Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


J Am Soc Nephrol 15: 2844-2850, 2004
© 2004 American Society of Nephrology
doi: 10.1097/01.ASN.0000143472.13214.2C

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hömme, M.
Right arrow Articles by Schaefer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hömme, M.
Right arrow Articles by Schaefer, F.

BASIC SCIENCE

Mechanisms of Mitogen-Activated Protein Kinase Inhibition by Parathyroid Hormone in Osteoblast-Like Cells

Meike Hömme, Claus P. Schmitt, Otto Mehls and Franz Schaefer

University Children’s Hospital, Division of Pediatric Nephrology, University of Heidelberg, Germany.

Correspondence to Dr. Meike Hömme, Division of Pediatric Nephrology, University Children’s Hospital, Im Neuenheimer Feld 151, 69120 Heidelberg, Germany. Phone: 49-6221-56-8366; Fax: 49-6221-56-4203; E-mail: meike_hoemme{at}med.uni-heidelberg.de


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Parathyroid hormone (PTH) dose dependently inhibits growth factor– and stress-induced osteoblast proliferation via inactivating mitogen-activated protein kinase (MAPK) signaling pathways. Osteoblasts have recently been shown to express MAPK phosphatase (MKP)-1, a dual-specific phosphatase inactivator of MAPK. Investigated was the role of MKPs in the PTH-induced attenuation of MAPK and Jun N-terminal kinase (JNK) signaling in osteoblast-like UMR106-01 cells. PTH induced a persistent inhibition of p42/44 MAPK and JNK phosphorylation starting at 10 min of incubation and lasting for at least 2 h. Actinomycin D affected both p42/44 MAPK and JNK dephosphorylation by PTH, suggesting a transcription-dependent mechanism of action. PTH rapidly and transiently induced expression of MKP-1. MKP-1 mRNA was already elevated after 10 min of 10–7 M PTH incubation, reached maximal expression after 30 to 60 min, and remained elevated after 4 h. MKP-1 protein was also upregulated within 30 to 60 min of PTH administration. The protein kinase A inhibitor H89 partly reduced PTH-induced MKP-1 expression, but the protein kinase C inhibitor bisindolylmaleimide had no effect, suggesting that PTH induces MKP-1 mainly via the protein kinase A pathway. MKP-2 mRNA was downregulated after 2 h after an early period of induction, and MKP-3 mRNA was immediately reduced. Ro 318-220 did not affect PTH-induced MAPK inactivation but effectively blocked JNK dephosphorylation. The time course of PTH-induced MKP-1 protein expression closely correlated with JNK dephosphorylation. PTH attenuates the stress-induced JNK signaling pathway in osteoblasts via induction of MKP-1 synthesis but inhibits the p42/44 MAPK pathway mainly via transcription-independent mechanisms.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Parathyroid hormone (PTH) is a major regulator of calcium homeostasis and has catabolic and anabolic effects on bone and osteoblasts in vivo and in vitro, depending on the temporal pattern of administration (1,2). Upon binding to its G-protein–coupled receptor (PTH/PTHrP-R), PTH activates both Gs-coupled adenylate cyclase and Gq-coupled phospholipase C, resulting in activation of both cAMP/protein kinase A (PKA) and protein kinase C (PKC)/Ca2+ signal transduction pathways (3,4). Besides these well defined signaling pathways, the mitogen-activated protein kinase (MAPK) signaling cascades have recently received attention as essential downstream targets of G protein coupled receptor signaling (5).

Three MAPK subfamilies have been identified: the p42/44 or extracellular signal-regulated kinases, the stress-activated protein kinase/c-Jun NH2 terminal kinase (JNK), and the p38 MAPK. The p42/44 MAPK cascade is activated by various growth factors binding to receptors with intrinsic tyrosine kinase activity (6). This well-established pathway includes the sequential activation via tyrosine phosphorylation of Raf and MEK, which in turn phosphorylates p42/44 MAPK at both threonine and tyrosine residues. Upon translocation to the nucleus, p42/44 MAPK phosphorylate multiple substrates such as the transcription factors p90RSK, Elk-1, and c-myc (reviewed in (7)). The JNK and p38 MAPK pathways are activated by certain mitogens, inflammatory cytokines, and environmental stresses such as heat, UV exposure, and osmotic and oxidative stress (7), all of which activate GTP-binding proteins of the Rho family (Rac, Rho, cdc42). These proteins phosphorylate MEKKs, ASK, or the mixed-lineage kinases, which in turn activate either the JNK kinases MKK 4 and 7, or the p38 MAPK kinases MKK 3 and 6. Activation of the JNK signaling cascade results in phosphorylation of transcription factors such as c-Jun, p53, ATF-2, and Elk-1, which in turn lead to AP-1 induction (8), a key regulator of cellular apoptosis and cell survival (7), as well as certain stress responses (9). The p38 subfamily is involved in the regulation of cell motility, transcription, and chromatin remodeling (7).

PTH markedly inhibits p42/44 MAPK (10) and JNK activation in osteoblasts (11), an effect mediated via the PKA pathway. PKA signaling can directly interfere with MAPK cascades by nontranscriptional mechanisms, e.g., by inactivation of Ras-dependent signals (12). Another possible regulatory mechanism is the induction of inactivating protein phosphatases. The MAPK are dephosphorylated by a family of dual-specific phosphatases, which target both phosphotyrosine and phospho-serine/-threonine residues (13). PTH-related protein (PTHrP) has recently been shown to induce MAPK phosphatase (MKP)-1 in pancreatic {beta} cells (14). MKP-1 has recently been demonstrated to be upregulated by glucocorticoids in osteoblastic cells, with concurrent inactivation of p42/44 MAPK and reduction of osteoblast proliferation (15).

We investigated a possible regulation of MKPs by PTH in osteoblasts and the role of these phosphatases in the PTH-induced inactivation of mitogenic protein kinase signaling. We observed a PKA-mediated, rapid and transient induction of MKP-1 by PTH. MKP-1 expression was necessary for PTH to inhibit JNK, but not p42/44 MAPK phosphorylation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Recombinant human PTH (1-34) and PTH (3-34) were purchased from Bachem (Heidelberg, Germany). Actinomycin D, cycloheximide, H-89, bisindolylmaleimide, Ro 318-220, and forskolin were obtained from Sigma-Aldrich Chemicals (Munich, Germany). {beta}-Actin monoclonal antibody was obtained from Abcam (Cambridge, UK), and p42/44 MAPK, phospho p42/44 MAPK, SAPK/JNK, phospho-SAPK/JNK, and HRP-conjugated (anti-rabbit, anti-mouse) antibodies were purchased from Cell Signaling Technology (Frankfurt, Germany). MKP-1, -2, and -3 antibodies were purchased from Santa Cruz (Heidelberg, Germany).

Cell Culture.
UMR 106-01 rat osteoblast-like osteosarcoma cells (provided by David Feldman, Stanford University, CA) were grown in 75-cm2 cell culture flasks at 37°C in humidified 5% CO2 atmosphere in MEM (with Earle salts) supplemented with 10% FBS, 100 U/ml penicillin/streptomycin, and 10 mM HEPES. Cells were passaged every 3 to 4 d, and experiments were performed with cells from passages 15 to 22. Subconfluent cultures were kept in serum-free medium for 24 h before stimulation. To induce JNK phosphorylation, cells were serum starved for 48 h.

Western Immunoblotting.
After incubation with the substances indicated, cells were washed once with cold PBS and lysed with ice-cold lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Triton X-100) containing a cocktail of proteinase and phosphatase inhibitors (20 mM NaF, 2 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinine, 3 mM benzamidine), vortexed, and centrifuged for 15 min at 15,000 x g. For separation of nuclear and cytoplasmic proteins, we used the commercially available NE-Per Kit (Perbio Sciences, Bonn) and followed the manufacturer’s instructions. The protein content of the supernatants was measured by the Bradford method (Protein Assay Kit; BioRad, Munich, Germany), and Western blot test was performed as described previously (16).

