 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
CLINICAL SCIENCE |
*Division of Kidney and Hypertension, Department of Internal Medicine, Jikei University School of Medicine, Tokyo, Japan; Department of Pharmacology and Toxicology, Kyorin University School of Medicine, Tokyo, Japan; Department of Cardiovascular Medicine, Tottori University, Yonago, Japan; and Department of Clinical Preventive Medicine, Nagoya University School of Medicine, Nagoya, Japan.
Correspondence to Kimiyoshi Ichida, Division of Kidney and Hypertension, Department of Internal Medicine, Jikei University School of Medicine, 3–25–8 Nishishimbashi, Minato-ku, Tokyo 105–8461, Japan. Phone: 81-33433-1111 ext. 3221; Fax: 81-33433-4297;
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Renal hypouricemia has been classified into the following five types according to responses to the anti-uricosuric drug pyrazinamide, and the uricosuric drug, probenecid: (a) a pre-secretory reabsorptive defect with an attenuated response to both pyrazinamide and probenecid (3); (b) a post-secretory reabsorptive defect when pyrazinamide suppressible urate clearance (CUA) is not influenced by probenecid (7); (c) total inhibition of urate reabsorption when pyrazinamide induces elimination of CUA exceeding the rate of glomerular filtration (8); (d) enhanced secretion when the pyrazinamide suppressible CUA is increased by probenecid (9); and (e) subtotal defect in urate transport without any response to either pyrazinamide or probenecid (10).
The four-component hypothesis and the classification of renal hypouricemia are rather complicated and have presumed that pyrazinamide inhibits urate secretion. However, some reports using membrane vesicles have recently indicated that the anti-uricosuria induced by pyrazinamide was due to enhanced urate reabsorption through exchange of its active metabolite, pyrazine carboxylic acid (PZA), via the urate/anion exchanger at the brush-border membrane (11–13). Reconsideration of the four-component hypothesis and the classification of renal hypouricemia are crucial. Therefore, a classification based on gene mutations in SLC22A12 and prospective urate transporter genes is needed.
Although membrane vesicles studies have suggested that a voltage-sensitive pathway and urate exchangers are located at both the apical and basolateral membranes of proximal tubule cells (12–14), no transporters have been identified that alter serum urate levels and urinary urate excretion in vivo. We recently cloned urate transporter 1 (URAT1 encoded by SLC22A12), located at the apical membrane in the proximal tubules. We also demonstrated that URAT1 regulates serum urate levels by showing that three patients with renal hypouricemia have defects in SLC22A12 (15). The following questions remain: (a) What proportion of renal hypouricemia cases have SLC22A12 defects? and (b) What variation of mutations exist in SLC22A12?
In this study, we elucidated clinical and genetic features of renal hypouricemia and the significance of URAT1 in maintaining serum urate levels in vivo using 32 unrelated patients. In addition, we performed loading tests with the anti-uricosuric drug pyrazinamide and the uricosuric drugs probenecid and benzbromarone in a number of the patients to establish URAT1 as the active site of pyrazinamide, probenecid, and benzbromarone for urate transport modification in vivo.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Methods
Pyrazinamide, probenecid, and benzbromarone loading tests were conducted according to the methods previously described (16–18). Serum urate, CUA, and creatinine clearance (Ccr) were measured before and after administration of 3g of pyrazinamide, 2 g of probenecid, or 100 mg of benzbromarone.
Genomic DNAs of the patients were isolated from peripheral blood cells using a QIAGEN blood and cell culture DNA kit (Qiagen, Hilden, Germany) for direct sequencing (19). Using primers designed from the sequences of the introns, the entire genomic DNA sequences equivalent to the open reading frame of URAT1 cDNA were determined (Table 1).
|
When two different mutations in SLC22A12 were identified, we performed PCR in which the DNA products included the two mutations; the primers in Table 1 were used to identify whether one SLC22A12 mutation and another SLC22A12 mutation were located on the same allele or not. We direct-sequenced several clones after the amplified DNA fragment was subcloned using TOPO XL PCR Cloning Kit (Invitrogen, San Diego, CA).
For the construction of a missense mutant, we used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The mutagenic oligonucleotide primers for generation of G269A, G412A, G490A, A1145T, T1298C, and deletion of 1639–1643 mutants were: 5'-GAGGCCCCATCAGTGCCGCC(A)CTTCCGCCAG CCACAGTGGCAGC-3', 5'-CGTGGCCAAGTGGAACCTC(A)TGTGTGACTCTCACGCTCTGAAGCC-3', 5'-CTGGTGGGAGCTGCTGCGTGC(A)GCCCTGCCTCAGACAGGTTTGGG-3', 5'-GGG CAGCAACATCTTCCTGCTCC(T)AATGTTCATTGGTGTCGTG G-3', 5'-CACGCTGGTGCCCCACGAAA(C)GGGGGCTCTGCGCT CAGCCTTG-3', and 5'-CATGGCACGCTGGGGAACTCT()AAAATCCACACAGTTTTAGCCTCC-3', respectively (sense strands; mutated nucleotides are in parentheses). Proper construction of the mutated cDNA was confirmed by complete sequencing.
URAT1 mutant cRNA was synthesized, using an mMESSAGE mMACHINE kit (Ambion, Inc., Austin, TX), from each linearized URAT1 mutant cDNA by NotI. Poly (A)+ tail was added using Poly (A) Tailing kit (Ambion). The injection of 50 ng of wild-type or mutant URAT1 cRNA into Xenopus leavis oocytes and maintenance of the oocytes and uptake studies were performed as described previously (15,20). Uptake studies were performed at room temperature in ND96 (in mM: 96 NaCl, 2.0 KCl, 1.8 CaCl2, 1.0 MgCl2, 5.0 HEPES, pH 7.4) containing 10 µM 14C-urate (1.85 to 2.22 GBq/mmol; American Radiolabeled Chemicals, Inc., St. Louis, MO) and 100 µM cold urate. After uptakes were stopped and washed five times with ice-cold ND96, pH 7.4, each oocyte solubilized with 200 µl of 10% SDS was mixed with 2.5 ml of Aquasol-2 (Packard, Meriden, CT) for radioactivity determination using a scintillation counter (LC-3010; ALOKA, Tokyo, Japan).
The subcellular localization of URAT1 mutants was determined by immunocytochemical analysis. Anti-URAT1 N-terminal polyclonal antibody was obtained as 1.705 mg/ml of IgG fraction by immunization of rabbit with a keyhole limpet hemocyanin-conjugated synthetic peptide SELLDLVGGLGR, corresponding to URAT1 amino acid sequence 4–15, and by peptide affinity-purification. Xenopus oocytes, which were injected with 50 ng of wild-type or mutant URAT1 cRNA and cultured for 3 d at 18°C, were fixed in 4% paraformaldehyde in ND96 for 30 min at room temperature. Three-micrometer paraffin sections were stained with anti-URAT1 N-terminal antibody (1:100), followed by staining with Cy5-conjugated anti-rabbit IgG (1:200; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Images were visualized by a confocal laser microscope (FLUOVIEW FV500; Olympus Co., Tokyo, Japan).
Values for clinical data were expressed as mean ± SD. The experiments for urate uptake of URAT1 mutant in vitro were performed using three batches of oocytes, and results from the representative experiments were expressed as means ± standard errors, respectively. Statistical analyses were performed using the unpaired t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Two nonsense mutations, both G774A and C889T within exon 4 and 5 of SLC22A12, produce a truncated protein that lacks half of the mature protein. The G774A mutation was identified in 40 (74.1%) of 54 affected SLC22A12 alleles, 11 homozygotes, 13 compound heterozygotes, and 5 heterozygotes (Table 2). The splice-site mutation (IVS2 + 1G
A) modifies the GT donor splice site of intron 2, suggesting aberrant splicing in this patient.
All of the six missense mutations were localized within the putative transmembrane domains (G164S, T217M, and Q382L) or within the putative intracellular loops (R90H, V138M, and M430T) (Figure 1). None of the missense mutations lie within the extracellular loops of the URAT1 protein. Four of six single–amino acid residue mutations of SLC22A12 (R90H, V138M, G164S, and Q382L) alter residues that are conserved in URAT1 and OAT4 encoded by SLC22A11. G269A and G412A were identified in 5 (9.3%) and 2 (3.7%) of 54 affected SLC22A12 alleles, respectively, and G650T we previously reported in one (1.6%).
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The incidence rates of exercise-induced acute renal failure and urolithiasis in patients with renal hypouricemia have not been adequately determined to date, despite the fact that most renal hypouricemic patients have been identified from the onset of these two conditions (18,22,23). The reported incidence rate of renal hypouricemia is 0.12% (5), and fewer than 70 patients with renal hypouricemia have been reported to develop exercise-induced acute renal failure in Japan. Accordingly, the perceived incidence rate of exercise-induced acute renal failure in patients with renal hypouricemia has been extremely lower than our frequency of 9.4%. A number of patients with renal hypouricemia who developed exercise-induced acute renal failure might have been overlooked due to the fact that the serum urate levels in these patients increase to the normal to high-normal range, during an exercise-induced acute renal failure episode. How renal hypouricemia accounts for exercise-induced acute renal failure remains an open question. Two mechanisms have been proposed: either urate nephropathy results from an increase in urate production during exercise (6,18), or renal reperfusion injury due to vasoconstriction results from an exercise-induced increase in oxygen free radicals and a lack of urate, free radical scavengers (24). The first hypothesis raises an interesting question; why has tubular urate precipitation been identified in renal biopsy specimens of only one (6) of these renal hypouricemic patients with exercise-induced acute renal failure (25–28)? Conversely, with regards to the second hypothesis, why has exercise-induced acute renal failure not been reported in xanthinuric patients who lack xanthine dehydrogenase and whose serum urate levels are almost 1 mg/dl or below, similar to renal hypouricemic patients? As SLC22A12 renal hypouricemia is proven to be primarily responsible for the renal hypouricemia documented in this study, we need to reconsider the mechanism from the viewpoint of URAT1 functional loss. Although it is difficult to obtain evidence for these hypotheses, understanding this mechanism may provide insights into other etiologies of acute renal failure.
The prevalence of urolithiasis is approximately 2 to 3% in the general population; however, 12.5% of the patients in this study had a history of urolithiasis. This high prevalence is probably related to the increased amount of urinary urate in these patients compared with healthy subjects, because the correlation of urinary urate with the prevalence of urolithiasis is well known (29,30). Renal hypouricemia should be recognized as one of the diseases to consider that leads to the formation of kidney stones.
This study demonstrated that URAT1 was responsible for most of the renal hypouricemia, especially severe renal hypouricemia with serum urate levels of 1.0 mg/dl or less. We also demonstrated a gene dosage effect of SLC22A12 on CUA/Ccr, correlating with the difference in serum urate levels, despite the possibility that some renal hypouricemia alleles lacking mutations may be explained by large deletions or insertions, mutations in the promoter region, or mutations in intron sequences that were not screened. These facts indicate that URAT1 acts as the most significant renal tubular urate transporter for reabsorption and fluctuations of serum urate levels in vivo. Additionally, the fact that 24 of 30 patients had homozygous or compound heterozygous SLC22A12 mutations indicates that SLC22A12 renal hypouricemia is autosomal recessive in principle, which is compatible with previous reports (22,31). In contrast, the present study showed individual variability in the SLC22A12 renal hypouricemia phenotype, as illustrated by the different CUA/Ccr and serum urate levels. For example, the homozygous G774A mutations resulted in variable CUA/Ccr values from 0.466 to 1.295. We preliminarily found some healthy subjects with the heterozygous G774A mutation whose serum urate level and CUA/Ccr were in the lower normal range (data not shown). This variability and both phenotypes, normouricemia and hypouricemia, in subjects with heterozygous SLC22A12 mutations suggest that other environmental and/or genetic factors affect CUA/Ccr and serum urate levels.
Functional analysis showed that five new missense mutations and the 5-bp deletion out of eight new mutations resulted in loss of urate transport activity. T1289C and 1639-1643del mutant proteins were present only at the plasma membrane, as demonstrated by immunocytochemical analysis. These finding indicate that impaired routing of URAT1 to the cell surface might be related with the loss of function in T1289C and 1639-1643del mutants. URAT1 has PDZ binding motifs at the C terminus, suggesting that URAT1 interacts with a multiple PDZ protein. PDZ domains are often involved in scaffolding protein complexes at plasma membranes, maintaining cell polarity, and signal transduction (32). Further investigation is needed, including identification of the PDZ protein that interacts with the PDZ domain of URAT1, and the interaction of URAT1 with the PDZ protein.
The new splice-site mutation (IVS2 + 1GA) should not induce urate transport activity by modification of the GT donor splice site of intron 2. Accordingly, all of the mutations in this study, including the new nonsense C889T mutation and missense C650T mutation previously reported (15), should lack urate transport activity. These analyses correspond to the phenotype of our patients with SLC22A12 renal hypouricemia. Interestingly, the G774A mutation accounts for 74.1% of SLC22A12 mutations in our patients. The G774A mutation could have occurred in ancient history and spread over Japan such as the APRT *J mutation of the adenine phosphoribosyltransferase gene (33). Out of 32 patients, two patients without any SLC22A12 mutation were natives of the Chuugoku region in the western part of Japan. Accordingly, the variation of SLC22A12 mutations and the frequency of SLC22A12 renal hypouricemia would differ somewhat in the area.
Guggino et al. (11) and Roch-Ramel et al. (13) suggested that the anti-uricosuric effect of PZA was due to enhanced urate reabsorption through exchange of PZA via the urate/anion exchanger at the brush-border membrane after PZA moved into proximal cells by sodium-cotransport. In contrast, benzbromarone was suggested to inhibit urate reabsorption from the lumen side via the same urate/anion exchanger used by PZA (13, 34). Using Xenopus oocytes injected with URAT1 complementary RNA, we demonstrated that urate is reabsorbed via URAT1 in exchange for organic anions such as lactate at the apical membrane, that URAT1 has affinity for both uricosuric and anti-uricosuric drugs such as benzbromarone, probenecid, and PZA, and that urate uptake was trans-stimulated by PZA (15). The typical responses for pyrazinamide, benzbromarone, and probenecid loading tests were not observed in the homozygotes and compound heterozygotes. From the absence of these drugs’ effects in these patients, we concluded that pyrazinamide, benzbromarone, and probenecid act on URAT1 as the target for their anti-uricosuric and uricosuric effects in vivo. These results correspond with previous studies in vitro (11,13,15,34). In addition, a slight but significant increase in CUA/Ccr of all the homozygotes and compound heterozygotes was observed in the probenecid loading test, suggesting that probenecid might also act on another urate transporter. It has been reported that a population of renal hypouricemic patients with a post-secretory reabsorptive defect have a pyrazinamide suppressible CUA that is not influenced by probenecid (5,7,35,36). This renal hypouricemia might be due to another urate transporter defect.
We identified two hypouricemic patients without SLC22A12 mutations in whom serum urate levels were > 1.0 mg/dl and CUA/Ccr was approximately 0.2. It is possible that they have mutations in other SLC22A12 regions such as the promoter region or the intron that affects URAT1 function. The responses for the loading tests in one of the two patients were similar to those of healthy subjects, rather than those of patients with URAT1 deficiency. Furthermore, most CUA/Ccr in the patients with SLC22A12 mutation did not exceed 1, despite the urate secretion mechanism in the tubules. These facts also suggest that another urate transporter acts on the tubules for urate reabsorption. If the unknown urate reabsorptive transporter plays a role in maintaining serum urate levels, we should recognize the transporter deficit as renal hypouricemia. Since URAT1 is responsible for most renal hypouricemia, the ability of the unknown urate reabsorptive transporter to regulate serum urate levels should not be greater than that of URAT1. We might be able to identify subjects with the unknown urate reabsorptive transporter disorder in the groups who have moderately lower serum urate levels.
In summary, this study correlated clinical and genetic features of renal hypouricemia. Clinically, the frequency of exercise-induced acute renal failure in patients with renal hypouricemia was higher than initially perceived. Genetically, this study illustrated that URAT1 is the main reabsorptive urate transporter because SLC22A12 was responsible for most renal hypouricemia, and the G774A mutation dominated SLC22A12 mutations in Japan. Furthermore, we established that pyrazinamide, benzbromarone, and probenecid exert anti-uricosuric and uricosuric effects by acting on URAT1 in vivo.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  N. Anzai, K. Ichida, P. Jutabha, T. Kimura, E. Babu, C. J. Jin, S. Srivastava, K. Kitamura, I. Hisatome, H. Endou, et al. Plasma Urate Level Is Directly Regulated by a Voltage-driven Urate Efflux Transporter URATv1 (SLC2A9) in Humans J. Biol. Chem., October 3, 2008; 283(40): 26834 - 26838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Le, M. Shafiu, W. Mu, and R. J. Johnson SLC2A9--a fructose transporter identified as a novel uric acid transporter Nephrol. Dial. Transplant., September 1, 2008; 23(9): 2746 - 2749. [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Eraly, V. Vallon, T. Rieg, J. A. Gangoiti, W. R. Wikoff, G. Siuzdak, B. A. Barshop, and S. K. Nigam Multiple organic anion transporters contribute to net renal excretion of uric acid Physiol Genomics, April 1, 2008; 33(2): 180 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kikuchi, H. Kusuhara, N. Hattori, I. Kim, K. Shiota, F. J. Gonzalez, and Y. Sugiyama Regulation of Tissue-Specific Expression of the Human and Mouse Urate Transporter 1 Gene by Hepatocyte Nuclear Factor 1 {alpha}/beta and DNA Methylation Mol. Pharmacol., December 1, 2007; 72(6): 1619 - 1625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Vazquez-Mellado, V Alvarado-Romano, R Burgos-Vargas, A L Jimenez-Vaca, G Pozo-Molina, and S A Cuevas-Covarrubias Homozygous frameshift mutation in the SLC22A12 gene in a patient with primary gout and high levels of serum uric acid J. Clin. Pathol., August 1, 2007; 60(8): 947 - 948. [Full Text] [PDF]
|
|
|
|
 |
|
 R. Cunningham, M. Brazie, S. Kanumuru, X. E, R. Biswas, F. Wang, D. Steplock, J. B. Wade, N. Anzai, H. Endou, et al. Sodium-Hydrogen Exchanger Regulatory Factor-1 Interacts with Mouse Urate Transporter 1 to Regulate Renal Proximal Tubule Uric Acid Transport J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1419 - 1425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Hagos, D. Stein, B. Ugele, G. Burckhardt, and A. Bahn Human Renal Organic Anion Transporter 4 Operates as an Asymmetric Urate Transporter J. Am. Soc. Nephrol., February 1, 2007; 18(2): 430 - 439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Vazquez-Mellado, A. L. Jimenez-Vaca, S. Cuevas-Covarrubias, V. Alvarado-Romano, G. Pozo-Molina, and R. Burgos-Vargas Molecular analysis of the SLC22A12 (URAT1) gene in patients with primary gout Rheumatology, February 1, 2007; 46(2): 215 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Iwanaga, M. Sato, T. Maeda, T. Ogihara, and I. Tamai Concentration-Dependent Mode of Interaction of Angiotensin II Receptor Blockers with Uric Acid Transporter J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 211 - 217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Yamamoto, H. Yamamoto, K. Ichida, J. Mitome, Y. Tanno, N. Katoh, K. Yokoyama, and T. Hosoya Successful living-related kidney transplantation in hereditary renal hypouricaemia Nephrol. Dial. Transplant., July 1, 2006; 21(7): 2041 - 2041. [Full Text] [PDF]
|
|
|
|
|
|
K. L. Price, Y. Y. Sautin, D. A. Long, L. Zhang, H. Miyazaki, W. Mu, H. Endou, and R. J. Johnson Human Vascular Smooth Muscle Cells Express a Urate Transporter J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1791 - 1795. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sekine, H. Miyazaki, and H. Endou Molecular physiology of renal organic anion transporters Am J Physiol Renal Physiol, February 1, 2006; 290(2): F251 - F261. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Choi, D. B. Mount, and A. M. Reginato Pathogenesis of Gout Ann Intern Med, October 4, 2005; 143(7): 499 - 516. [Full Text] [PDF]
|
|
|
|
|
|
I. Ishikawa, M. Nakagawa, S. Hayama, S. Yoshida, and T. Date Acute renal failure with severe loin pain and patchy renal ischaemia after anaerobic exercise (ALPE) (exercise-induced acute renal failure) in a father and child with URAT1 mutations beyond the W258X mutation Nephrol. Dial. Transplant., May 1, 2005; 20(5): 1015 - 1015. [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Hediger, R. J Johnson, H. Miyazaki, and H. Endou Molecular Physiology of Urate Transport Physiology, April 1, 2005; 20(2): 125 - 133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Wakida, D. G. Tuyen, M. Adachi, T. Miyoshi, H. Nonoguchi, T. Oka, O. Ueda, M. Tazawa, S. Kurihara, Y. Yoneta, et al. Mutations in Human Urate Transporter 1 Gene in Presecretory Reabsorption Defect Type of Familial Renal Hypouricemia J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2169 - 2174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Anzai, H. Miyazaki, R. Noshiro, S. Khamdang, A. Chairoungdua, H.-J. Shin, A. Enomoto, S. Sakamoto, T. Hirata, K. Tomita, et al. The Multivalent PDZ Domain-containing Protein PDZK1 Regulates Transport Activity of Renal Urate-Anion Exchanger URAT1 via Its C Terminus J. Biol. Chem., October 29, 2004; 279(44): 45942 - 45950. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
: homozygotes; 
: compound heterozygotes; •: heterozygotes; 
: patients with wild type URAT1; 
: controls. The regression curve is plotted. R: correlation coefficient, y = 0.5068x-0.8227, R2 = 0.8056.
