNa · V) and K+ (UK · V) excretion are shown in the top and bottom panels, respectively. The origin of time (t = 0) is the time of the start of intravenous infusion and initial dexamethasone administration. Aldosterone infusion was started at 150 min (as indicated by the arrow labeled with an A) at the rate of 1 µmol · kg-1 · h-1. The values in six 30-min periods are shown, one control period (t = 120 to 150 min) before and five experimental periods starting after t = 150 min. Dexamethasone was administered as a bolus at the time of anesthesia, i.e., shortly before t = 0, and perfused continuously thereafter. Aldosterone administration started at 150 min. The statistical significance of the differences between the groups was analyzed by ANOVA for the effect of aldosterone and for the effect of dexamethasone. A significant effect of aldosterone is indicated (* P < 0.05; ** P < 0.001), and a significant effect of dexamethasone is indicated (# P < 0.05). The number of measurements was 13, 14, 12, and 14, respectively, for the group that received no steroid (CONTROL), the group that received aldosterone only (ALDO), the group that received dexamethasone only (DEX), and the group that received both steroids (ALDO+DEX).

 
While it was stable or slowly rising in the two groups that did not receive aldosterone (CONTROL and DEX), UNa · V started to decrease in the second period after aldosterone treatment (30 to 60 min) and reached a significantly lower value (P < 0.001 for aldosterone effect, ANOVA) after 60 min of aldosterone treatment in the two groups receiving this hormone (ALDO and ALDO+DEX). The reverse change was observed for the excretion of K+, with UK · V increasing in the ALDO and ALDO+DEX groups by more than twofold, whereas it only increased very slightly in the CONTROL and DEX groups. Figure 3 also indicates that the two groups receiving dexamethasone tended to have a slightly higher Na+ excretion rate than their respective control group (P < 0.05 for a dexamethasone effect, ANOVA) from 210 to 270 min after the start of the experiment.

The BP was similar in all groups and did not change significantly during the course of the experiment. The BP values (average of the values of the mean BP taken at 150, 210, and 270 min) were: CONTROL, 100.6 ± 3.3 mmHg; ALDO, 98 ± 3.8 mmHg; DEX, 98 ± 3.8 mmHg; and ALDO+DEX, 99 ± 3.5 mmHg.

Effect of Aldosterone and Dexamethasone on Transcript Abundance in the Whole Kidney
To establish a correlation between the physiologic effects of aldosterone and the modulation of the transcript level, we performed Northern blot analysis on the whole kidney and hybridized the blot with two well-known aldosterone-induced transcripts, namely the {alpha} subunit of ENaC and Sgk-1, and with the more recently described GILZ (15). The effects of aldosterone and dexamethasone on the mRNA abundance of these three proteins in the whole kidney are depicted in Figure 4. GILZ mRNA levels were threefold to fourfold higher in the ALDO (P < 0.05) and DEX (P < 0.001) groups than in CONTROL, and both hormones together induced a sevenfold increase (P < 0.001). The ENaC {alpha} subunit was induced approximately fourfold over the control by aldosterone (P < 0.05), approximately twofold with dexamethasone (P < 0.05), and approximately threefold with both hormones together (P < 0.01). Sgk-1 was induced eightfold over the control by aldosterone (P < 0.005), fivefold with dexamethasone (P < 0.005), and sevenfold with both hormones together (P < 0.001). The small apparent decrease in GAPDH mRNA content observed in the Aldo group was probably due to a lower loading of the gel rather than to a real change of the GAPDH mRNA abundance by aldosterone treatment as GAPDH is known to be expressed at a constant level (20). This experiment shows that {alpha}ENaC and Sgk-1 mRNA abundance is increased in the whole kidney by both mineralocorticoids and glucocorticoids and that dexamethasone does not induce an additional effect over that reached with 1 nmol/L aldosterone.



View larger version (65K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Transcriptional response of GILZ, {alpha}ENaC, and Sgk-1 determined by Northern blot. (A) Northern blot analysis on the whole kidney of the three proteins of interest (GILZ, {alpha}ENaC, and Sgk-1) and GAPDH, which was used as a loading control. (B) Quantification of the mRNA signals was obtained by PhosphoImager. Mean ± SEM normalized mRNA/GAPDH ratio (value set to 1 for the Control group) for five different rats in each group. * P < 0.05 and ** P < 0.001 for comparison with the control group.

 
Effect of Aldosterone and Dexamethasone on Transcript Abundance in Isolated CCD
It is well known that mineralocorticoid action is restricted to the distal part of the nephron. Therefore, we also performed microdissection experiments to examine the effect of steroids on the level of several AIT in the mineralocorticoid target cells using quantitative RT-PCR with Dodecenoyl-CoA {delta} Isomerase (DCI) as an endogenous internal control for mRNA extraction and PCR amplification. DCI was used as an internal standard because this gene was found to be expressed at about the same transcript copy level as the three genes of interest in CCD cells (15). We also verified by Northern blot that the GAPDH/DCI ratio was not altered by either steroid treatment (Control: 3.8 ± 0.7, n = 10; Aldo: 2.7 ± 0.3, n = 11; Dex: 3.5 ± 0.5, n = 9; Aldo+Dex: 3.1 ± 0.4, n = 11). This allowed us to co-amplifiy each gene of interest with DCI as an internal standard while checking for saturation of the amplification.

The validity of the PCR amplified DNA signal requires similar RT-PCR amplification efficiency for the four genes. Therefore, in preliminary experiments, we checked the linearity and the similarity of the amplification by measuring the amount of DNA formed as a function of the number of PCR cycles. Figure 5 shows constant and similar amplification rates for the four targets up to 32 cycles. We therefore chose a 32-cycle protocol for all the quantitative PCR experiments and compared the mRNA amounts of the three genes of interest with DCI. The GILZ/DCI ratio was the lowest among the three tested transcripts, probably because GILZ is a low-abundance transcript that is detectable by Northern hybridization only in thymus and spleen (14).



View larger version (37K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Comparative RT-PCR co-amplification efficiency of GILZ, {alpha}ENaC, and Sgk-1 mRNA with DCI. PCR assays were performed in the presence of [{alpha}32P] dCTP, aliquots were taken every three cycles from 26 to 35 cycles. (A) Aliquots were loaded in a 3% agarose gel, fixed in 10% acetic acid, dried, and exposed on a MolecularImager screen. ENaC {alpha} subunit is 528-bp-long, Sgk-1 is 606-bp-long, GILZ is 261-bp-long, and DCI is 695-bp-long. (B, C, and D) Amounts of incorporated {alpha}32P expressed as a function of the number of PCR cycles. 32 cycles has been used for the rest of the experiment.

 
As shown in Figure 6, GILZ mRNA was induced threefold by aldosterone (P < 0.01), more than twofold by dexamethasone (P < 0.05), and fivefold by aldosterone and dexamethasone together (P < 0.001). The {alpha} subunit of ENaC mRNA was induced threefold by aldosterone (P < 0.01), more than twofold by dexamethasone (P < 0.05), and 3.5-fold by aldosterone and dexamethasone together (P < 0.001). Finally, Sgk-1 mRNA was increased by about threefold by aldosterone (P < 0.001), but dexamethasone alone had no effect. The effect of aldosterone was similar with or without dexamethasone.



View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. Abundance of mRNA of GILZ, {alpha}ENaC, and Sgk-1 determined by RT-PCR. Analysis of microdissected tubules (CCD). mRNA signal was normalized to DCI as a internal control (see results). Panel A shows the results of one PCR experiment in which tubule samples from five different rats for each treatment group were analyzed. (B) Mean ± SEM (n between 14 and 21 in each case) normalized values of the test protein/DCI signal ratio (value set to 1 for the Control group) obtained with a 1-mm length of CCD from five to seven different rats in each treatment group and for two to five PCR experiments for each rat. Statistical analysis was first performed using ANOVA to demonstrate a significant effect of hormonal treatment. Each experimental group was then compared with the control group using the t test for unpaired data, and the results of these comparisons are reported in the graph (* P < 0.05; ** P < 0.001).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The existence of two types of receptors for mineralocorticoid hormones has been known and well demonstrated for a long time, and there is good evidence supporting a role for both of them in the natriuretic response to aldosterone (3,21,22). The question of the specific signal transduction pathway downstream of the binding of the steroid to each of these receptors has been much more difficult to solve. One problem has been the difficulty to obtain precise values of the binding affinities of mineralocorticoid and glucocorticoid steroids to both types of receptor. The values of the affinity of aldosterone reported in the literature vary considerably, from 0.3 to 4 nM for the MR and from 14 to 60 nM for the GR. Dexamethasone, a pharmacologic glucocorticoid, has been shown to have a high affinity for the GR, around 1 nM, but its affinity for the MR has been more difficult to define due to the much lower number of MR sites in natural tissues. Recent studies with artificial expression of MR and GR (8,23) have allowed more precise determination of binding parameters; however, some issues remain open. While the equilibrium binding measurements demonstrate a roughly similar Kd for MR of aldosterone and dexamethasone (0.5 and 0.7 nM, respectively), other parameters such as protection from proteolysis or transactivation activities demonstrated an apparent affinity two or three orders of magnitude lower for dexamethasone (8). It is probable that the effective binding of dexamethasone to MR leading to activation of the receptor is strongly limited by a fast dissociation rate (8).

Our present approach to answering these questions was to correlate plasma level of steroids with physiologic effects and modulation of mRNA abundance. A plasma concentration of 1 nmol/L of aldosterone was sufficient to produce large effects on the urinary electrolyte excretion.

Due to the limitations of the present study that uses a single concentration in vivo, it is not possible to reach firm conclusions about the occupancy of the two types of receptor. However, receptor occupancy under our experimental circumstances can be roughly estimated from published affinity values with the assumption that the intracellular and the extracellular concentrations of aldosterone were similar. These estimations are consistent with the known high affinity of aldosterone for MR (3,6–8). The 1 nmol/L concentration of aldosterone should occupy between 77% and 25% of the MR (calculated from a 0.3 to 3 nmol/L Kd range, respectively). Assuming a linear relationship between occupancy and effect, the contribution of GR in the aldosterone response is probably small because the used concentration of aldosterone should occupy only 1.5% to 6% of GR (that can be estimated from the 15 to 60 nmol/L range of Kd values [3,4]). Furthermore, this contribution seems even less likely considering the fact that the presence of dexamethasone, which clearly has a higher affinity than aldosterone for GR (8), makes essentially no difference to the aldosterone effect on the urinary Na/K excertion, while dexamethasone has by itself significant effects on mRNA abundance of several proteins (see below). These short-term observations do not exclude the possibility that occupancy of the GR at higher aldosterone concentrations could enhance the mineralocorticoid response or may be necessary for maintenance of a long-term response.

Exposure to a 1 nM concentration of dexamethasone resulted in the CCD in a rise of the GILZ and {alpha}ENaC mRNA levels, but no antinatriuretic effect was observed, suggesting that these responses may be permissive, i.e., may be needed for an enhanced early and/or prolonged response, but are not sufficient by themselves to generate the early mineralocorticoid response. Dexamethasone has been reported to be metabolized by the 11{beta}-OH-steroid dehydrogenase type II, but rather inefficiently (24). The observed effects on transcripts abundance in the isolated CCD show that our administration scheme, and the resulting plasma concentrations, resulted in intracellular dexamethasone concentrations that were sufficient to occupy GR, at least partially. The small, but significant natriuretic effect of dexamethasone that was observed could be due to a glucocorticoid action in any segment of the nephron or be secondary to a cardiovascular effect of glucocorticoids, but we cannot determine from the present data the mechanism of this effect. It is probably not due to mineralocorticoid antagonism at the level of the CCD, because the same higher level of Na+ excretion was observed in the DEX versus CONTROL group and in the ALDO+DEX versus ALDO group. In addition, the antinatriuretic and kaliuretic effects of aldosterone were not decreased by the presence of dexamethasone.

It is interesting to compare the pattern of stimulation in the whole kidney and in isolated CCD. This pattern is different for Sgk-1 and for {alpha}ENaC or GILZ. In the CCD, and within the physiologic range of doses explored in the present study, Sgk-1 stimulation is clearly aldosterone-specific. In contrast, in the whole kidney, dexamethasone is also able to induce Sgk-1. Because MR is present only in the distal nephron, these observations indicate that the stimulation observed in the whole kidney is mostly due to GR occupancy. It thus seems most probable that the increased expression of Sgk-1 observed at the level of the whole kidney after either glucocorticoid treatment or high doses of aldosterone is not related to the mineralocorticoid effects.

The absence of effect of dexamethasone on the level of Sgk-1 mRNA in the isolated CCT is surprising considering that this steroid can clearly increase this mRNA species in other part of the kidney, as seen on the whole kidney analysis. As other mRNA species are modified in the CCT by dexamethasone, indicating, as discussed above, a significant level of receptor occupancy, it seems improbable that this lack of effect is due to a low intracellular level of this steroid resulting from the effect 11{beta}-OH-steroid dehydrogenase type II. As the level of RNA was examined only 5 h after the initial administration of dexamethasone, it can be argued that a transient increase in Sgk-1 mRNA may have been missed. Indeed the short half-life of aldosterone and of Sgk-1 mRNA results in a transient expression of Sgk-1 upon single-dose administration of aldosterone (25–27). However, when aldosterone was administered continuously, a high level of Sgk-1 mRNA was observed for 6 and 21 d (28). Rabbit CCD cells continuously exposed to 10 nM aldosterone showed a sustained response of Sgk-1 mRNA abundance with a level at 24 h still about 50% of the maximal reponse recorded at 2 h (12), and a significant increase of Sgk-1 mRNA was seen in A6 cells 6 h after treatment with 100 µM dexamethasone (29). In addition, even a single dose of dexamethasone (0.5 mg/kg) resulted in a sustained increase in Sgk-1 mRNA in rat kidney (25). Thus, it seems very unlikely that the continuous intravenous administration of steroids used in our experiments would result in only a transient increase of Sgk-1 mRNA that then returns to baseline value within 5 h. One has to conclude that the Sgk-1 mRNA level is not under the control of GR alone in the CCT cells as it is seems to be in other kidney cells. The requirement for homodimeriztion or heterodimerization of the activated steroid receptors and for cell-specific cofactors (30) may allow for a cell type–specific modulation of their transcriptional effects. It will be difficult to investigate these questions until a CCT cell line with biochemical and physiologic responses to corticosteroid similar to those observed in vivo (i.e., a strong electrolyte transport response to nM concentrations of aldosterone and no response to glucocorticoids) is available.

Our experiments only detected an increase of the mRNA level in the isolated CCT. They do not allow to determine the mechanism, transcriptional or post-transcriptional, of these effects, nor to conclude to a change of the protein expression level, which would need methods allowing to determine quantitatively the level of the Sgk-1 protein at the tubule segment level.

With ENaC, a similar pattern of stimulation was observed in the whole kidney and in the isolated CCD. However, as ENaC is expressed mostly in the distal segments of the nephron (31), the results on the whole kidney probably reflect essentially what happens in these segments.

The observation that the level of the mRNA coding for one ENaC subunit can be increased by glucocorticoid in the kidney is consistent with the recent demonstration that glucocorticoid treatment was able to increase the mRNA abundance for the three subunits of ENaC and to stimulate Na+ transport in isolated CCD and colon epithelium from MR knockout mice (32) and with absence of changes in the ENaC subunit transcripts in MR knockout mice (9). In the near future, the relative role of mineralocorticoid and glucocorticoid in triggering the Na/K response via MR and/or GR should be studied in nephron segment-specific (i.e., CCD) knockout animals using the Cre-lox technology (33), allowing a much more precise evaluation of their respective physiologic roles in sodium balance and homeostasis.

Variations of the aldosterone plasma level in the 0 to 1 nmol/L range have major effects on the urinary Na+ and K+ excretion, while similar concentrations of glucocorticoid do not. These aldosterone concentrations occur through the circadian cycle (34) and are due to "normal" day-to-day variations of the ECF volume. We show that, in this physiologic range of concentrations, aldosterone modulates mRNA level for several proteins, including Sgk-1, {alpha}ENaC, and GILZ. While the increased level of Sgk-1 mRNA in the CCT is correlated with the early antinatriuretic and kaliuretic effects of aldosterone, the higher level of {alpha}ENaC and GILZ mRNAs is not sufficient by itself to modify urinary electrolyte excretion. These proteins may rather be involved in the late phase response to aldosterone. Higher levels of aldosterone may further induce other proteins such as the {alpha}ENaC subunit and GILZ (as demonstrated in this work) or the Na,K-ATPase {alpha} and {beta} subunits (35) and energy metabolism enzymes (22,36) through activation of type II receptors (GR).


   Acknowledgments
 
This work was supported by the Human Frontier Science Foundation (HFSP) grant RG 0261 to JDH and by the Swiss "Fonds National de la Recherche Scientifique," Grant # 3100–065140.1 to DF. OM was supported in part by a fellowship from the Botnar Foundation. We are grateful to K. Geering, L. Schild, and M. A. Thomas for careful reading of the manuscript and providing helpful suggestions.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Verrey F, Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, Zecevic M: Pleiotropic action of aldosterone in epithelia mediated by transcription and post-transcription mechanisms. Kidney Int 57: 1277–1282, 2000[CrossRef][Medline]
  2. Stockand JD: New ideas about aldosterone signaling in epithelia. Am J Physiol Renal Physiol 282: F559–F576, 2002[Abstract/Free Full Text]
  3. Rossier BC, Geering K, Atkinson J, Roch-Ramel F: Renal receptors. In: The Kidney: Physiology and Pathophysiology, edited by Seldin DW, Giebisch G, New York, Raven Press, 1985, pp 775–806
  4. Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, Evans RM: Cloning of human mineralocorticoid receptor complementary DNA: Structural and functional kinship with the glucocorticoid receptor. Science 237: 268–275, 1987[Abstract/Free Full Text]
  5. Weinberger C, Hollenberg SM, Ong ES, Harmon JM, Brower ST, Cidlowski J, Thompson EB, Rosenfeld MG, Evans RM: Identification of human glucocorticoid receptor complementary-DNA clones by epitope selection. Science 228: 740–742, 1985[Abstract/Free Full Text]
  6. Claire M, Rafestin-Oblin M-E, Michaud A, Corvol P, Venot A, Roth-Meyer C, Boisvieux JF, Mallet A: Statistical test of models and computerised parameter estimation for aldosterone binding in rat kidney. FEBS Lett 88: 295–299, 1978[CrossRef][Medline]
  7. Fagart J, Wurtz JM, Souque A, Hellal-Levy C, Moras D, Rafestin-Oblin M-E: Antagonism in the human mineralocorticoid receptor. EMBO J 17: 3317–3325, 1998[CrossRef][Medline]
  8. Hellal-Levy C, Couette B, Fagart J, Souque A, Gomez-Sanchez C, Rafestin-Oblin M-E: Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett 464: 9–13, 1999[CrossRef][Medline]
  9. Berger S, Bleich M, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W, Warth R, Greger R, Schutz G: Mineralocorticoid receptor knockout mice — Pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95: 9424–9429, 1998[Abstract/Free Full Text]
  10. Spindler B, Mastroberardino L, Custer M, Verrey F: Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434: 323–331, 1997[CrossRef][Medline]
  11. Pearce D, Verrey F, Chen SY, Mastroberardino L, Meijer OC, Wang J, Bhargava A: Role of SGK in mineralocorticoid-regulated sodium transport. Kidney Int 57: 1283–1289, 2000[CrossRef][Medline]
  12. Naray-Fejes-Tóth A, Canessa CM, Cleaveland ES, Aldrich G, Fejes-Tóth G: sgk is an aldosterone-induced kinase in the renal collecting duct — Effects on epithelial Na+ channels. J Biol Chem 274: 16973–16978, 1999[Abstract/Free Full Text]
  13. Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Münster C, Chraïbi A, Pratt JH, Horisberger J-D, Pearce D, Loffing J, Staub O: Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na+ channel cell surface expression. EMBO J 20: 7052–7059, 2001[CrossRef][Medline]
  14. D’Adamio F, Zollo O, Moraca R, Ayroldi E, Bruscoli S, Bartoli A, Cannarile L, Migliorati G, Riccardi C: A new dexamethasone-induced gene of the leucine zipper family protects T lymphocytes from TCR/CD3-activated cell death. Immunity 7: 803–812, 1997[CrossRef][Medline]
  15. Robert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger J-D, Vandewalle A, Rossier BC, Firsov D: Transcriptome of a mouse kidney cortical collecting duct cell line: Effects of aldosterone and vasopressin. Proc Natl Acad Sci USA 98: 2712–2716, 2001[Abstract/Free Full Text]
  16. Horisberger J-D, Diezi J: Effects of mineralocorticoids on Na+ and K+ excretion in the adrenalectomized rat. Am J Physiol 245: F89–F99, 1983
  17. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction. Anal Biochem 162: 156–159, 1987[Medline]
  18. Elalouf JM, Buhler JM, Tessiot C, Bellanger AC, Dublineau I, Derouffignac C: Predominant expression of beta-1-adrenergic receptor in the thick ascending limb of rat-kidney — Absolute messenger-RNA quantitation by reverse transcription and polymerase chain reaction. J Clin Invest 91: 264–272, 1993
  19. Weber KT: Mechanisms of disease — Aldosterone in congestive heart failure [Review]. New Engl J Med 345: 1689–1697, 2001[Free Full Text]
  20. Choi YS, Dubel SJ, Pacioaiou ML, Omori A, Ito T, Copeland TD, Takahashi M, Mcenery MW: Parallel detection of Na, K-atpase alpha subunit isoforms by pan-specific monoclonal mab 9a7. Arch Biochem Biophys 344: 165–175, 1997[CrossRef][Medline]
  21. Geering K, Claire M, Gaeggeler H-P, Rossier BC: Receptor occupancy vs induction of Na-K-ATPase and Na+ transport by aldosterone. Am J Physiol 248: C102–C108, 1985
  22. Rossier BC, Paccolat MP, Verrey F, Kraehenbühl J-P, Geering K: Mechanism of action of aldosterone: A pleiotrophic response. In: Hormones and Cell Regulation, edited by Dumont JE, Hamprecht B, Nunez J, Amsterdam, Elsevier, 1985, pp 209–225
  23. Hellal-Levy C, Fagart J, Souque A, Rafestin-Oblin M-E: Mechanistic aspects of mineralocorticoid receptor activation. Kidney Int 57: 1250–1255, 2000[CrossRef][Medline]
  24. Woitge HW, Harrison JR, Ivkosic A, Krozowski Z, Kream BE: Cloning and in vitro characterization of alpha 1(I)-collagen 11 beta-hydroxysteroid dehydrogenase type 2 transgenes as models for osteoblast-selective inactivation of natural glucocorticoids. Endocrinology 142: 1341–1348, 2001[Abstract/Free Full Text]
  25. Brennan FE, Fuller PJ: Rapid upregulation of serum and glucocorticoid-regulated kinase (sgk) gene expression by corticosteroids in vivo. Mol Cell Endocrinol 166: 129–136, 2000[CrossRef][Medline]
  26. Bhargava A, Fullerton MJ, Myles K, Purdy TM, Funder JW, Pearce D, Cole, TJ: The serum- and glucocorticoid-induced kinase is a physiological mediator of aldosterone action. Endocrinology 142: 1587–1594, 2001[Abstract/Free Full Text]
  27. Loffing J, Zecevic M, Feraille E, Kaissling B, Asher C, Rossier BC, Firestone GL, Pearce D, Verrey F: Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am J Physiol Renal Fluid Electrolyte Physiol 280: F675–F682, 2001[Abstract/Free Full Text]
  28. Hou JH, Speirs HJL, Seckl JR, Brown RW: Sgk1 gene expression in kidney and its regulation by aldosterone: Spatio-temporal heterogeneity and quantitative analysis. J Am Soc Nephrol 13: 1190–1198, 2002[Abstract/Free Full Text]
  29. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D: Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514–2519, 1999[Abstract/Free Full Text]
  30. Farman N, Rafestin-Oblin M-E: Multiple aspects of mineralocorticoid selectivity. Am J Physiol Renal Fluid Electrolyte Physiol 280: F181–F192, 2001[Abstract/Free Full Text]
  31. Duc C, Farman N, Canessa CM, Bonvalet J-P, Rossier BC: Cell-specific expression of epithelial sodium channel {alpha}, {beta}, and gamma subunits in aldosterone-responsive epithelia from the rat: Localization by in situ hybridization and immunocytochemistry. J Cell Biol 127: 1907–1921, 1994[Abstract/Free Full Text]
  32. Schulz-Baldes A, Berger S, Grahammer F, Warth R, Goldschmidt I, Peters J, Schutz G, Greger R, Bleich M: Induction of the epithelial Na+ channel via glucocorticoids in mineralocorticoid receptor knockout mice. Pflügers Arch 443: 297–305, 2001[CrossRef][Medline]
  33. Hummler E, Merillat AM, Rubera I, Rossier BC, Beermann F: Conditional gene targeting of the Scnn1a ({alpha}ENaC) gene locus. Genesis 32: 169–172, 2002[CrossRef][Medline]
  34. Maggioni C, Lucini D, Antinozzi R, Pagani M: Circadian rhythm of ANP, aldosterone and PRA in normotensive IUGR. J Hypertens 19: 1659–1664, 2001[CrossRef][Medline]
  35. Rossier BC, Geering K, Kraehenbühl J-P: Mechanism of action of aldosterone: Role of Na-K-ATPase. In: Nephrology: Proceedings of the IXth International Congress of Nephrology, Los Angeles, June 1984, edited by Robinson RR, New York, Springer, 1984, pp 388–396
  36. Kirsten E, Kirsten R, Leaf A, Sharp GWG: Increased activity of enzymes of the tricarboxylic acid cycle in response to aldosterone in the toad bladder. Pflügers Arch 300: 213–225, 1968[CrossRef]
Received for publication September 2, 2002. Accepted for publication January 26, 2003.




This article has been cited by other articles:


Home page
 J. Am. Soc. Nephrol.Home page
J. E. Goodwin, J. Zhang, and D. S. Geller
A Critical Role for Vascular Smooth Muscle in Acute Glucocorticoid-Induced Hypertension
J. Am. Soc. Nephrol., July 1, 2008; 19(7): 1291 - 1299.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
G. Fejes-Toth, G. Frindt, A. Naray-Fejes-Toth, and L. G. Palmer
Epithelial Na+ channel activation and processing in mice lacking SGK1
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1298 - F1305.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
L. Adler, E. Efrati, and I. Zelikovic
Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene
Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1261 - C1276.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
R. F. Husted, K. A. Volk, R. D. Sigmund, and J. B. Stokes
Discordant effects of corticosteroids and expression of subunits on ENaC activity
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F813 - F820.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
P. Sun, D.-H. Lin, T. Wang, E. Babilonia, Z. Wang, Y. Jin, R. Kemp, A. Nasjletti, and W.-H. Wang
Low Na intake suppresses expression of CYP2C23 and arachidonic acid-induced inhibition of ENaC
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1192 - F1200.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
V. Bhalla, R. Soundararajan, A. C. Pao, H. Li, and D. Pearce
Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F714 - F721.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Liang, K. W. Peters, M. B. Butterworth, and R. A. Frizzell
14-3-3 Isoforms Are Induced by Aldosterone and Participate in Its Regulation of Epithelial Sodium Channels
J. Biol. Chem., June 16, 2006; 281(24): 16323 - 16332.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Soundararajan, T. T. Zhang, J. Wang, A. Vandewalle, and D. Pearce
A Novel Role for Glucocorticoid-induced Leucine Zipper Protein in Epithelial Sodium Channel-mediated Sodium Transport
J. Biol. Chem., December 2, 2005; 280(48): 39970 - 39981.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
P. J. Fuller and M. J. Young
Mechanisms of Mineralocorticoid Action
Hypertension, December 1, 2005; 46(6): 1227 - 1235.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
O. Staub and F. Verrey
Impact of Nedd4 Proteins and Serum and Glucocorticoid-Induced Kinases on Epithelial Na+ Transport in the Distal Nephron
J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3167 - 3174.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
J. Loffing and L. Schild
Functional Domains of the Epithelial Sodium Channel
J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3175 - 3181.
[Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
S. Y. Flores, D. Loffing-Cueni, E. Kamynina, D. Daidie, C. Gerbex, S. Chabanel, J. Dudler, J. Loffing, and O. Staub
Aldosterone-Induced Serum and Glucocorticoid-Induced Kinase 1 Expression Is Accompanied by Nedd4-2 Phosphorylation and Increased Na+ Transport in Cortical Collecting Duct Cells
J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2279 - 2287.
[Abstract] [Full Text] [PDF]

Home page
 Exp PhysiolHome page
N. Marissal-Arvy and P. Mormede
Excretion of electrolytes in Brown Norway and Fischer 344 rats: effects of adrenalectomy and of mineralocorticoid and glucocorticoid receptor ligands
Exp Physiol, November 1, 2004; 89(6): 753 - 765.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muller, O. G.
Right arrow Articles by Horisberger, J.-D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muller, O. G.
Right arrow Articles by Horisberger, J.-D.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP