Mechanisms of Mitogen-Activated Protein Kinase Inhibition by Parathyroid Hormone in Osteoblast-Like Cells
Meike Hömme,
Claus P. Schmitt,
Otto Mehls and
Franz Schaefer
University Children’s Hospital, Division of Pediatric Nephrology, University of Heidelberg, Germany.
Correspondence to Dr. Meike Hömme, Division of Pediatric Nephrology, University Children’s Hospital, Im Neuenheimer Feld 151, 69120 Heidelberg, Germany. Phone: 49-6221-56-8366; Fax: 49-6221-56-4203; E-mail: meike_hoemme{at}med.uni-heidelberg.de
Parathyroid hormone (PTH) dose dependently inhibits growthfactor– and stress-induced osteoblast proliferation viainactivating mitogen-activated protein kinase (MAPK) signalingpathways. Osteoblasts have recently been shown to express MAPKphosphatase (MKP)-1, a dual-specific phosphatase inactivatorof MAPK. Investigated was the role of MKPs in the PTH-inducedattenuation of MAPK and Jun N-terminal kinase (JNK) signalingin osteoblast-like UMR106-01 cells. PTH induced a persistentinhibition of p42/44 MAPK and JNK phosphorylation starting at10 min of incubation and lasting for at least 2 h. ActinomycinD affected both p42/44 MAPK and JNK dephosphorylation by PTH,suggesting a transcription-dependent mechanism of action. PTHrapidly and transiently induced expression of MKP-1. MKP-1 mRNAwas already elevated after 10 min of 10–7 M PTH incubation,reached maximal expression after 30 to 60 min, and remainedelevated after 4 h. MKP-1 protein was also upregulated within30 to 60 min of PTH administration. The protein kinase A inhibitorH89 partly reduced PTH-induced MKP-1 expression, but the proteinkinase C inhibitor bisindolylmaleimide had no effect, suggestingthat PTH induces MKP-1 mainly via the protein kinase A pathway.MKP-2 mRNA was downregulated after 2 h after an early periodof induction, and MKP-3 mRNA was immediately reduced. Ro 318-220did not affect PTH-induced MAPK inactivation but effectivelyblocked JNK dephosphorylation. The time course of PTH-inducedMKP-1 protein expression closely correlated with JNK dephosphorylation.PTH attenuates the stress-induced JNK signaling pathway in osteoblastsvia induction of MKP-1 synthesis but inhibits the p42/44 MAPKpathway mainly via transcription-independent mechanisms.
Parathyroid hormone (PTH) is a major regulator of calcium homeostasisand has catabolic and anabolic effects on bone and osteoblastsin vivo and in vitro, depending on the temporal pattern of administration(1,2). Upon binding to its G-protein–coupled receptor(PTH/PTHrP-R), PTH activates both Gs-coupled adenylate cyclaseand Gq-coupled phospholipase C, resulting in activation of bothcAMP/protein kinase A (PKA) and protein kinase C (PKC)/Ca2+signal transduction pathways (3,4). Besides these well definedsignaling pathways, the mitogen-activated protein kinase (MAPK)signaling cascades have recently received attention as essentialdownstream targets of G protein coupled receptor signaling (5).
Three MAPK subfamilies have been identified: the p42/44 or extracellularsignal-regulated kinases, the stress-activated protein kinase/c-JunNH2 terminal kinase (JNK), and the p38 MAPK. The p42/44 MAPKcascade is activated by various growth factors binding to receptorswith intrinsic tyrosine kinase activity (6). This well-establishedpathway includes the sequential activation via tyrosine phosphorylationof Raf and MEK, which in turn phosphorylates p42/44 MAPK atboth threonine and tyrosine residues. Upon translocation tothe nucleus, p42/44 MAPK phosphorylate multiple substrates suchas the transcription factors p90RSK, Elk-1, and c-myc (reviewedin (7)). The JNK and p38 MAPK pathways are activated by certainmitogens, inflammatory cytokines, and environmental stressessuch as heat, UV exposure, and osmotic and oxidative stress(7), all of which activate GTP-binding proteins of the Rho family(Rac, Rho, cdc42). These proteins phosphorylate MEKKs, ASK,or the mixed-lineage kinases, which in turn activate eitherthe JNK kinases MKK 4 and 7, or the p38 MAPK kinases MKK 3 and6. Activation of the JNK signaling cascade results in phosphorylationof transcription factors such as c-Jun, p53, ATF-2, and Elk-1,which in turn lead to AP-1 induction (8), a key regulator ofcellular apoptosis and cell survival (7), as well as certainstress responses (9). The p38 subfamily is involved in the regulationof cell motility, transcription, and chromatin remodeling (7).
PTH markedly inhibits p42/44 MAPK (10) and JNK activation inosteoblasts (11), an effect mediated via the PKA pathway. PKAsignaling can directly interfere with MAPK cascades by nontranscriptionalmechanisms, e.g., by inactivation of Ras-dependent signals (12).Another possible regulatory mechanism is the induction of inactivatingprotein phosphatases. The MAPK are dephosphorylated by a familyof dual-specific phosphatases, which target both phosphotyrosineand phospho-serine/-threonine residues (13). PTH-related protein(PTHrP) has recently been shown to induce MAPK phosphatase (MKP)-1in pancreatic cells (14). MKP-1 has recently been demonstratedto be upregulated by glucocorticoids in osteoblastic cells,with concurrent inactivation of p42/44 MAPK and reduction ofosteoblast proliferation (15).
We investigated a possible regulation of MKPs by PTH in osteoblastsand the role of these phosphatases in the PTH-induced inactivationof mitogenic protein kinase signaling. We observed a PKA-mediated,rapid and transient induction of MKP-1 by PTH. MKP-1 expressionwas necessary for PTH to inhibit JNK, but not p42/44 MAPK phosphorylation.
Materials
Recombinant human PTH (1-34) and PTH (3-34) were purchased fromBachem (Heidelberg, Germany). Actinomycin D, cycloheximide,H-89, bisindolylmaleimide, Ro 318-220, and forskolin were obtainedfrom Sigma-Aldrich Chemicals (Munich, Germany). -Actin monoclonalantibody was obtained from Abcam (Cambridge, UK), and p42/44MAPK, phospho p42/44 MAPK, SAPK/JNK, phospho-SAPK/JNK, and HRP-conjugated(anti-rabbit, anti-mouse) antibodies were purchased from CellSignaling Technology (Frankfurt, Germany). MKP-1, -2, and -3antibodies were purchased from Santa Cruz (Heidelberg, Germany).
Cell Culture.
UMR 106-01 rat osteoblast-like osteosarcoma cells (providedby David Feldman, Stanford University, CA) were grown in 75-cm2cell culture flasks at 37°C in humidified 5% CO2 atmospherein MEM (with Earle salts) supplemented with 10% FBS, 100 U/mlpenicillin/streptomycin, and 10 mM HEPES. Cells were passagedevery 3 to 4 d, and experiments were performed with cells frompassages 15 to 22. Subconfluent cultures were kept in serum-freemedium for 24 h before stimulation. To induce JNK phosphorylation,cells were serum starved for 48 h.
Western Immunoblotting.
After incubation with the substances indicated, cells were washedonce with cold PBS and lysed with ice-cold lysis buffer (20mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Triton X-100) containinga cocktail of proteinase and phosphatase inhibitors (20 mM NaF,2 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 1 mM PMSF, 10 µg/mlleupeptin, 10 µg/ml aprotinine, 3 mM benzamidine), vortexed,and centrifuged for 15 min at 15,000 x g. For separation ofnuclear and cytoplasmic proteins, we used the commercially availableNE-Per Kit (Perbio Sciences, Bonn) and followed the manufacturer’sinstructions. The protein content of the supernatants was measuredby the Bradford method (Protein Assay Kit; BioRad, Munich, Germany),and Western blot test was performed as described previously(16).
Real-Time RT-PCR.
RNA was isolated with Tri Reagent (Sigma, Munich), checked forintegrity on an agarose gel, and quantified photometrically.One microgram of total RNA was reverse transcribed with oligo(dT)/randomhexamer primers (10:1). Real time RT-PCR was performed withthe ABI Prism 7000 Real Time PCR system (Applied Biosystems,Darmstadt, Germany) with specific primers for 18S (forward:AGTTGGTGGAGCGATTTGTC; reverse: GCTGAGCCAGTTCAGTGTAGC, ampliconlength 205 bp), MKP-1 (forward: TCCAAGGAGGATATGAAGCGTT reverse:GCTACAGGAGCTGCATCCG, amplicon length: 134 bp), MKP-2 (forward:CCATCGAATACATAGACGCAGTGA, reverse: CGAAAGCCTCCTCCAGCC, ampliconlength: 138 bp), or MKP-3 (forward: GAGCCAAAACCTGTCCCAGTT, reverse:CAAGCAATGCACCAGGACAC, amplicon length: 91 bp) and UniversalMastermix (also Applied Biosystems) with SYBR green to detectPCR products at the end of each amplification step. Serial dilutionsof an arbitrary cDNA pool were used to establish a standardcurve. Relative quantities of RNA levels were determined accountingfor amplification efficacy by the software provided with thePCR system. mRNA levels were normalized to corresponding 18Squantities determined within the same run. (RT-)RNA controlsin which the cDNA synthesis step was omitted and controls withouttemplate did not show a detectable amplification product.
Time Course of p42/44 MAPK and JNK Inhibition by PTH
The effects of PTH on p42/44 MAPK and JNK phosphorylation wereassessed by Western blot test that used phosphorylation state-specificantibodies. UMR 106-01 cells were coincubated with EGF (1 ng/ml)and maximally effective PTH concentrations (10–7 M (10))for 10 min to 4 h. Incubation with PTH resulted in a rapid andpersistent inhibition of basal and EGF-induced p42/44 MAPK phosphorylation(Figure 1). The maximal inhibitory effect occurred after 60min of exposure to PTH. The inhibition was seen both in thecytoplasmic and the nuclear compartment (results not shown).To induce JNK activation, the cells were deprived of serum for48 h. PTH administration caused a rapid, dynamic inhibitionof JNK phosphorylation (Figure 2), which was maximal after 45min.
Figure 1. Inhibition of basal and EGF-induced p42/44 mitogen-activated protein kinase (MAPK) phosphorylation by parathyroid hormone (PTH). Twenty-four-hour serum-deprived cells were left untreated or treated with 10–7 M PTH (1-34) 5 min before the addition of 1 ng/ml EGF for indicated incubation times, and harvested for Western immunoblotting.
Figure 2. Inhibition of Jun N-terminal kinase (JNK) phosphorylation and induction of mitogen-activated protein kinase phosphatase (MKP)-1 protein expression by parathyroid hormone (PTH). Forty-eight-hour serum-deprived cells were left untreated or treated with 10–7 M PTH (1-34) for indicated incubation times, and harvested for Western immunoblotting. (A) MKP-1 expression; loading control, -actin. (B) JNK phosphorylation.
Rapid Induction of MKP-1 Expression by PTH
The effect of PTH on MKP-1 transcription was investigated byreal-time RT-PCR (Figures 3A and 4A). MKP-1 mRNA abundance wasalready increased after 10 min of incubation with 10–7M PTH, reached maximal expression after 30 to 60 min, and graduallydeclined thereafter, but remained elevated after 4 h (Figure 3A).MKP-2 gene expression was induced after 1 h, but decreasedafter 2 to 4 h of PTH-incubation. MKP-3 mRNA abundance decreasedafter 1 to 2 h of PTH exposure (Figure 3B, C). MKP-2 and -3protein abundance did not change during the first 4 h of PTHincubation (data not shown). MKP-1 mRNA and protein were dose-dependentlyinduced by PTH doses between 10–0 M and 10–7 M,with a maximal effect at 10–7 M (Figure 4, A and C). MKP-1protein was upregulated within 30 to 60 min after PTH administration(Figure 2).
Figure 3. Time-dependent induction of mitogen-activated protein kinase phosphatase (MKP)-1 expression by parathyroid hormone (PTH). RNA isolation, cDNA synthesis, and real-time RT-PCR was performed as described in text. Twenty-four-hour serum-deprived cells were left untreated or incubated with 10–7 M PTH (1-34) for the indicated incubation times, then harvested. (A) MKP-1 expression. (B) MKP-2 expression. (C) MKP-3 expression.
Figure 4. Parathyroid hormone (PTH)-induced mitogen-activated protein kinase phosphatase (MKP)-1 expression is dose and PKA dependent. (A, C) Serum-deprived cells were left untreated or incubated with different concentrations of PTH (1-34). (B, D) Cells were incubated with 10–7 M PTH (1-34) with or without 20 µM H89 or 10–7 M bisindolylmaleimide (BIS), 10–7 M PTH (3-34), or 10–7 M forskolin (FSK) for 1 h. (A, B) MKP-1 mRNA levels. (C, D) MKP-1 protein expression with -actin as loading control.
Effect of PKA and PKC Inhibition on PTH-Induced MKP-1 Expression
To investigate which of the signal transduction pathways coupledto the PTH/PTHrP receptor is responsible for MKP-1 induction,the PKA pathway was inhibited by H-89 and the PKC pathway bybisindolymaleimide. H-89 partly reduced PTH-induced MKP-1 mRNAand protein expression, whereas bisindolymaleimide had no effect.Furthermore, the PKA activator forskolin induced MKP-1 expression,whereas PTH (3-34), a fragment selectively inducing PKC signaling,showed no induction of MKP-1 (Figure 4, B and D).
Effect of Actinomycin D and Ro 31-8220 on PTH-Induced Attenuation of p42/44 MAPK and JNK Activation
To further characterize the possible mechanism responsible forthe inhibition of p42/44 MAPK and JNK phosphorylation by PTH,cells were preincubated with actinomycin D, a transcriptioninhibitor or cycloheximide (CHX), a translation inhibitor, beforeexposure to PTH. The PTH-induced attenuation of p42/44 MAPKphosphorylation was affected after 30 to 60 min of actinomycinD incubation, whereas preincubation of UMR 106-01 cells withCHX increased PTH-induced attenuation of p42/44 MAPK phosphorylation.(Figure 5). In contrast, the PTH-induced inhibition of JNK phosphorylationwas nearly fully reversed by actinomycin D as well as by CHXpreincubation (Figure 6), suggesting a mechanism involving genetranscription and de novo protein synthesis.
Figure 5. Effect of actinomycin D (Act. D) and cycloheximide (CHX) on parathyroid hormone (PTH)-induced attenuation of p42/44 mitogen-activated protein kinase (MAPK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with actinomycin D or CHX before they were treated with or without 10–7 M PTH (1-34) and 1 ng/ml EGF for the indicated times.
Figure 6. Effect of actinomycin D (Act. D) and CHX on parathyroid hormone (PTH)–induced attenuation of Jun N-terminal kinase (JNK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with actinomycin D (5 µg/ml) or CHX (35 µM) before they were treated with or without 10–7 M PTH (1-34) for 1 h.
To confirm the involvement of MKP-1 in the attenuating effectof PTH on MAPK phosphorylation, Ro 31-8220, an inhibitor ofMKP-1 expression, was administered (14,17,18). We confirmedthat Ro 31-8220 inhibited PTH-induced MKP-1 mRNA and proteinexpression in our model (Figure 7). Ro 31-8220 incubation aloneinduced p42/44 MAPK (Figure 8) and JNK phosphorylation (Figure 9).PTH still attenuated p42/44 MAPK phosphorylation in Ro 31-8220–treatedcells (Figure 8), whereas preincubation of Ro 31-8220 blockedthe PTH-induced attenuation of JNK phosphorylation (Figure 9).
Figure 7. Ro 31-8220 and actinomycin D inhibit mitogen-activated protein kinase phosphatase (MKP)-1 expression. Serum-deprived cells were left untreated or preincubated for 1 h with Ro 31-8220 (10–6M) or actinomycin D (Act. D; 5 µg/ml) before they were treated with or without 10–7 M parathyroid hormone (PTH) (1-34) for 1 h. (A) MKP-1 mRNA abundance. (B) MKP-1 protein abundance with -actin as loading control.
Figure 8. Effect of Ro 31-8220 on parathyroid hormone (PTH)–induced attenuation of p42/44 mitogen-activated protein kinase (MAPK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with 10–6M Ro 31-8220 before they were treated with or without 10–7 M PTH (1-34) and 1 ng/ml EGF for 1 h.
Figure 9. Effect of Ro 31-8220 on parathyroid hormone (PTH)–induced attenuation of Jun N-terminal kinase (JNK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with 10–6M Ro 31-8220 before they were treated with or without 10–7 M PTH (1-34) for 1 h.
This study provides evidence that PTH uses different mechanismsto attenuate the activation status of individual MAPK. We demonstratefor the first time that MKP-1 induction, a novel regulatorymechanism of MAPK signaling, is involved in the regulation ofosteoblasts by PTH. We set out on the observation of a distinctattenuating effect of PTH on the phosphorylation status of bothp42/44 MAPK and JNK in osteoblasts, a finding confirming previousresults in the same cell line as well as in primary osteoblasts(10,11). Because osteoblast cell turnover is critical to theregulation of bone mass, the suppression of MAPK could be acrucial mechanism mediating the profound catabolic action exertedby PTH at high doses, complementing its indirect activationof osteoclast proliferation via suppression of osteoblasticosteoprotegerin release. The attenuated phosphorylation of bothMAPK species by PTH occurs rapidly within 15 to 30 min, persistsfor more than 1 h, and is mediated via the cAMP/PKA pathway(10,11) (our own results; data not shown).
By pharmacologic blocking experiments, we found that PTH-inducedJNK dephosphorylation is mediated by a mechanism requiring activegene transcription and de novo protein synthesis. Inhibitionof gene transcription also partly abrogated PTH-induced p42/44MAPK dephosphorylation, whereas inhibition of translation increasedthe PTH-induced attenuating effect, suggesting that mechanism(s)requiring translation are responsible for preserving p42/44MAPK phosphorylation.
The transcription dependence of PTH-induced MAPK inhibitionwas somewhat surprising given the very rapid time course ofPTH-induced MAPK dephosphorylation, and this finding suggestedthe induction of one or several target genes with immediate-earlyresponse gene properties. The recent characterization of dual-specificphosphatases as immediate-early gene products (14,15) with rapidtranscriptional induction and short half-lives due to rapiddegradation by the 26S proteasome (19) made the members of theMKP subclass of this phosphatase family interesting candidatemediators of PTH-induced MAPK dephosphorylation. Indeed, wewere able to demonstrate that PTH rapidly and transiently inducesgene transcription and protein synthesis of MKP-1 in UMR106-01osteoblasts. This finding corresponds well to the recent demonstrationof MKP-1 induction by PTHrP in pancreatic cells (14) and theinducible expression of MKP-1 in osteoblasts exposed to glucocorticoids(15).
In contrast to the rapid and distinct upregulation of MKP-1,PTH suppressed, at a slower time course, MKP-2 and -3 gene expression,and did not alter MKP-2 and -3 protein expression within thefirst 4 h of PTH incubation. A rapid induction of MKP-1 andslow downregulation of MKP-3 was also seen with dexamethasonetreatment of mouse osteoblastic cells (15). The availabilityof a specific inhibitor of MKP-1 expression permitted us toanalyze the relative efficacy of MKP-1 in intercepting the individualMAPK pathways. Interestingly, the administration of Ro 31-8220increased both the basal phosphorylation of p42/44 MAPK in 24h serum-starved cells and its immediate stimulation by the growthfactor EGF, suggesting the presence of some constitutive MKP-1activity. However, when the MKP-1 inhibitor was coadministeredwith EGF and PTH, the attenuating effect of PTH on p42/44 MAPKphosphorylation was largely retained. In contrast, MKP-1 inhibitionfully abolished the attenuating effect of PTH on starvationstress-induced JNK phosphorylation. Hence, our results provideevidence that PTH uses differential cellular mechanisms to inactivatethe growth factor–dependent and the stress-dependent MAPKsignaling systems: MKP-1 is essential for PTH to attenuate JNKphosphorylation, whereas p42/44 MAPK phosphorylation is efficientlysuppressed by PTH even in the absence of MKP-1 activity. Thisresult is in keeping with MKP-1 binding affinity studies suggestingpreferential binding of the phosphatase to JNK (20–22),although MKP-1 has been found to bind to and dephosphorylatealso p42/44 MAPK under certain conditions (21).
The lacking effect of Ro 31-8220 and the in part transcription-independentsuppression of p42/44 MAPK phosphorylation suggest that thisPKA-mediated effect of PTH is mainly mediated by nongenomicmechanisms. PTH administration and PKA activation in generalare known to inhibit upstream mediators of p42/44 activation.In osteoblasts and fibroblasts, it has been reported that PKAinterferes with MAPK activation at the level of Raf-1 (10,23).PKA can inhibit Raf-1 either directly or via phosphorylationof the Rap1-GTPase, an antagonist of Ras-induced cell transformation(for a review, see (12)).
An important biologic role of MKP-1 in the regulation of inflammatorysignals has recently been postulated (24). Induced by cytokines,cellular stress, and glucocorticoids, MKP-1 might primarilyserve to limit inflammatory and stress responses on a cellularlevel by inhibiting JNK signaling, interfering less markedlywith mitogenic signals. The distinct induction of MKP-1 by glucocorticoids(15) and, as demonstrated in this study, PTH in osteoblastsadds the bone to the rapidly expanding range of tissues thatuse this mode of feedback regulation. According to this lineof reasoning, the action of PTH on osteoblast MAPK signalingcould be considered both anti-inflammatory (via MKP-1) and antiproliferative(via upstream inactivation of p42/44 MAPK pathway).
Acknowledgments
This study was supported by a grant from the Else Kröner-FreseniusFoundation.
Schmitt CP, Hessing S, Oh J, Weber L, Ochlich P, Mehls O: Intermittent administration of parathyroid hormone (1-37) improves growth and bone mineral density in uremic rats. Kidney Int 57: 1484–1492, 2000[CrossRef][Medline]
Tam CS, Heersche JNM, Murray TM, Parsons JA: Parathyroid hormone stimulates the bone apposition rate independently of its resorptive action: Differential effects of intermittent and continuous administration. Endocrinology 110: 506–512, 1982[Abstract]
Abou-Samra AB, Jüppner H, Force T, Freeman MW, Kong XF, Schipani E, Urena P, Richards J, Bonventre JV, Potts JT, Kronenberg HM, Segre GV: Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: A single receptor stimulates intracellular accumulation of both cAMP and inositol trisphosphates and increases intracellular free calcium. Proc Natl Acad Sci U S A 89: 2732–2736, 1992[Abstract/Free Full Text]
Dunlay R, Hruska K: PTH receptor coupling to phospholipase C is an alternate pathway of signal transduction in bone and kidney. Am J Physiol 258: F223–F231, 1990
Luttrell LM: G protein-coupled receptor signalling in neuroendocrine systems. J Mol Endocrinol 30: 117–126, 2003[Abstract]
van der Geer P, Hunter T, Lindberg RA: Receptor protein-tyrosine kinases and their signal transduction pathways. Annu Rev Cell Biol 10: 251–337, 1994[CrossRef][Medline]
Cowan KJ, Storey KB: Mitogen-activated protein kinases: New signaling pathways functioning in cellular responses to environmental stress. J Exp Biol 206: 1107–1115, 2003[Abstract/Free Full Text]
Kyriakis JM, Avruch J: Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807–869, 2001[Abstract/Free Full Text]
Tokuda H, Niwa M, Ito H, Oiso Y, Kato K, Kozawa O: Involvement of stress-activated protein kinase/c-Jun N-terminal kinase in endothelin-1–induced heat shock protein 27 in osteoblasts. Eur J Endocrinol 149: 239–245, 2003[Abstract]
Verheijen MHG, Defize LHK: Parathyroid hormone inhibits mitogen-activated protein kinase activation in osteosarcoma cells via a protein kinase A–dependent pathway. Endocrinology 136: 3331–3337, 2001
Doggett TA, Swarthout JT, Jefcoat SC, Wilhem D, Dieckmann A, Angel P, Partridge NC: Parathyroid hormone inhibits c-Jun N-terminal kinase activity in rat osteoblastic cells by a protein kinase A dependent pathway. Endocrinology 143: 1880–1888, 2002[Abstract/Free Full Text]
Stork PJS, Schmitt JM: Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol 12: 258–266, 2002[CrossRef][Medline]
Zhang B, Hosaka M, Sawada Y, Torii S, Mizutani S, Ogata M, Izumi T, Takeuchi T: Parathyroid hormone–related protein induces insulin expression through activation of MAP kinase–specific phosphatase-1 that dephosphorylates c-Jun NH2-terminal kinase in pankreatic -cells. Diabetes 52: 2720–2730, 2003[Abstract/Free Full Text]
Engelbrecht Y, de Wet H, Horsch K, Langeveldt CR, Hough FS, Hulley PA: Glucocorticoids induce rapid up-regulation of mitogen-activated protein kinase phosphatase-1 and dephosphorylation of extrcellular signal-regulated kinase and impair proliferation in human and mouse osteoblast cell lines. Endocrinology 144: 412–422, 2003[Abstract/Free Full Text]
Hömme M, Schmitt CP, Himmele R, Hoffmann GF, Mehls O, Schaefer F: Vitamin D and dexamethasone inversely regulate PTH induced regulator of G protein signaling (RGS)-2 expression in osteoblast-like cells. Endocrinology 144: 2496–2504, 2003[Abstract/Free Full Text]
Guo YL, Kang B, Williamson JR: Inhibtion of the expression of mitogen-activated protein phosphatase-1 potentiates apoptosis induced by tumor necrosis factor- in rat mesangial cells. J Biol Chem 273: 10362–10366, 1998[Abstract/Free Full Text]
Beltman J, McCormick F, Cook SJ: The selective protein kinase C inhibitor, Ro-31-8220, inhibits mitogen-activated protein kinase phosphatase-1 (MKP-1) expression, induces c-Jun expression, and activates Jun N-terminal kinase. J Biol Chem 271: 27018–27024, 1996[Abstract/Free Full Text]
Brondello JM, Brunet A, Pouyssegur J, McKenzie FR: The dual specific mitogen-activated protein kinase phosphatase-1 and-2 are induced by the p42/44 MAPK cascade. J Biol Chem 272: 1368–1376, 1997[Abstract/Free Full Text]
Franklin CC, Kraft AS: Conditionla expression of the mitogen-activated protein kinase (MAPK) phosphatase MKP-1 preferentially inhibits p38 MAPK and stress-activated protein kinase in U937 cells. J Biol Chem 272: 16917–16923, 1997[Abstract/Free Full Text]
Slack DN, Seternes OM, Gabrielsen M, Keyse SM: Distinct binding deteminants for Erk2/p38 and JNK MAP kinases mediate catalytic activation and substrate selectivity of MAP kinase phosphatase-1. J Biol Chem 276: 16491–16500, 2001[Abstract/Free Full Text]
Liu Y, Gorospe M, Yang C, Holbrook NJ: Role of mitogen-activated protein kinase phosphatase during the cellular response to genotoxic stress. J Biol Chem 270: 8377–8380, 1995[Abstract/Free Full Text]
Hordijk PL, Verlaan I, Jalink K, van Corven EJ, Moolenaar WH: CAMP abrogates the p21ras-mitogen-activated protein kinase pathway in fibroblasts. J Biol Chem 269: 3534–3538, 1994[Abstract/Free Full Text]
Clark AR: MAP kinase phosphatase 1: A novel mediator of biological effects of glucocorticoids? J Endocrinol 178: 5–12, 2003[Abstract]
Received for publication April 19, 2004.
Accepted for publication August 8, 2004.
Top
Abstract
Introduction
cells (14). MKP-1 has recently been demonstrated to be upregulated by glucocorticoids in osteoblastic cells, with concurrent inactivation of p42/44 MAPK and reduction of osteoblast proliferation (15). 
). MKP-1 mRNA abundance was already increased after 10 min of incubation with 10–7 M PTH, reached maximal expression after 30 to 60 min, and gradually declined thereafter, but remained elevated after 4 h (Figure 3A). MKP-2 gene expression was induced after 1 h, but decreased after 2 to 4 h of PTH-incubation. MKP-3 mRNA abundance decreased after 1 to 2 h of PTH exposure (Figure 3B, C). MKP-2 and -3 protein abundance did not change during the first 4 h of PTH incubation (data not shown). MKP-1 mRNA and protein were dose-dependently induced by PTH doses between 10–0 M and 10–7 M, with a maximal effect at 10–7 M (Figure 4, A and C). MKP-1 protein was upregulated within 30 to 60 min after PTH administration (Figure 2). 
in rat mesangial cells. J Biol Chem 273: 10362–10366, 1998