Real-Time RT-PCR.
RNA was isolated with Tri Reagent (Sigma, Munich), checked for integrity on an agarose gel, and quantified photometrically. One microgram of total RNA was reverse transcribed with oligo(dT)/random hexamer primers (10:1). Real time RT-PCR was performed with the ABI Prism 7000 Real Time PCR system (Applied Biosystems, Darmstadt, Germany) with specific primers for 18S (forward: AGTTGGTGGAGCGATTTGTC; reverse: GCTGAGCCAGTTCAGTGTAGC, amplicon length 205 bp), MKP-1 (forward: TCCAAGGAGGATATGAAGCGTT reverse: GCTACAGGAGCTGCATCCG, amplicon length: 134 bp), MKP-2 (forward: CCATCGAATACATAGACGCAGTGA, reverse: CGAAAGCCTCCTCCAGCC, amplicon length: 138 bp), or MKP-3 (forward: GAGCCAAAACCTGTCCCAGTT, reverse: CAAGCAATGCACCAGGACAC, amplicon length: 91 bp) and Universal Mastermix (also Applied Biosystems) with SYBR green to detect PCR products at the end of each amplification step. Serial dilutions of an arbitrary cDNA pool were used to establish a standard curve. Relative quantities of RNA levels were determined accounting for amplification efficacy by the software provided with the PCR system. mRNA levels were normalized to corresponding 18S quantities determined within the same run. (RT-)RNA controls in which the cDNA synthesis step was omitted and controls without template did not show a detectable amplification product.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Time Course of p42/44 MAPK and JNK Inhibition by PTH
The effects of PTH on p42/44 MAPK and JNK phosphorylation were assessed by Western blot test that used phosphorylation state-specific antibodies. UMR 106-01 cells were coincubated with EGF (1 ng/ml) and maximally effective PTH concentrations (10–7 M (10)) for 10 min to 4 h. Incubation with PTH resulted in a rapid and persistent inhibition of basal and EGF-induced p42/44 MAPK phosphorylation (Figure 1). The maximal inhibitory effect occurred after 60 min of exposure to PTH. The inhibition was seen both in the cytoplasmic and the nuclear compartment (results not shown). To induce JNK activation, the cells were deprived of serum for 48 h. PTH administration caused a rapid, dynamic inhibition of JNK phosphorylation (Figure 2), which was maximal after 45 min.



View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Inhibition of basal and EGF-induced p42/44 mitogen-activated protein kinase (MAPK) phosphorylation by parathyroid hormone (PTH). Twenty-four-hour serum-deprived cells were left untreated or treated with 10–7 M PTH (1-34) 5 min before the addition of 1 ng/ml EGF for indicated incubation times, and harvested for Western immunoblotting.

 


View larger version (39K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Inhibition of Jun N-terminal kinase (JNK) phosphorylation and induction of mitogen-activated protein kinase phosphatase (MKP)-1 protein expression by parathyroid hormone (PTH). Forty-eight-hour serum-deprived cells were left untreated or treated with 10–7 M PTH (1-34) for indicated incubation times, and harvested for Western immunoblotting. (A) MKP-1 expression; loading control, {beta}-actin. (B) JNK phosphorylation.

 
Rapid Induction of MKP-1 Expression by PTH
The effect of PTH on MKP-1 transcription was investigated by real-time RT-PCR (Figures 3A and 4AGo). MKP-1 mRNA abundance was already increased after 10 min of incubation with 10–7 M PTH, reached maximal expression after 30 to 60 min, and gradually declined thereafter, but remained elevated after 4 h (Figure 3A). MKP-2 gene expression was induced after 1 h, but decreased after 2 to 4 h of PTH-incubation. MKP-3 mRNA abundance decreased after 1 to 2 h of PTH exposure (Figure 3B, C). MKP-2 and -3 protein abundance did not change during the first 4 h of PTH incubation (data not shown). MKP-1 mRNA and protein were dose-dependently induced by PTH doses between 10–0 M and 10–7 M, with a maximal effect at 10–7 M (Figure 4, A and C). MKP-1 protein was upregulated within 30 to 60 min after PTH administration (Figure 2).



View larger version (28K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Time-dependent induction of mitogen-activated protein kinase phosphatase (MKP)-1 expression by parathyroid hormone (PTH). RNA isolation, cDNA synthesis, and real-time RT-PCR was performed as described in text. Twenty-four-hour serum-deprived cells were left untreated or incubated with 10–7 M PTH (1-34) for the indicated incubation times, then harvested. (A) MKP-1 expression. (B) MKP-2 expression. (C) MKP-3 expression.

 


View larger version (41K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Parathyroid hormone (PTH)-induced mitogen-activated protein kinase phosphatase (MKP)-1 expression is dose and PKA dependent. (A, C) Serum-deprived cells were left untreated or incubated with different concentrations of PTH (1-34). (B, D) Cells were incubated with 10–7 M PTH (1-34) with or without 20 µM H89 or 10–7 M bisindolylmaleimide (BIS), 10–7 M PTH (3-34), or 10–7 M forskolin (FSK) for 1 h. (A, B) MKP-1 mRNA levels. (C, D) MKP-1 protein expression with {beta}-actin as loading control.

 
Effect of PKA and PKC Inhibition on PTH-Induced MKP-1 Expression
To investigate which of the signal transduction pathways coupled to the PTH/PTHrP receptor is responsible for MKP-1 induction, the PKA pathway was inhibited by H-89 and the PKC pathway by bisindolymaleimide. H-89 partly reduced PTH-induced MKP-1 mRNA and protein expression, whereas bisindolymaleimide had no effect. Furthermore, the PKA activator forskolin induced MKP-1 expression, whereas PTH (3-34), a fragment selectively inducing PKC signaling, showed no induction of MKP-1 (Figure 4, B and D).

Effect of Actinomycin D and Ro 31-8220 on PTH-Induced Attenuation of p42/44 MAPK and JNK Activation
To further characterize the possible mechanism responsible for the inhibition of p42/44 MAPK and JNK phosphorylation by PTH, cells were preincubated with actinomycin D, a transcription inhibitor or cycloheximide (CHX), a translation inhibitor, before exposure to PTH. The PTH-induced attenuation of p42/44 MAPK phosphorylation was affected after 30 to 60 min of actinomycin D incubation, whereas preincubation of UMR 106-01 cells with CHX increased PTH-induced attenuation of p42/44 MAPK phosphorylation. (Figure 5). In contrast, the PTH-induced inhibition of JNK phosphorylation was nearly fully reversed by actinomycin D as well as by CHX preincubation (Figure 6), suggesting a mechanism involving gene transcription and de novo protein synthesis.



View larger version (43K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Effect of actinomycin D (Act. D) and cycloheximide (CHX) on parathyroid hormone (PTH)-induced attenuation of p42/44 mitogen-activated protein kinase (MAPK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with actinomycin D or CHX before they were treated with or without 10–7 M PTH (1-34) and 1 ng/ml EGF for the indicated times.

 


View larger version (44K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Effect of actinomycin D (Act. D) and CHX on parathyroid hormone (PTH)–induced attenuation of Jun N-terminal kinase (JNK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with actinomycin D (5 µg/ml) or CHX (35 µM) before they were treated with or without 10–7 M PTH (1-34) for 1 h.

 
To confirm the involvement of MKP-1 in the attenuating effect of PTH on MAPK phosphorylation, Ro 31-8220, an inhibitor of MKP-1 expression, was administered (14,17,18). We confirmed that Ro 31-8220 inhibited PTH-induced MKP-1 mRNA and protein expression in our model (Figure 7). Ro 31-8220 incubation alone induced p42/44 MAPK (Figure 8) and JNK phosphorylation (Figure 9). PTH still attenuated p42/44 MAPK phosphorylation in Ro 31-8220–treated cells (Figure 8), whereas preincubation of Ro 31-8220 blocked the PTH-induced attenuation of JNK phosphorylation (Figure 9).



View larger version (36K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Ro 31-8220 and actinomycin D inhibit mitogen-activated protein kinase phosphatase (MKP)-1 expression. Serum-deprived cells were left untreated or preincubated for 1 h with Ro 31-8220 (10–6M) or actinomycin D (Act. D; 5 µg/ml) before they were treated with or without 10–7 M parathyroid hormone (PTH) (1-34) for 1 h. (A) MKP-1 mRNA abundance. (B) MKP-1 protein abundance with {beta}-actin as loading control.

 


View larger version (34K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 8. Effect of Ro 31-8220 on parathyroid hormone (PTH)–induced attenuation of p42/44 mitogen-activated protein kinase (MAPK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with 10–6M Ro 31-8220 before they were treated with or without 10–7 M PTH (1-34) and 1 ng/ml EGF for 1 h.

 


View larger version (53K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 9. Effect of Ro 31-8220 on parathyroid hormone (PTH)–induced attenuation of Jun N-terminal kinase (JNK) phosphorylation. Serum-deprived cells were left untreated or preincubated for 1 h with 10–6M Ro 31-8220 before they were treated with or without 10–7 M PTH (1-34) for 1 h.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study provides evidence that PTH uses different mechanisms to attenuate the activation status of individual MAPK. We demonstrate for the first time that MKP-1 induction, a novel regulatory mechanism of MAPK signaling, is involved in the regulation of osteoblasts by PTH. We set out on the observation of a distinct attenuating effect of PTH on the phosphorylation status of both p42/44 MAPK and JNK in osteoblasts, a finding confirming previous results in the same cell line as well as in primary osteoblasts (10,11). Because osteoblast cell turnover is critical to the regulation of bone mass, the suppression of MAPK could be a crucial mechanism mediating the profound catabolic action exerted by PTH at high doses, complementing its indirect activation of osteoclast proliferation via suppression of osteoblastic osteoprotegerin release. The attenuated phosphorylation of both MAPK species by PTH occurs rapidly within 15 to 30 min, persists for more than 1 h, and is mediated via the cAMP/PKA pathway (10,11) (our own results; data not shown).

By pharmacologic blocking experiments, we found that PTH-induced JNK dephosphorylation is mediated by a mechanism requiring active gene transcription and de novo protein synthesis. Inhibition of gene transcription also partly abrogated PTH-induced p42/44 MAPK dephosphorylation, whereas inhibition of translation increased the PTH-induced attenuating effect, suggesting that mechanism(s) requiring translation are responsible for preserving p42/44 MAPK phosphorylation.

The transcription dependence of PTH-induced MAPK inhibition was somewhat surprising given the very rapid time course of PTH-induced MAPK dephosphorylation, and this finding suggested the induction of one or several target genes with immediate-early response gene properties. The recent characterization of dual-specific phosphatases as immediate-early gene products (14,15) with rapid transcriptional induction and short half-lives due to rapid degradation by the 26S proteasome (19) made the members of the MKP subclass of this phosphatase family interesting candidate mediators of PTH-induced MAPK dephosphorylation. Indeed, we were able to demonstrate that PTH rapidly and transiently induces gene transcription and protein synthesis of MKP-1 in UMR106-01 osteoblasts. This finding corresponds well to the recent demonstration of MKP-1 induction by PTHrP in pancreatic {beta} cells (14) and the inducible expression of MKP-1 in osteoblasts exposed to glucocorticoids (15).

In contrast to the rapid and distinct upregulation of MKP-1, PTH suppressed, at a slower time course, MKP-2 and -3 gene expression, and did not alter MKP-2 and -3 protein expression within the first 4 h of PTH incubation. A rapid induction of MKP-1 and slow downregulation of MKP-3 was also seen with dexamethasone treatment of mouse osteoblastic cells (15). The availability of a specific inhibitor of MKP-1 expression permitted us to analyze the relative efficacy of MKP-1 in intercepting the individual MAPK pathways. Interestingly, the administration of Ro 31-8220 increased both the basal phosphorylation of p42/44 MAPK in 24 h serum-starved cells and its immediate stimulation by the growth factor EGF, suggesting the presence of some constitutive MKP-1 activity. However, when the MKP-1 inhibitor was coadministered with EGF and PTH, the attenuating effect of PTH on p42/44 MAPK phosphorylation was largely retained. In contrast, MKP-1 inhibition fully abolished the attenuating effect of PTH on starvation stress-induced JNK phosphorylation. Hence, our results provide evidence that PTH uses differential cellular mechanisms to inactivate the growth factor–dependent and the stress-dependent MAPK signaling systems: MKP-1 is essential for PTH to attenuate JNK phosphorylation, whereas p42/44 MAPK phosphorylation is efficiently suppressed by PTH even in the absence of MKP-1 activity. This result is in keeping with MKP-1 binding affinity studies suggesting preferential binding of the phosphatase to JNK (20–22), although MKP-1 has been found to bind to and dephosphorylate also p42/44 MAPK under certain conditions (21).

The lacking effect of Ro 31-8220 and the in part transcription-independent suppression of p42/44 MAPK phosphorylation suggest that this PKA-mediated effect of PTH is mainly mediated by nongenomic mechanisms. PTH administration and PKA activation in general are known to inhibit upstream mediators of p42/44 activation. In osteoblasts and fibroblasts, it has been reported that PKA interferes with MAPK activation at the level of Raf-1 (10,23). PKA can inhibit Raf-1 either directly or via phosphorylation of the Rap1-GTPase, an antagonist of Ras-induced cell transformation (for a review, see (12)).

An important biologic role of MKP-1 in the regulation of inflammatory signals has recently been postulated (24). Induced by cytokines, cellular stress, and glucocorticoids, MKP-1 might primarily serve to limit inflammatory and stress responses on a cellular level by inhibiting JNK signaling, interfering less markedly with mitogenic signals. The distinct induction of MKP-1 by glucocorticoids (15) and, as demonstrated in this study, PTH in osteoblasts adds the bone to the rapidly expanding range of tissues that use this mode of feedback regulation. According to this line of reasoning, the action of PTH on osteoblast MAPK signaling could be considered both anti-inflammatory (via MKP-1) and antiproliferative (via upstream inactivation of p42/44 MAPK pathway).


    Acknowledgments
 
This study was supported by a grant from the Else Kröner-Fresenius Foundation.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schmitt CP, Hessing S, Oh J, Weber L, Ochlich P, Mehls O: Intermittent administration of parathyroid hormone (1-37) improves growth and bone mineral density in uremic rats. Kidney Int 57: 1484–1492, 2000[CrossRef][Medline]
  2. Tam CS, Heersche JNM, Murray TM, Parsons JA: Parathyroid hormone stimulates the bone apposition rate independently of its resorptive action: Differential effects of intermittent and continuous administration. Endocrinology 110: 506–512, 1982[Abstract]
  3. Abou-Samra AB, Jüppner H, Force T, Freeman MW, Kong XF, Schipani E, Urena P, Richards J, Bonventre JV, Potts JT, Kronenberg HM, Segre GV: Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: A single receptor stimulates intracellular accumulation of both cAMP and inositol trisphosphates and increases intracellular free calcium. Proc Natl Acad Sci U S A 89: 2732–2736, 1992[Abstract/Free Full Text]
  4. Dunlay R, Hruska K: PTH receptor coupling to phospholipase C is an alternate pathway of signal transduction in bone and kidney. Am J Physiol 258: F223–F231, 1990
  5. Luttrell LM: G protein-coupled receptor signalling in neuroendocrine systems. J Mol Endocrinol 30: 117–126, 2003[Abstract]
  6. van der Geer P, Hunter T, Lindberg RA: Receptor protein-tyrosine kinases and their signal transduction pathways. Annu Rev Cell Biol 10: 251–337, 1994[CrossRef][Medline]
  7. Cowan KJ, Storey KB: Mitogen-activated protein kinases: New signaling pathways functioning in cellular responses to environmental stress. J Exp Biol 206: 1107–1115, 2003[Abstract/Free Full Text]
  8. Kyriakis JM, Avruch J: Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807–869, 2001[Abstract/Free Full Text]
  9. Tokuda H, Niwa M, Ito H, Oiso Y, Kato K, Kozawa O: Involvement of stress-activated protein kinase/c-Jun N-terminal kinase in endothelin-1–induced heat shock protein 27 in osteoblasts. Eur J Endocrinol 149: 239–245, 2003[Abstract]
  10. Verheijen MHG, Defize LHK: Parathyroid hormone inhibits mitogen-activated protein kinase activation in osteosarcoma cells via a protein kinase A–dependent pathway. Endocrinology 136: 3331–3337, 2001
  11. Doggett TA, Swarthout JT, Jefcoat SC, Wilhem D, Dieckmann A, Angel P, Partridge NC: Parathyroid hormone inhibits c-Jun N-terminal kinase activity in rat osteoblastic cells by a protein kinase A dependent pathway. Endocrinology 143: 1880–1888, 2002[Abstract/Free Full Text]
  12. Stork PJS, Schmitt JM: Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol 12: 258–266, 2002[CrossRef][Medline]
  13. Theodosiou A, Ashworth A: MAPK kinase phosphatases. Genome Biol 3: reviews3009.1–reviews3009.10, 2002
  14. Zhang B, Hosaka M, Sawada Y, Torii S, Mizutani S, Ogata M, Izumi T, Takeuchi T: Parathyroid hormone–related protein induces insulin expression through activation of MAP kinase–specific phosphatase-1 that dephosphorylates c-Jun NH2-terminal kinase in pankreatic {beta}-cells. Diabetes 52: 2720–2730, 2003[Abstract/Free Full Text]
  15. Engelbrecht Y, de Wet H, Horsch K, Langeveldt CR, Hough FS, Hulley PA: Glucocorticoids induce rapid up-regulation of mitogen-activated protein kinase phosphatase-1 and dephosphorylation of extrcellular signal-regulated kinase and impair proliferation in human and mouse osteoblast cell lines. Endocrinology 144: 412–422, 2003[Abstract/Free Full Text]
  16. Hömme M, Schmitt CP, Himmele R, Hoffmann GF, Mehls O, Schaefer F: Vitamin D and dexamethasone inversely regulate PTH induced regulator of G protein signaling (RGS)-2 expression in osteoblast-like cells. Endocrinology 144: 2496–2504, 2003[Abstract/Free Full Text]
  17. Guo YL, Kang B, Williamson JR: Inhibtion of the expression of mitogen-activated protein phosphatase-1 potentiates apoptosis induced by tumor necrosis factor-{alpha} in rat mesangial cells. J Biol Chem 273: 10362–10366, 1998[Abstract/Free Full Text]
  18. Beltman J, McCormick F, Cook SJ: The selective protein kinase C inhibitor, Ro-31-8220, inhibits mitogen-activated protein kinase phosphatase-1 (MKP-1) expression, induces c-Jun expression, and activates Jun N-terminal kinase. J Biol Chem 271: 27018–27024, 1996[Abstract/Free Full Text]
  19. Brondello JM, Brunet A, Pouyssegur J, McKenzie FR: The dual specific mitogen-activated protein kinase phosphatase-1 and-2 are induced by the p42/44 MAPK cascade. J Biol Chem 272: 1368–1376, 1997[Abstract/Free Full Text]
  20. Franklin CC, Kraft AS: Conditionla expression of the mitogen-activated protein kinase (MAPK) phosphatase MKP-1 preferentially inhibits p38 MAPK and stress-activated protein kinase in U937 cells. J Biol Chem 272: 16917–16923, 1997[Abstract/Free Full Text]
  21. Slack DN, Seternes OM, Gabrielsen M, Keyse SM: Distinct binding deteminants for Erk2/p38{alpha} and JNK MAP kinases mediate catalytic activation and substrate selectivity of MAP kinase phosphatase-1. J Biol Chem 276: 16491–16500, 2001[Abstract/Free Full Text]
  22. Liu Y, Gorospe M, Yang C, Holbrook NJ: Role of mitogen-activated protein kinase phosphatase during the cellular response to genotoxic stress. J Biol Chem 270: 8377–8380, 1995[Abstract/Free Full Text]
  23. Hordijk PL, Verlaan I, Jalink K, van Corven EJ, Moolenaar WH: CAMP abrogates the p21ras-mitogen-activated protein kinase pathway in fibroblasts. J Biol Chem 269: 3534–3538, 1994[Abstract/Free Full Text]
  24. Clark AR: MAP kinase phosphatase 1: A novel mediator of biological effects of glucocorticoids? J Endocrinol 178: 5–12, 2003[Abstract]
Received for publication April 19, 2004. Accepted for publication August 8, 2004.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hömme, M.
Right arrow Articles by Schaefer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hömme, M.
Right arrow Articles by Schaefer, F.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP