Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


J Am Soc Nephrol 15: 2619-2629, 2004
© 2004 American Society of Nephrology
doi: 10.1097/01.ASN.0000139066.77892.04
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, D. J.
Right arrow Articles by Gilbert, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, D. J.
Right arrow Articles by Gilbert, R. E.

BASIC SCIENCE

Tranilast Attenuates Structural and Functional Aspects of Renal Injury in the Remnant Kidney Model

Darren J. Kelly, Yuan Zhang, Renae Gow and Richard E. Gilbert

University of Melbourne Departments of Medicine, St. Vincent’s Hospital, Victoria, Australia

Correspondence to Darren J. Kelly, Department of Medicine, St. Vincent’s Hospital, Fitzroy, Victoria, 3065, Australia. Phone: +61-3-9288-2580; Fax: +61-3-9288-2581; E-mail: dkelly{at}medstv.unimelb.edu.au


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pathologic fibrosis is a key feature of progressive renal disease that correlates closely with kidney dysfunction and in which the prosclerotic growth factor TGF-{beta} has been consistently implicated. Tranilast (n-[3,4-dimethoxycinnamoyl] anthranilic acid), an antifibrotic agent that is used to treat hypertrophic scars and scleroderma, has also been shown to inhibit TGF-{beta}–induced extracellular matrix synthesis in a range of cell types, including those of renal origin. Therefore, the effects of tranilast on kidney fibrosis and dysfunction were examined in the subtotal nephrectomy model of progressive renal injury. Subtotal nephrectomy led to proteinuria and renal dysfunction in association with glomerulosclerosis, tubulointerstitial fibrosis, and macrophage accumulation. Despite persistent hypertension, treatment with tranilast led to a reduction in albuminuria (61.7 x/÷ 1.2 versus 20.5 x/÷ 1.3 mg/d; P < 0.01) and plasma creatinine (0.16 versus 0.08 mmol/L; P < 0.01) in subtotally nephrectomized rats. In addition, features suggestive of TGF-{beta} activation, including glomerulosclerosis, tubulointerstitial fibrosis, tubular atrophy, and macrophage accumulation, all were significantly attenuated by tranilast in association with evidence of reduced TGF-{beta} signaling in vivo. In the context of a recent pilot study in humans, the findings of the present report suggest that tranilast may provide a novel strategy for the treatment of progressive kidney disease characterized by fibrotic scarring.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
With only a limited capacity for regeneration, the response to chronic or repeated injury in mature mammals consists mostly of the elaboration of extracellular matrix. When excessive, this fibrotic response to injury is recognized histopathologically in various organs such as cirrhosis in the liver, pulmonary interstitial fibrosis in the lung, and glomerulosclerosis and tubulointerstitial fibrosis in the kidney. As in these other sites, the disruption of normal architecture in the kidney by pathologic fibrosis correlates closely with declining renal function (1,2).

Studies conducted over more than a decade have consistently indicated a major role for the prosclerotic growth factor TGF-{beta} in renal fibrosis and dysfunction (3), such that blockade of its expression and action represents an important therapeutic target in kidney disease. Tranilast (n-[3,4-dimethoxycinnamoyl] anthranilic acid) is an antifibrotic agent that is used in Japan for the treatment of hypertrophic scars (4) and scleroderma (5), skin disorders associated with an excessive fibrosis. Although the precise mechanisms underlying the antifibrotic effects of tranilast are incompletely understood, known actions of tranilast include the inhibition of TGF-{beta}–induced extracellular matrix production synthesis in a range of cell types, including skin fibroblasts (6), hepatic stellate cells (7), vascular smooth muscle cells (8), and renal interstitial fibroblasts (9). We therefore hypothesized that tranilast may attenuate the glomerulosclerosis and tubulointerstitial fibrosis that follow renal mass reduction, a well-characterized model of noninflammatory proteinuric renal disease associated with TGF-{beta} overexpression and fibrosis (10) that is frequently used to examine the pathogenesis of progressive kidney disease (11).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Forty male Sprague-Dawley rats that weighed 200 to 250 g were randomized to four groups of 10 animals each. Anesthesia was achieved by the intraperitoneal administration of pentobarbital (6 mg/100 g body wt; Boehringer Ingelheim, Artarmon, NSW, Australia). Twenty rats underwent subtotal (5/6) nephrectomy (STNx) performed by right subcapsular nephrectomy and infarction of approximately two thirds of the left kidney by selective ligation of two of three to four extrarenal branches of the left renal artery. Animals were then randomly assigned to two groups: STNx and vehicle or STNx with tranilast (400 mg/kg per d bi daily gavage; Pharm Chemical, Shanghai Lansheng Corporation, Shanghai, China). The control groups (control + vehicle, control + tranilast) underwent sham surgery that consisted of laparotomy and manipulation of both kidneys before wound closure. Rats were housed in a temperature-controlled (22°C) room with ad libitum access to commercial standard rat chow (Norco Co-Operative Ltd., Lismore, NSW, Australia) and water during the entire study. Rats from each group were killed at 12 wk after surgery. When the rats were killed, the remnant (left) kidney was then sliced sagittally, and one half was immersion fixed in 10% neutral-buffered formalin and embedded in paraffin for histology and the other half was frozen in liquid nitrogen for molecular biology. All experiments adhered to the guidelines of the Animal Welfare and Ethics Committee of the St. Vincent’s Hospital and the National Health and Medical Research Foundation of Australia.

Renal Functional
Body weight was measured weekly. Plasma creatinine was measured by autoanalyzer (Beckman Instrumentals, Palo Alto, CA) at the beginning and the end of the study. Systolic BP was measured in conscious rats using an occlusive tail-cuff plethysmograph attached to a pneumatic pulse transducer (Narco Bio-system Inc., Houston, TX) (12). Before the rats were killed, they were housed in metabolic cages for 24 h for subsequent measurement of urinary creatinine and albumin excretion using a double radioimmunoassay method (13).

Tissue Preparation
Rats were anesthetized (Nembutal 60 mg/kg body wt intraperitoneally; Boehringer-Ingelheim, Artarmon, New South Wales, Australia), and the abdominal aorta was cannulated with an 18-G needle. Perfusion-exsanguination commenced at systolic BP (180 to 220 mmHg) via the abdominal aorta with 0.1 M PBS (pH 7.4; 20 to 50 ml) to remove circulating blood, and the inferior vena cava adjacent to the renal vein was simultaneously severed, allowing free flow of the perfusate. After clearance of circulating blood, 10% buffered formalin fixative was perfused for an additional 5 min (100 to 200 ml of fixative) to fix the tissues. Kidneys were removed from the animal, decapsulated, and sliced transversely and paraffin embedded for light microscopic evaluation.

Histopathology
Changes in kidney structure were assessed in a masked protocol in at least 25 randomly selected tissue sections from each group studied. Sections were stained with Mayer’s hematoxylin and eosin to examine cell structure, periodic acid-Schiff (PAS) to identify changes in basement membrane architecture and glycogen deposition, or Masson’s modified trichrome to demonstrate collagen matrix (14).

Glomerulosclerotic Index
In 3-µm kidney sections stained with PAS, 50 to 80 glomeruli from rats were examined in a masked protocol. The degree of sclerosis in each glomerulus was graded subjectively on a scale of 0 to 4 as described previously (10) as follows: grade 0, normal; grade 1, sclerotic area up to 25% (minimal); grade 2, sclerotic area 25 to 50% (moderate); grade 3, sclerotic area 50 to 75% (moderate to severe); and grade 4, sclerotic area 75 to 100% (severe). Glomerulosclerosis was defined as glomerular basement membrane thickening, mesangial hypertrophy, and capillary occlusion. A glomerulosclerotic index (GSI) was then calculated using the formula 4 GSI = {Sigma} Fi (i) i = 0 where Fi is the fraction of glomeruli in the rat with a given score (i).

Tubular Atrophy
Tubular atrophy was assessed in kidney sections stained with Masson’s trichrome stain. At x40 magnification (Olympus BX-50 light microscope; Olympus, Tokyo, Japan), six random and nonoverlapping fields from each slide (two slides analyzed for n = 6 rats/group) were selected. Atrophic tubules were identified as described previously; results are expressed as the number of atrophied tubules per field of kidney cortex (15).

TGF-{beta} Receptor Activation
Activation of the TGF-{beta} receptor was assessed by quantifying the nuclear expression of phosphorylated Smad2 using a rabbit anti–phospho-Smad2 antibody (Cell Signaling Technology, Boston, MA) that detects endogenous Smad2 only when dually phosphorylated at Ser463 and Ser465 (16). Sections were immunostained, as described previously (16), according to the manufacturer’s instructions. Sections that were incubated with 1:10 normal goat serum instead of the primary antiserum served as the negative control.

Quantification of Matrix Deposition and Phospho-Smad2 Expression
The accumulation of matrix and the extent of immunostaining phospho-Smad2 were quantified using computer-assisted image analysis, as previously reported (17,18). Briefly, 5 random nonoverlapping fields from six rats per group were captured and digitized using a BX50 microscope attached to a Fujix HC5000 digital camera. Digital images were then loaded onto a Pentium III IBM computer. An area of blue on trichrome-stained sections (for matrix) or brown on immunostained sections (for phospho-Smad2) were selected for their color ranges, and the proportional area of tissue with their respective ranges of color were then quantified. Calculation of the proportional area stained blue (matrix) or brown (phospho-Smad2) was then determined using image analysis (AIS, Analytical Imaging Station Version 6.0, Ontario, Canada).

Macrophages
Three-micron sections were placed into Histosol to remove the paraffin wax, hydrated in graded ethanol, and immersed in tap water before being incubated for 20 min with normal goat serum diluted 1:10 with 0.1 M PBS at pH 7.4. Sections were then incubated for 18 h at 4°C with specific primary monoclonal rat macrophage marker (ED-1, 1:200; Serotec, Raleigh, NC). Macrophage number was estimated by counting the number of macrophages in six sections per animal from each group (n = 6 per group).

Cell Proliferation
Cell proliferation was assessed by quantifying the expression of proliferating cell nuclear antigen (PCNA). In brief, 4-µm sections were deparaffinized with histolene, rehydrated with graded ethanol, and treated with 3% H2O2. Antigen retrieval technique was performed by placing sections into boiling 0.01 M citrate buffer (pH 6) for 5 min (19). Once sections were cooled and washed in PBS, they were treated with 5% goat serum for 30 min followed by incubation with anti-PCNA antibody (1:50; DAKO, Carpinteria, CA) for 18 h at 4°C. Sections were washed in PBS, treated with biotinylated goat anti-mouse antibody for 45 min, and followed by incubation of avidin-biotin peroxidase complex (Vector, Burlingame, CA) for 40 min. Diaminobenzidine (DAKO) was used as a chromogen, and sections were counterstained with eosin. Negative control consisted of omitting the primary antibody and replacing it with 5% goat serum. Sections of rat testis served as a positive control. The extent of PCNA staining was examined in the images of 15 randomly selected fields (x200 magnification) per section that were captured and digitized using a Fujix HC-2000 digital camera. The number of positively stained nuclei (brown) per field was then quantified.

Apoptosis
Apoptosis was examined by quantifying terminal dUTP nick-end labeling (TUNEL) as described previously (20,21). In brief, sections were deparaffinized and rehydrated. Permeabilization and removal of endogenous peroxidase was carried out by treating sections with 20 µg/ml Proteinase K (Roche Diagnostics, Mannheim, Germany) for 30 min and 3% H2O2 for 5 min, respectively. Sections were then washed in dH2O (2 x 5 min) and treated with TdT Buffer (Roche Diagnostics, Mannheim, Germany) for 20 min to allow for equilibration before being treated with TdT enzyme (10 U; Roche Diagnostics) and biotinylated dUTP (1 nmol; Roche Diagnostics) for 60 min at 37°C in a dark, humidified chamber. The reaction was stopped with TB Buffer (300 mM sodium chloride, 30 mM sodium citrate) for 15 min and washed with PBS (2 x 5 min). Sections were then treated with Streptavidin-conjugated horseradish peroxidase (1:300; DAKO) for 30 min at 37°C, washed, incubated with diaminobenzidine, and counterstained with eosin. Negative control was generated by not treating the section with TdT enzyme, whereas the positive control was treated with 1 µg/µl DNase I (Promega, Madison, WI) in 1 mM MgSO4/PBS for 20 min before incubation with 3% H2O2. The extent of TUNEL staining was assessed as described for PCNA.

RNA Extraction and cDNA Synthesis
Frozen tissue, stored at –80°C, was homogenized (Polytron, Kinematica Gmbh, Littau, Switzerland) and total RNA was isolated using TRIzol reagent (Life Technologies, Grand Island, NY). The purified RNA was dissolved in sterile water and quantified spectrophotometrically (OD260). RNA quality was verified on a 1% denaturing agarose gel. Four micrograms of total RNA was treated with RQ1 DNAse (1 U/µl; Promega) to remove genomic DNA. The DNAse-treated RNA was reverse transcribed with 1 µl (2 µg/µl) random hexamers (Roche Diagnostics) and incubated for 5 min at 70°C. After cooling on ice for 5 min, 5 µl of 5x Avian myeloblastosis virus (AMV) reaction buffer, 2.5 µl of 10 mM dNTP mix, 0.5 µl of RNase inhibitor (40 U/µl; Roche Diagnostics), 0.5 µl of AMV reverse transcriptase (25 U/µl; Roche Diagnostics), and 4.5 µl of DEPC water was added. Tubes were incubated at 37°C for 60 min, after which cDNA samples were stored at –20°C for future use.

Quantitative Real-Time Reverse Transcriptase–PCR
TGF-{beta}1 was quantified by real-time PCR using sequence specific primers as previously reported by our group (22) with forward primer (5' to 3') AGAAGTCACCCGCGTGCTA, reverse primer (5' to 3') TGTGTGATGTCTTTGGTTTTGTCA, and probe FAM-TGGTGGACC GCAACAACGCAAT-TAMRA. A commercial, predeveloped 18S control kit labeled with the fluorescence reporter dye (VIC) on the 5' end, and the quencher (TAMRA) on the 3' end (PE Biosystems, Foster City, CA) was used as the housekeeping gene to control for inequalities of loading. Primers and probes for target genes were obtained from PE Biosystems. Quantitative real-time PCR was then performed using a GeneAmp 7000 Sequence Detector (PE Biosystems) according to the manufacturer’s instructions. The derived values are the averages of four runs and were normalized to those of sham kidneys that were arbitrarily assigned a value of 1 and expressed as arbitrary units (AU).

Statistical Analyses
Data are expressed as means ± SEM unless otherwise stated. Statistical significance was determined by a two-way ANOVA with a Fisher post hoc comparison. Because of its skew distribution, data on albuminuria were log transformed before analysis and expressed as geometric mean x/÷ tolerance factor. All analyses were performed using Statview II + Graphics package (Abacus Concepts, Berkeley, CA) on an Apple Macintosh G4 computer (Apple Computer, Inc., Cupertino, CA). P < 0.05 was regarded as statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Clinical Parameters
In comparison with sham animals, rats that underwent STNx were hypertensive and developed substantial albuminuria, increased plasma creatinine, and reduced creatinine clearance. Treatment of STNx rats with tranilast attenuated all of these changes (Table 1). BP was also increased in STNx rats compared with sham animals but was unaffected by tranilast (Table 1). At the end of the study, subtotally nephrectomized rats weighed less and ate more than sham animals (Table 1). Neither body weight nor food consumption was affected by tranilast treatment in either sham or STNx groups.


View this table:
[in this window]
[in a new window]

  		Table 1. Clinical parametersa
 
Histopathology
STNx led to significant glomerulosclerosis and tubulointerstitial fibrosis (Figures 1 through 3GoGo) with the proportional area of kidney cortex occupied by collagenous matrix increased 20-fold (P < 0.01; Figure 1) compared with shams. In addition, tubular atrophy, absent in sham kidneys, was a prominent feature of STNx kidneys (Figures 3 and 4Go). Considerable internephron heterogeneity in the extent of fibrosis and atrophy was noted. Tranilast attenuated both fibrosis and atrophy in STNx kidneys (Figures 1 through 4 GoGoGo).



View larger version (18K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Glomerulosclerotic index (top) and tubulointerstitial fibrosis (bottom) in sham-operated rats and rats that underwent subtotal nephrectomy (STNx) and were treated with and without tranilast. Data are presented as mean ± SEM. *P < 0.01 versus shams; {dagger}P < 0.01 versus untreated STNx rat kidneys.

 


View larger version (88K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Representative photomicrograph of periodic acid Schiff (PAS)-stained sections from sham, STNx, and STNX rats treated with tranilast. In sham (A) rats, there is no glomerulosclerosis, whereas STNx (B) is associated with a dramatic increase in glomerulosclerosis. Treatment of STNx rats that were with tranilast (C) was associated with a reduction in the extent of glomerulosclerosis. Magnification x360.

 


View larger version (73K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. Representative trichrome-stained sections showing tubulointerstitial fibrosis and atrophy in sham, STNx, and STNx rats that were treated with tranilast. In sham (A), there is no cortical tubular fibrosis or atrophy, whereas STNx (B) is associated with an increase in interstitial fibrosis (blue) and atrophic tubules. Treatment of STNx rats with tranilast was associated with a reduction in both tubular fibrosis and atrophy. Magnification x380.

 


View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Quantification of atrophic tubules in rat kidneys from sham, sham + tranilast, STNx, and STNx + tranilast. Values are represented as mean ± SEM. *P < 0.001 versus control; {dagger}P < 0.01 versus STNx.

 
Immunohistochemistry: Phosphorylated Smad2 and Macrophages
A 12-fold increase in immunostaining for phosphorylated Smad2 was noted in STNx (Figures 5 and 6Go). Immunostaining was confined to nuclei and was particularly prominent in areas of fibrosis and atrophy (Figure 6). In contrast, phosphorylated Smad2 was substantially lower in STNx rats that were treated with tranilast and in sham animals. In kidney sections from sham animals, very few macrophages were detected. STNx was associated with a dramatic increase in the number of macrophages (P < 0.001), particularly within regions of tubulointerstitial injury (Figures 7 and 8Go). The extent of macrophage infiltration in kidney sections from subtotally nephrectomized rats was reduced with tranilast.



View larger version (24K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Quantification of phospho-Smad 2 immunostaining in rat kidneys from sham, sham + tranilast, STNx, and STNx + tranilast groups. Values are represented as mean ± SEM. *P < 0.001 versus control; {dagger}P < 0.01 versus STNx.

 


View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. Immunohistochemistry for phosphorylated-Smad 2 in Sham, STNx, and STNx rats that were treated with tranilast. In sham (A), there is minimal phosphorylated-Smad2 immunostaining, whereas STNx (B) is associated with an increase in phosphorylated Smad 2 immunostaining in the nuclei of tubules. Treatment of STNx rats with tranilast was associated with a reduction in nuclear phosphorylated-Smad 2 immunostaining. Magnification x380.

 


View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. Quantitation of ED-1 positive macrophages in rat kidneys from sham, sham + tranilast, STNx, and STNx + tranilast groups. Values are represented as mean ± SEM. *P < 0.001 versus control; {dagger}P < 0.01 versus STNx.

 


View larger version (82K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 8. ED-1–positive macrophages from sham, STNx, and STNx rats that were treated with tranilast. In sham (A), only an occasional macrophage was observed, whereas STNx (B) was associated with numerous macrophages (brown). Treatment of STNx rats with tranilast was associated with a reduction in macrophage number. Magnification x380.

 
Cell Proliferation and Apoptosis
When compared with sham-operated kidneys, sections for animals that underwent STNx showed increased PCNA labeling, predominantly in tubular epithelial cells (Figures 9 and 10Go). Subtotally nephrectomized animals also displayed evidence of augmented apoptosis with increased TUNEL labeling (Figures 11 and 12Go). Whereas tranilast had no effect on cell proliferation, TUNEL was attenuated by tranilast treatment (Figures 11 and 12Go).



View larger version (18K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 9. Quantification of proliferating cell nuclear antigen (PCNA) immunostaining in rat kidneys from sham, sham + tranilast, STNx, and STNx + tranilast. Values are represented as mean ± SEM. *P < 0.001 versus shams.

 


View larger version (78K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 10. PCNA immunostaining from sham, STNx, and STNx rats that were treated with tranilast. In sham (A), only an occasional PCNA-positive cell was observed, whereas sections from both untreated (B) and tranilast-treated STNx kidneys (C) showed numerous immunolabeled cells. Magnification x380.

 


View larger version (27K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 11. Quantification of terminal dUTP nick-end labeling (TUNEL) in rat kidneys from sham, sham + tranilast, STNx, and STNx + tranilast. Values are represented as mean ± SEM. *P < 0.001 versus control; {dagger}P < 0.01 versus untreated STNx.

 


View larger version (85K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 12. TUNEL in sham (A), STNx (B), and STNx rats that were treated with tranilast (C). In sham animals (A), only an occasional TUNEL-positive cell is noted (arrows), whereas sections from untreated STNx rats (B) show numerous positive cells with fewer in tranilast-treated animals (C). Magnification x380.

 
TGF-{beta} Gene Expression
TGF-{beta}1 mRNA was increased in the kidneys of animals that underwent STNx compared with sham rats (3.33 ± 0.8 versus 1.00 ± 0.3 AU, STNx versus sham; P < 0.001). Tranilast treatment of subtotally nephrectomized rats did not demonstrably effect TGF-{beta}1 gene expression (3.24 ± 0.7 AU).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The present study demonstrates that despite persistent hypertension, treatment with tranilast led to a reduction in proteinuria and renal dysfunction in subtotally nephrectomized rats. In addition, features suggestive of TGF-{beta} activation, including glomerulosclerosis, tubulointerstitial fibrosis, and macrophage accumulation, were attenuated by tranilast in association with evidence of reduced TGF-{beta} signaling in vivo.

Current treatment of progressive renal disease focuses on the treatment of hypertension and blockade of the renin-angiotensin system. However, despite such therapy, renal dysfunction continues to progress in the majority of patients. Agents used in experimental studies to antagonize the effects of TGF-{beta} have included the use of neutralizing antibodies (23) and the small proteoglycan, decorin (24). In the present study, we explored an alternative approach with the use of an orally active compound that had previously been shown to block TGF-{beta}–induced fibrosis in both the in vitro (6,8,9) and in vivo settings (9,25,26).

Following on from studies in the heart (25) and vasculature (27), three previous studies have investigated the effects of tranilast in fibrotic renal disease. In a study that examined the changes that develop after unilateral ureteric obstruction, Miyajima et al. (26) found that tranilast administration attenuated kidney fibrosis in association with diminished TGF-{beta} bioactivity. In two other studies, the effects of tranilast in diabetic nephropathy were examined. In the first, a pilot study of nine humans with advanced diabetic nephropathy, tranilast was reported to slow the decline in GFR over a 12-mo period, with a nonsignificant trend toward reduction in proteinuria (28). More recently, tranilast was also shown to reduce renal fibrosis and proteinuria in an experimental model of advanced diabetic nephropathy when used as a late intervention (9).

In the present study, tranilast not only attenuated the structural manifestations of progressive renal disease with reductions in the extent of glomerulosclerosis and tubulointerstitial fibrosis but also significantly diminished its functional manifestations with improvements in proteinuria, plasma creatinine, and creatinine clearance. These findings are consistent with the correlation between renal function and the extent of fibrosis in both natural history and intervention studies in animals and humans (23,29,30). Proteinuria, a key manifestation and pathogenetic feature of progressive renal disease (31), was also attenuated in the present study by tranilast. This antiproteinuric effect contrasts that of neutralizing anti–TGF-{beta} antibodies, which, although reported to attenuate matrix deposition, did not reduce proteinuria in the db/db mouse (23). The reasons underlying the differing effects of tranilast and anti–TGF-{beta} antibody therapy on albuminuria is uncertain but may be a consequence of either the TGF-{beta}–independent effects of tranilast or the nonspecific effects of antibody administration on glomerular function, in the latter study.

In addition to its widely known effects on fibrosis, TGF-{beta} initiates macrophage chemotaxis (32,33). In the normal kidney, macrophages are mostly restricted to the renal capsule, pelvic wall, and adventitia of large vessels (34). However, in both inflammatory and noninflammatory renal disease, macrophage infiltration is a prominent feature (10,35–37), where their cellular contents of reactive oxygen intermediates, proteases, inflammatory cytokines, and growth factors including TGF-{beta} itself (10,35,38) are viewed as playing a significant role in mediating renal injury (35). Thus, the ability of tranilast to reduce macrophage accumulation, as noted in the present study, may potentially contribute to the observed attenuation of renal injury.

In addition to fibrosis and macrophage infiltration, tubular atrophy has long been recognized as an indicator of renal disease severity and progression (39,40). Whereas tubular atrophy with its attendant tubular epithelial cell loss may be the result of necrosis, the absence of the expected cytological features, in most forms of chronic renal disease, suggest that apoptosis may be the predominant mechanism underlying epithelial cell deletion in the injured kidney (41,42). TGF-{beta} not only is antiproliferative but also induces apoptosis in a wide range of cells (43–45), leading to its implication in the pathogenesis of the tubular atrophy that develops in STNx (20). In the present study, both apoptosis and cell proliferation, as identified by TUNEL and PCNA labeling, respectively, were increased after STNx. Tranilast treatment diminished TUNEL but not PCNA, consistent with disruption of the known actions of TGF-{beta} and contrasting the recently demonstrated effects of BP lowering in which reductions in both PCNA and TUNEL both were noted (46).

A number of strategies have been used to antagonize the effects of TGF-{beta} in vivo. For instance, the small proteoglycan decorin has been shown to antagonize TGF-{beta} in cell culture and to attenuate renal fibrosis in experimental glomerulonephritis (47). However, more recent studies have shown that in addition to antagonizing the effects of TGF-{beta}, decorin is a potent blocker of PDGF (47). Similarly, although the present report has focused on the TGF-{beta}–related effects of tranilast, a range of other actions may account for the beneficial effects seen in the present study.

The signaling pathways of TGF-{beta} are complex. On binding to the constitutively active type II receptor (TGF-{beta}IIR), TGF-{beta} induces association and activation of its type I receptor (TGF-{beta}RI) (48). The induced kinase activity of TGF-{beta}RI then leads to phosphorylation of the receptor-activated Smad (R-Smad): Smad2 and Smad3. These two Smad then associate with a common partner Smad (Smad4) to form a heterotrimeric complex that translocates to the nucleus and modulates TGF-{beta}–dependent gene transcription (49). In the present study, we found prominent nuclear staining of phosphorylated Smad2 in subtotally nephrectomized rats, consistent with activation of TGF-{beta} signaling pathways (49). In contrast, treatment of subtotally nephrectomized rats with tranilast led to a relative diminution of nuclear phosphorylated Smad2 immunostaining, without affecting TGF-{beta} gene expression. These findings, consistent with previous reports (50), suggest that the beneficial effects of tranilast are not the consequence of altered TGF-{beta} transcription but may be attributable to events that are more downstream.

In summary, treatment with tranilast in this model of progressive renal disease attenuated the structural and functional manifestations of disease in association with evidence of reduced activation of the TGF-{beta} signaling pathway. In the context of the recent pilot study in humans, this study suggests that tranilast may provide a novel strategy for the treatment of progressive kidney disease characterized by fibrotic scarring (28).


   Acknowledgments
 
This project was supported by a program grant from the National Health and Medical Research Council of Australia and the Juvenile Diabetes Research Foundation.

We thank Mariana Pacheco and Jemma Court for excellent animal husbandry and Laura Di Rago for technical assistance. D.J.K. is the recipient of a Career Development Award from the Juvenile Diabetes Research Foundation.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nath KA: Tubulointerstitial changes as a major determinant in the progression of renal damage. Am J Kidney Dis 20: 1–17, 1992[Medline]
  2. Mauer S, Steffes M, Ellis E, Sutherland D, Brown D, Goetz F: Structural-functional relationships in diabetic nephropathy. J Clin Invest 74: 1143–1155, 1984
  3. Border WA, Brees D, Noble NA: Transforming growth factor-beta and extracellular matrix deposition in the kidney. Contrib Nephrol 107: 140–145, 1994[Medline]
  4. Shigeki S, Murakami T, Yata N, Ikuta Y: Treatment of keloid and hypertrophic scars by iontophoretic transdermal delivery of tranilast. Scand J Plast Reconstr Surg Hand Surg 31: 151–158, 1997[Medline]
  5. Taniguchi S, Yorifuji T, Hamada T: Treatment of linear localized scleroderma with the anti-allergic drug, tranilast. Clin Exp Dermatol 19: 391–393, 1994[CrossRef][Medline]
  6. Yamada H, Tajima S, Nishikawa T, Murad S, Pinnell SR: Tranilast, a selective inhibitor of collagen synthesis in human skin fibroblasts. J Biochem (Tokyo) 116: 892–897, 1994[Abstract/Free Full Text]
  7. Ikeda H, Inao M, Fujiwara K: Inhibitory effect of tranilast on activation and transforming growth factor beta 1 expression in cultured rat stellate cells. Biochem Biophys Res Commun 227: 322–327, 1996[CrossRef][Medline]
  8. Miyazawa K, Kikuchi S, Fukuyama J, Hamano S, Ujiie A: Inhibition of PDGF- and TGF-beta 1-induced collagen synthesis, migration and proliferation by tranilast in vascular smooth muscle cells from spontaneously hypertensive rats. Atherosclerosis 118: 213–221, 1995[CrossRef][Medline]
  9. Mifsud S, Kelly, Qi W, Zhang Y, Pollock CA, Wilkinson-Berka JL, Gilbert RE: Intervention with tranilast attenuates renal pathology and albuminuria in advanced experimental diabetic nephropathy. Nephron 95: 83–91, 2003[CrossRef]
  10. Wu L, Cox A, Roe C, Dziadek M, Cooper ME, Gilbert RE: Transforming growth factor {beta}1 and renal injury following subtotal nephrectomy in the rat: Role of the renin-angiotensin system. Kidney Int 51: 1553–1567, 1997[Medline]
  11. Brenner BM: Hemodynamically mediated glomerular injury and the progressive nature of kidney disease. Kidney Int 23: 647–655, 1983[Medline]
  12. Bunag RD: Validation in awake rats of a tail-cuff method for measuring systolic pressure. J Appl Physiol 34: 279–282, 1973[Free Full Text]
  13. Kelly DJ, Wilkinson-Berka JL, Allen TJ, Cooper ME, Skinner SL: A new model of diabetic nephropathy with progressive renal impairment in the transgenic (mRen-2)27 rat. Kidney Int 54: 343–352, 1998[CrossRef][Medline]
  14. Masson P: Trichrome stainings and their preliminary technique. J Tech Methods 2: 75–90, 1929
  15. Kelly DJ, Cox AJ, Tolcos M, Cooper ME, Wilkinson-Berka JL, Gilbert RE: Attenuation of tubular apoptosis by blockade of the renin-angiotensin system in diabetic Ren-2 rats. Kidney Int 61: 31–39, 2002[CrossRef][Medline]
  16. Haller D, Holt L, Kim SC, Schwabe RF, Sartor RB, Jobin C: Transforming growth factor-beta 1 inhibits non-pathogenic Gram negative bacteria-induced NF-kappa B recruitment to the interleukin-6 gene promoter in intestinal epithelial cells through modulation of histone acetylation. J Biol Chem 278: 23851–23860, 2003[Abstract/Free Full Text]
  17. Lehr HA, Mankoff DA, Corwin D, Santeusanio G, Gown AM: Application of Photoshop-based image analysis to quantification of hormone receptor expression in breast cancer. J Histochem Cytochem 45: 1559–1565, 1997[Abstract/Free Full Text]
  18. Lehr HA, van der Loos CM, Teeling P, Gown AM: Complete chromogen separation and analysis in double immunohistochemical stains using Photoshop-based image analysis. J Histochem Cytochem 47: 119–126, 1999[Abstract/Free Full Text]
  19. Shi SR, Key ME, Kalra KL: Antigen retrieval in formalin-fixed, paraffin-embedded tissues: An enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 39: 741–748, 1991[Abstract]
  20. Kelly DJ, Cox AJ, Tolcos M, Cooper ME, Wilkinson-Berka JL, Gilbert RE: Attenuation of tubular apoptosis by blockade of the renin-angiotensin system in diabetic Ren-2 rats. Kidney Int 61: 31–39, 2002
  21. Wilkinson-Berka JL, Babic S, De Gooyer T, Stitt AW, Jaworski K, Ong LG, Kelly DJ, Gilbert RE: Inhibition of platelet-derived growth factor promotes pericyte loss and angiogenesis in ischemic retinopathy. Am J Pathol 164: 1263–1273, 2004[Abstract/Free Full Text]
  22. Kelly DJ, Aaltonen P, Cox AJ, Rumble JR, Langham R, Panagiotopoulos S, Jerums G, Holthofer H, Gilbert RE: Expression of the slit-diaphragm protein, nephrin, in experimental diabetic nephropathy: Differing effects of anti-proteinuric therapies. Nephrol Dial Transplant 17: 1327–1332, 2002[Abstract/Free Full Text]
  23. Ziyadeh FN, Hoffman BB, Han DC, Iglesias-De La Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, Sharma K: Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice. Proc Natl Acad Sci U S A 97: 8015–8020, 2000[Abstract/Free Full Text]
  24. Yamaguchi Y, Mann DM, Ruoslahti E: Negative regulation of transforming growth factor-{beta} by the proteoglycan decorin. Nature 346: 281–284, 1990[CrossRef][Medline]
  25. Pinto YM, Pinto-Sietsma SJ, Philipp T, Engler S, Kobetamehl P, Hocher B, Marquardt H, Sethmann S, Lauster R, Merker HJ, Paul M: Reduction in left ventricular messenger RNA for transforming growth factor beta(1) attenuates left ventricular fibrosis and improves survival without lowering blood pressure in the hypertensive TGR(mRen2)27 Rat. Hypertension 36: 747–754, 2000[Abstract/Free Full Text]
  26. Miyajima A, Asano T, Yoshimura I, Seta K, Hayakawa M: Tranilast ameliorates renal tubular damage in unilateral ureteral obstruction. J Urol 165: 1714–1718, 2001[CrossRef][Medline]
  27. Ward MR, Sasahara T, Agrotis A, Dilley RJ, Jennings GL, Bobik A: Inhibitory effects of tranilast on expression of transforming growth factor-{beta} isoforms and receptors in injured arteries. Atherosclerosis 137: 267–275, 1998[CrossRef][Medline]
  28. Soma J, Sugawara T, Huang YD, Nakajima J, Kawamura M: Tranilast slows the progression of advanced diabetic nephropathy. Nephron 92: 693–698, 2002[CrossRef][Medline]
  29. Taft J, Nolan CJ, Yeung SP, Hewitson TD, Martin FIR: Clinical and histological correlations of decline in renal function in diabetic patients with proteinuria. Diabetes 43: 1046–1051, 1994[Abstract]
  30. Cordonnier DJ, Pinel N, Barro C, Maynard C, Zaoui P, Halimi S, De Ligny BH, Reznic Y, Simon D, Bilous RW: Expansion of cortical interstitium is limited by converting enzyme inhibition in type 2 diabetic patients with glomerulosclerosis. J Am Soc Nephrol 10: 1253–1263, 1999[Abstract/Free Full Text]
  31. Remuzzi G, Bertani T: Pathophysiology of progressive nephropathies. N Engl J Med 339: 1448–1456, 1998[Free Full Text]
  32. Malyankar UM, Almeida M, Johnson RJ, Pichler RH, Giachelli CM: Osteopontin regulation in cultured rat renal epithelial cells. Kidney Int 51: 1766–1773, 1997[Medline]
  33. Sato K, Kawasaki H, Nagayama H, Enomoto M, Morimoto C, Tadokoro K, Juji T, Takahashi TA: TGF-beta 1 reciprocally controls chemotaxis of human peripheral blood monocyte-derived dendritic cells via chemokine receptors. J Immunol 164: 2285–2295, 2000[Abstract/Free Full Text]
  34. Kaissling B, Lehir M: Characterization and distribution of interstitial cell types in the renal cortex of rats. Kidney Int 45: 709–720, 1994[Medline]
  35. Nikolic-Paterson DJ, Lan HY, Hill PA, Atkins RC: Macrophages in renal injury. Kidney Int Suppl 45: S79–S82, 1994[Medline]
  36. Wada T, Furuichi K, Sakai N, Iwata Y, Yoshimoto K, Shimizu M, Takeda SI, Takasawa K, Yoshimura M, Kida H, Kobayashi KI, Mukaida N, Naito T, Matsushima K, Yokoyama H: Up-regulation of monocyte chemoattractant protein-1 in tubulointerstitial lesions of human diabetic nephropathy. Kidney Int 58: 1492–1499, 2000[CrossRef][Medline]
  37. Shikata K, Makino H: Role of macrophages in the pathogenesis of diabetic nephropathy. Contrib Nephrol (134): 46–54, 2001
  38. Schena FP, Gesualdo L, Grandaliano G, Montinaro V: Progression of renal damage in human glomerulonephritides: Is there sleight of hand in winning the game? Kidney Int 52: 1439–1457, 1997[Medline]
  39. Risdon RA, Sloper JC, de Vardener HE: Relationship between renal function and histological changes found in renal biopsy specimens from patients with persistent glomerulonephritis. Lancet 2: 363–366, 1968[Medline]
  40. Schainuck LI, Striker GE, Cutler RE, Benditt EP: Structural-functional correlations in renla disease. Part II. The correlations. Hum Pathol 1: 631–641, 1970[Medline]
  41. Schelling JR, Cleveland RP: Involvement of Fas-dependent apoptosis in renal tubular epithelial cell deletion in chronic renal failure. Kidney Int 56: 1313–1316, 1999[CrossRef][Medline]
  42. Schelling JR, Nkemere N, Kopp JB, Cleveland RP: Fas-dependent fratricidal apoptosis is a mechanism of tubular epithelial cell deletion in chronic renal failure. Lab Invest 78: 813–824, 1998[Medline]
  43. Choi ME, Ballermann BJ: Inhibition of capillary morphogenesis and associated apoptosis by dominant negative mutant transforming growth factor-beta receptors. J Biol Chem 270: 21144–21150, 1995[Abstract/Free Full Text]
  44. Rotello RJ, Lieberman RC, Purchio AF, Gerschenson LE: Coordinated regulation of apoptosis and cell proliferation by transforming growth factor beta 1 in cultured uterine epithelial cells. Proc Natl Acad Sci U S A 88: 3412–3415, 1991[Abstract/Free Full Text]
  45. Sanchez A, Alvarez AM, Benito M, Fabregat I: Apoptosis induced by transforming growth factor-beta in fetal hepatocyte primary cultures: Involvement of reactive oxygen intermediates. J Biol Chem 271: 7416–7422, 1996[Abstract/Free Full Text]
  46. Soto K, Gomez-Garre D, Largo R, Gallego-Delgado J, Tejera N, Catalan MP, Ortiz A, Plaza JJ, Alonso C, Egido J: Tight blood pressure control decreases apoptosis during renal damage. Kidney Int 65: 811–822, 2004[CrossRef][Medline]
  47. Border WA, Noble NA, Yamamoto T, Harper JR, Yamaguchi Y, Pierschbacher MD, Ruoslahti E: Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease. Nature 360: 361–364, 1992[CrossRef][Medline]
  48. Schiffer M, von Gersdorff G, Bitzer M, Susztak K, Bottinger EP: Smad proteins and transforming growth factor-beta signaling. Kidney Int Suppl 77: S45–S52, 2000[CrossRef][Medline]
  49. Massague J, Chen YG: Controlling TGF-beta signaling. Genes Dev 14: 627–644, 2000[Free Full Text]
  50. Ochiai H, Ochiai Y, Chihara E: Tranilast inhibits TGF-A1 secretion without affecting its mRNA levels in conjunctival cells. Kobe J Med Sci 47: 203–209, 2001[Medline]
Received for publication December 22, 2003. Accepted for publication June 28, 2004.




This article has been cited by other articles:


Home page
 Nephrol Dial TransplantHome page
P. Boor, K. Sebekova, T. Ostendorf, and J. Floege
Treatment targets in renal fibrosis
Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3391 - 3407.
[Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
D. J. Kelly, Y. Zhang, K. Connelly, A. J. Cox, J. Martin, H. Krum, and R. E. Gilbert
Tranilast attenuates diastolic dysfunction and structural injury in experimental diabetic cardiomyopathy
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2860 - H2869.
[Abstract] [Full Text] [PDF]

Home page
 Journal of Renin-Angiotensin-Aldosterone SystemHome page
I. Tsunenari, T. Ohmura, R. Seidler, M. Chachin, T. Hayashi, A. Konomi, T. Matsumaru, T. Sumida, N. Hayashi, and Y. Horie
Renoprotective effects of telmisartan in the 5/6 nephrectomised rats
Journal of Renin-Angiotensin-Aldosterone System, June 1, 2007; 8(2): 93 - 100.
[Abstract] [PDF]

Home page
 GutHome page
N. Oshitani, H. Yamagami, K. Watanabe, K. Higuchi, and T. Arakawa
Long-term prospective pilot study with tranilast for the prevention of stricture progression in patients with Crohn's disease
Gut, April 1, 2007; 56(4): 599 - 600.
[Full Text] [PDF]

Home page
 Nephrol Dial TransplantHome page
J. Soma, K. Sato, H. Saito, and Y. Tsuchiya
Effect of tranilast in early-stage diabetic nephropathy
Nephrol. Dial. Transplant., October 1, 2006; 21(10): 2795 - 2799.
[Abstract] [Full Text] [PDF]

Home page
 CJASNHome page
R. E. Gilbert, K. Connelly, D. J. Kelly, C. A. Pollock, and H. Krum
Heart Failure and Nephropathy: Catastrophic and Interrelated Complications of Diabetes
Clin. J. Am. Soc. Nephrol., March 1, 2006; 1(2): 193 - 208.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, D. J.
Right arrow Articles by Gilbert, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, D. J.
Right arrow Articles by Gilbert, R. E.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP