Human Podocytes Possess a Stretch-Sensitive, Ca2+-Activated K+ Channel: Potential Implications for the Control of Glomerular Filtration
Michael J. Morton*,
Katie Hutchinson*,
Peter W. Mathieson,
Ian R. Witherden,
Moin A. Saleem and
Malcolm Hunter*
*School of Biomedical Sciences, University of Leeds, Leeds; and Academic Renal Unit, University of Bristol, Southmead Hospital, Bristol, United Kingdom
Correspondence to Dr. Malcolm Hunter, School of Biomedical Sciences, Worsley Building, University of Leeds, Leeds LS2 9NQ, UK. Phone: 44-133-3434240; Fax: 44-133-3434228; E-mail: m.hunter{at}leeds.ac.uk
Podocytes express many proteins characteristic of smooth muscle,such as actin and myosin. They also express receptors to severalvasoactive agents, including acetylcholine and angiotensin II;these phenotypic properties suggest that podocytes are not staticentities but may respond to physiologic stimuli. The electrophysiologicproperties of a conditionally immortalized human podocyte cellline that expresses the specific podocyte proteins nephrin,podocin, and synaptopodin were examined by patch clamp. Channelsthat were highly K+-selective and had a conductance of 224 ±11.5 pS in symmetrical 150 mM K+ solutions were identified.Channel activity was Ca2+- and voltage-dependent, being increasedwith an increase in Ca2+ or depolarization, and inhibited bypenitrem A. The conductance and voltage- and Ca2+-dependencesuggest that this is the large-conductance calcium-activatedK+ channel, BK (KCNMA1)—this was supported by reversetranscription-PCR experiments that showed the presence of theBK encoding mRNA, along with expression of KCNMB subunit types3 and 4. In sections of human glomeruli, immunocytochemistryrevealed that BK co-localizes with the podocyte-specific proteinnephrin, indicating that these channels are present in nativehuman podocytes. In whole-cell experiments, penitrem A inhibitedoutward currents to the same extent as tetra-ethyl ammonium(TEA) but did not affect the membrane potential. Channel activitywas also increased by applying suction to the patch pipetteor by dilution of the bathing medium, indicating that thesechannels are stretch sensitive. Thus, these channels do notcontribute to the resting membrane potential but are activatedby a rise in intracellular Ca2+, membrane depolarization, cellswelling, or membrane stretch. By implication, these resultssuggest that podocytes may be able to respond to changes inthe glomerular capillary pressure and modulate the GFR.
A key function of the mammalian kidney is the ability to filterselectively the plasma, allowing water and small molecules topass freely into the filtrate while retaining larger moleculessuch as plasma proteins. This filtration takes place in theglomerulus, a specialized knot of blood vessels whose wall formsthe filtration barrier and is composed of three layers: theendothelium, glomerular basement membrane, and visceral epithelialcells or podocytes. Podocytes have finger-like projections,called pedicels, or foot processes, that interdigitate withthose from neighboring cells and that are separated by a glycoproteinnetwork forming slit pores of 40 nM in width (1). Although therole of these slit pores in filtration is conjectural, thereis clear evidence that changes in podocyte morphology are associatedwith changes in the integrity of the glomerular filter; forexample, the loss of podocytes and progressive nephropathy ofdiabetes (2). Importantly, congenital forms of nephrotic syndromeare associated with mutations of podocyte-specific genes (1).The limited ability of the podocyte to repair and/or regenerateis believed to be crucial in progressive renal disease (3).
The physiologic function of the podocyte remains unknown. Itslocation within the glomerulus, surrounding the glomerular capillaries,means that it will be exposed to the transmural hydrostaticpressure favoring glomerular filtration. Podocytes contain actinand myosin, suggestive of contractile ability; if coupled withmechanosensitivity, these proteins would allow podocytes toreact to changes in capillary diameter and thus maintain thepatency of Bowman’s space in the face of variations inperfusion pressure. Mature podocytes express several types ofreceptor and second messenger systems (1). Receptors includemuscarinic, angiotensin II, prostaglandin E2, and atrial natriureticpeptide, which are targeted onto Ca2+, phospholipase C/inositol1,4,5-triphosphate (PLC/IP3), cAMP, and cyclic guanosine monophosphatesignal cascades. Thus, the evidence suggests that, far frombeing passive entities, simply providing passive support forthe capillary endothelium and slit pores, podocytes have therelevant cellular machinery to allow rapid responses to externalstimuli.
Remarkably little is known of podocyte electrophysiology, presumablybecause of the difficulty of isolation and the loss of phenotypein tissue culture (4). To date, published work has been limitedto measurements of the membrane potential and whole-cell conductancein rodent podocytes and their response to vasoactive agonists(5). The membrane potential lies between –38 and –64mV (6,7), suggesting moderate K+ selectivity but also the presenceof other conductances, such as Cl– or nonselective cationchannels.
In this article, we present the first recordings of single ionchannel activity from podocytes. To overcome the problem ofdedifferentiation associated with primary podocyte culture,we used a recently developed conditionally immortalized humanpodocyte cell line that expresses the specific podocyte proteinsnephrin, podocin, and synaptopodin (4).
Cell Culture
All experiments were carried out on an immortalized monoclonalcell line generated from outgrowths of explanted glomeruli ofhuman kidney that had been subsequently transfected with thetemperature-sensitive SV40 gene construct (4). The incorporationof this construct confers temperature sensitivity on cell development,such that at a permissive temperature of 33°C, the cellsremain in an undifferentiated proliferative state, whereas raisingthe temperature to 37°C results in growth arrest and differentiationto the parental podocyte phenotype. Undifferentiated podocytecultures were maintained at 33°C in plastic culture flasksthat contained RPMI 1640 medium with penicillin, streptomycin,ITS (insulin, transferrin, selenite), and 10% FCS. Once cellshad reached 70 to 80% confluence, they were transferred to anincubator set at 37°C and left for at least 14 d beforeuse, when full differentiation had taken place (4). On the daybefore a patch-clamp experiment, adherent cells were dispersedby brief incubation in Ca2+-free medium, followed by gentletrituration, seeded onto sterile glass coverslips, and maintainedat 37°C.
Electrophysiology
A small section of coverslip was transferred to a perfusionchamber (Model RC-22; Warner Instruments) situated on the stageof an inverted microscope (Nikon Diaphot) and standard patch-clamptechniques were used to measure channel activity in cell-attachedand inside-out configurations. All experiments were performedat room temperature. The bath perfusion system was a gravityfeed system such that the bath solution was flowing constantly.Several reservoirs that contained the various solutions fedinto a common manifold and were selected by a simple mechanicalswitch. Pipettes were fabricated from soda lime microhematocrittubes (LIP, Shipley, UK) using a two-stage puller (Model PP-83;Narishige) and had a resistance of 2 to 5 M when filled withpipette solution. After filling, patch pipettes were dippedbriefly, to a depth of 1 cm, i.e., greater than that experiencedby the pipette in the bath fluid, into Sigmacote (Sigma) toreduce stray capacitance and associated noise. Stable positioningof the pipette during recordings was achieved using a piezoelectricmanipulator (Burleigh Instruments). Currents were amplified(Axopatch 200B), low-pass filtered at 2 kHz, and recorded onlineat a sampling rate of 4 kHz via a Digidata 1322A interface (AxonInstruments). Data acquisition and analysis was performed withpClamp 8.0 software (Axon Instruments).
The standard bath solution had the following composition (inmM): 145 NaCl, 4.5 KCl, 2.0 CaCl2, 1.0 MgCl2, and 10 HEPES (pH7.4). In the hypotonic shock experiments, the bath solutionwas diluted by 30% by the addition of water. The pipette contained(in mM) 130 K gluconate, 15 KCl, 5.76 CaCl2 (free calcium concentration200 nM), 1.0 MgCl2, 10 EGTA, and 10 HEPES (pH 7.2). The equilibriumconcentrations of cations were calculated using React (GL Smith,University of Glasgow). For excised patch experiments, the totalcalcium was varied to give free calcium concentrations of 1,100, and 1000 nM, the pH being adjusted to 7.2 in all cases.
Reverse Transcription-PCR
Mature podocyte cultures, 14 d after thermoswitching, were rinsedwith RNase-free PBS and dispersed using trypsin-EDTA, and thecells were pelleted by brief centrifugation. The resulting pelletwas resuspended in Tri-Reagent (Sigma), and total RNA was purifiedby chloroform extraction and precipitation with isopropanol.Approximately 1 µg of total RNA was reverse-transcribedusing oligo-dT primers and Superscipt reverse transcriptase,according to the manufacturer’s instructions (Invitrogen).Reverse transcription (RT) products were subject to 30 to 40cycles of PCR with primers directed toward the and subunitsof BK channels (KCNMA1, KCNMB1–4) and SLACK (KCNT1). Primersequences were as follows (5' to 3'): KCNMA1 sense AACCCGCCCTATGAGTTTGand antisense GGATGGGATGGAGTGAACAG; 1 sense AGAGACACGAGCCCTTTGCCand antisense CGGTCAGCAGGAAGGTGG; 2 sense CAAAAGGAAAACAGTCACAGCand antisense GAAGAGTGAATGGAACAGCAC; 3 sense GAGAGGACCGAGCCGTGATGand antisense CACCACCTAGCAGAGTCAGTGAAG; 4 sense TTCTATCTTCGGCTTCTGCTGand antisense TGGCTGGGAACCAATCTCATC; SLACK sense AGATCCAGCCTGAGGATCCGand antisense GAAACACGGGGATGAACA. To control for genomic DNAcontamination, primers were designed to span intron sequences,and RT were performed in the absence of Superscript. The integrityof total RNA and efficacy of RT were confirmed by amplificationof -actin with sense GCATTGTTACCAACTGGGACG and antisense TGGAAGGTGGACAGTGAGGCprimers. The identity of PCR products was confirmed by agarosegel electrophoresis and automated fluorescence sequencing (LarkLaboratories). RT-PCR was performed in duplicate on total RNAfrom three different batches of podocytes.
Immunocytochemistry
Frozen sections (5 µM) were mounted on polylysine-coatedmicroscope slides and fixed with 2% paraformaldehyde and 4%sucrose in PBS for 10 min, then permeabilized with 0.3% TritonX-100 (Sigma) in PBS for 10 min. Sections were washed with 4%FCS in PBS for 5 min. Nonspecific binding sites were blockedwith 4% FCS + 0.1% Tween 20 (Sigma) in PBS for 30 min. Primaryantibodies and FITC- or TEXAS red-conjugated secondary antibodies(purchased from Biochem-Pharm, Salzburg, Austria) were appliedat 1:100 and 1:200 dilutions in the blocking solution, respectively(4). Sections were washed with 4% FCS in PBS for 3 x 10 minafter each antibody. Coverslips were mounted with 10 µlof Vectashield (Vector Laboratories, Burlingame, CA). Imageswere obtained using a Spot 2 slider digital camera (DiagnosticInstruments Inc., Sterling Heights MI) on a Leica DM-IRB photomicroscope(Wetzlar, Germany) and processed with Adobe Photoshop 6.0 software.
Results are presented as mean ± the SEM, with the numberof observations, n. Statistical analysis was performed usingt test (Excel, Microsoft), and graphs were plotted in Origin(Microcal).
In the cell-attached configuration, with Ringer solution inthe pipette and a high-K+ bath solution, BK channel activitywas evident upon strong depolarization (Figure 1, left). Underthese circumstances, the cell membrane potential will be closeto 0 mV, and there will be a chemical driving force favoringK+ movement from the cell to the pipette; however, in the absenceof an imposed potential, no channel activity was observed. Similarly,in a separate series of experiments, with the more physiologicRinger solution in the bath and either Ringer or a K+-rich solutionin the pipette, channel activity was evident only with applieddepolarizations in excess of 80 mV. Excision of the patch causedthe immediate appearance of channel activity (Figure 1, right)—inthis inside-out configuration, the cytosolic face of the channelis exposed to the bath solution that contains 1 mM Ca2+.
Figure 1. Channel activity in the cell-attached and inside-out patch configurations. Typical recordings with Ringer solution in the pipette and a K+-rich bath solution that contained 1 mM Ca2+. In the cell-attached configuration, channel activity is apparent only at the most positive potentials. Excision of the patch into the 1 mM Ca2+ bath solution results in a large increase in channel activity. Openings are upward in all traces.
The conductance and K+ selectivity of the channels is shownin Figure 2. The slope conductance in excised inside-out patchesin symmetrical 150 mM K+ was 224 ± 11.5 pS (n = 6). Fora K+-selective channel, lowering the bath perfusate K+ concentrationshould cause a rightward shift in the reversal potential, aswas seen with bath K+ concentrations of 31.5 and 4.5 mM. Thedata were reasonably well-described by the GHK equation (dottedlines are best fits), which gave estimates of the PK/PNa ratioof >100 (31.5 mM K+) and 21.5 (4.5 mM K+). Thus, the channelsare highly K+ selective.
Figure 2. Conductance and K+ selectivity of podocyte BK channels. Average current/voltage relationships in the absence of a K+ concentration gradient (150 K+ in both bath and pipette) and with bath concentrations of 31.5 and 4.5 mM (150 mM K+ in the pipette). Solid line is least-squares best fit to linear function, and dotted lines are best fits to GHK equation.
The Ca2+ and voltage dependence of the channels suggested inFigure 1 is shown more clearly in Figure 3. In excised patches,raising the Ca2+ concentration increases the open probabilityat any given potential. In addition, the open probability atany bath Ca2+ concentration increases with depolarization. Thevoltage dependence of channel open probability, Po, can be describedby the Boltzmann function Po = Pomax[(1/1 + e–(V –V0.5)z'F/RT))], where Pomax is the maximum Po, V is the membranepotential, V0.5 is the voltage at which Po is 0.5, z' is theeffective valence, F is Faraday’s constant, R is the gasconstant, and T is the absolute temperature. The effective valenceis an index of voltage sensitivity and was 1.91 ± 0.11at 1 mM Ca2+ and 2.12 ± 0.10 at 1 µM Ca2+.
Figure 3. Ca2+ and voltage dependence of channel activity. (Top) Typical recording showing high open probability in an inside-out patch that contains two channels with a high-Ca2+ (1 mM) bath solution. Switching bath perfusion to a solution that contains 10 nM free Ca+ results in a rapid reduction in channel activity. (Bottom) The open probability increases with depolarization and increased bath ("cytosolic") calcium activity (1 mM, 1 µM, and 10 nM, as indicated). Lines are best fits to the Boltzmann equation (see text).
BK channels are selectively inhibited by penitrem A (8). Inclusionof 100 nM penitrem A in the pipette solution gave a marked reductionin channel activity in cell-attached patches (Figure 4). Inthis series of experiments, the patch was depolarized by 160mV to ensure that channel activity could be detected. For minimizingpotential experimental artifacts, penitrem A was added to thepipette solution in alternate patches. All control patches showedBK channel activity, whereas channel activity was observed inonly one of the seven patches that were exposed to penitremA, and the mean channel activity was significantly reduced (Figure 4;NB, logarithmic scale of NPo).
Figure 4. Inhibition of channels by penitrem A. (TOP) Typical cell-attached recordings of channel activity at a holding potential 160 mV positive to the resting membrane potential, where outward currents are readily seen in the absence of penitrem A (control). Inclusion of penitrem A in the pipette solution drastically reduces the occurrence of channel openings. (Bottom) Mean data of channel activity (N.Po) for experiments depicted in top panel (control, n = 5; penitrem A, n = 7). Bars = 1 SEM. Note that the N.Po axis is logarithmic.
To detect macroscopic BK currents, we performed both conventionaland perforated patch whole-cell recordings. In both cases, wedetermined the sensitivity of the currents to the BK inhibitorstetra-ethyl ammonium (TEA) (5 mM) and penitrem A (100 nM) (8,9).In conventional whole-cell clamp, the cell becomes dialyzedwith the pipette solution, which had a Ca2+ activity of 100µM to maximize BK currents. The I/V curves (Figure 5)show a substantial outward current of 5.17 ± 0.7 pA/pF(539 ± 114 pA, n = 4) at 100 mV, which is inhibited tothe same extent by TEA and penitrem A, with a voltage dependenceand time course of activation characteristic of BK channels[e.g., see (10)]. To detect macroscopic BK currents at the restingintracellular Ca2+ activity, we used the perforated patch technique.The TEA- and penitrem A-sensitive currents at 100 mV were thesame as those in the whole-cell recordings, indicating thatmaximal channel activity was achieved in both recording modes.Penitrem A had no effect on the membrane potential: the meanchange was –0.2 mV ± 1.2 mV (n = 4), indicatingthat BK does not contribute to the resting membrane potential.
Figure 5. Whole cell currents. (TOP) Representative traces of whole-cell currents in control solution (left) and on addition of 5 mM TEA (right). (Bottom) Mean I/V relationships from four experiments with 100 µM Ca2+ in the patch pipette. Control 1 and control 2 were determined before and after TEA addition, respectively; the effect of TEA was reversible. Penitrem A (Pen A; 100 nM) was added after control 2 and caused irreversible inhibition.
During the course of these experiments, it was noted that currentnoise arising from the patch increased during the formationof a seal, when suction is typically applied to the rear ofthe pipette. Figure 6 shows the clear increase in channel activitywhen a negative pressure of 20 cmH2O is applied to cell-attachedpatches after the establishment of a Giga-seal. Such increasedactivity was completely reversible. Thus, these channels arestretch sensitive. Furthermore, cell swelling induced by hypotonicshock also increased channel activity in a reversible manner(Figure 7).
Figure 6. Activation of BK channels by negative pressure. Representative recording of channel activity in a cell-attached patch at 100 mV positive to the resting membrane potential. Channel openings are seen as upward current steps. Under control conditions, a few single-channel opening events are seen. Application of –20 cmH2O suction to the rear of the patch pipette results in a substantial increase in channel activity, such that it now becomes apparent that there are at least two channels in this patch. (Bottom) Data from seven experiments showing the reversible nature of the increase in channel activity with pipette suction; , mean values ± SEM.
Figure 7. Activation of BK channels by hypotonic shock. BK channel activity was measured in the cell-attached configuration before, during, and after dilution of the bath fluid. Results of 13 individual experiments are indicated by thin lines; , mean values ± SEM; the error bars fall within the symbols.
The two channels that could be responsible for these large-conductance,calcium-activated channel currents are BK (KCNMA1) and SLACK(KCNT1). To discriminate between these two gene product candidates,we performed RT-PCR of RNA derived from mature podocytes. Wecould detect no evidence of the expression of SLACK (Figure 8)—thiswas not due to inefficacy of the primers becausethe positive control brain tissue yielded products of appropriatesize. However, KCNMA1 mRNA was present in both brain- and podocyte-derivedRNA, suggestive of its expression in these cells. Finally, theproperties of BK channels are influenced by the accessory subunits(10). Once again, using brain RNA as positive control, we coulddetect evidence of 3 and 4 mRNA but not 1 or 2 mRNA in podocytes(Figure 9). In both of these sets of RT-PCR experiments, DNAproduct bands were absent in the negative-RT controls, indicatinglack of contamination. The ability to detect all subunits inbrain RNA but only 3 and 4 products in podocyte RNA indicatesthe selective expression of these two subunits in podocytes.
Figure 8. Identification of BK mRNA. Reverse transcription-PCR (RT-PCR) of mature podocyte (Po) and brain (Br) mRNA with primers specific for SLACK (KCNT1) and BK (KCNMA1, Slo). Negative RT (–) controls of podocyte mRNA were performed in the absence of reverse transcriptase. M is a 100-bp molecular weight ladder. Products were of the predicted sizes of 390 bp for SLACK and 159 bp for BK.
Figure 9. Identification of BK subunit mRNA. RT-PCR of mature podocyte (Po) and brain (Br) mRNA with primers specific for 1 to 4 as indicated. Negative RT (–) controls of podocyte mRNA were performed in the absence of reverse transcriptase. M is a 100-bp molecular weight ladder. Products were of the predicted sizes of 473, 508, 513, and 339 bp for 1 to 4, respectively.
To address the question as to whether KCNMA1 is present in nativehuman podocytes, we subjected human kidney sections to immunocytochemistrywith antibodies to KCNMA1 and the podocyte-specific marker nephrin(Figure 10, A and B). Coexpression of KCNMA1 and nephrin isshown by the yellow regions of the overlay (Figure 10C and indicatesthat KCNMA1 is expressed in podocytes in human kidney.
Figure 10. Localization of BK to native human podocytes. Immunocytochemistry of human kidney sections with anti-BK (A) and anti-nephrin (B) antibodies. The merged image is shown in C. Areas of co-localization of BK and nephrin are shown by arrows. Magnification, x400.
The glomerular podocytes form the earliest part of the nephronand are continuous, with the epithelial cells forming Bowman’scapsule. These specialized cells form a complex interdigitatingnetwork that envelops the glomerular capillary tuft and arean integral part of the filtration barrier. They are thoughtto be important in the determination of GFR and in the discriminationagainst the filtration of proteins. For years, it has been supposedthat these cells may have contractile activity, i.e., that theyare myogenic, and that they may be able to respond to changesin the glomerular capillary pressure (11). To enable this, thecells would need to respond to deformation; the discovery ofchannels whose open probability is increased by membrane stretch,reported in this article, provides the first direct experimentalevidence indicating that podocytes may be able to respond acutelyto mechanical stress.
The data presented in this article clearly show the presenceof BK channels in immortalized human podocytes and in nativehuman glomerular tissue, where BK channels co-localize withthe podocyte-specific marker nephrin. The large-conductance,high-K+ selectivity, Ca2+ and voltage dependence and sensitivityto penitrem A all are characteristic of BK channels (12). Inaddition, RT-PCR showed the presence of mRNA encoding the pore-forming subunit (KCNMA1) and two accessory subunits (KCNMB3 and KCNMB4).However, the lack of channel activity in the absence of an applieddepolarization or negative pressure, together with the lackof effect of penitrem A on the membrane potential, indicatesthat BK channels probably play little role in determining theresting membrane potential of immortalized human podocytes.However, the current study shows that these channels are activatedwhen the cell membrane is stretched, either by the applicationof negative pressure to the patch pipette or by an increasein intracellular pressure as a consequence of cell swelling.
The gating of BK channels is modulated by the coexpression of subunits (10). Our RT-PCR data indicated the presence of 3and 4 subunits. When coexpressed with the subunit in a heterologousexpression system, 4 caused a slight slowing of activation upondepolarization and increased the sensitivity to intracellularCa2+. A consequence of subunit expression is to confer estrogensensitivity on BK (13). This is of potential interest becauseestrogen increases GFR independent of changes in BP, i.e., itincreases Kf (14). By the same token, it has been postulatedthe contractile state of podocytes may alter the size of thefiltration slits and thereby alter Kf and GFR (11). This raisesthe possibility that the effects of estrogen on GFR are mediatedby changes in podocyte contractility.
What is the likely physiologic role of BK channels in podocytes?BK channels are present in a wide variety of cell types (15).In excitable cells such as neurons and myocytes, BK channelsprovide a negative-feedback mechanism to control the membranepotential, resulting in relatively long periods of silence duringotherwise intense activity, therefore avoiding overstimulation.In nonexcitable tissues, such as renal and colonic epithelia,they are involved in K secretion and volume regulation, whereasin exocrine glands, they play a role in stimulus-secretion coupling.Our own preliminary data on gene expression suggest a smoothmuscle phenotype of podocytes (16). Vascular smooth muscle cellsdepolarize as the luminal pressure is increased (17), possiblyas a consequence of activation of nonselective cation channels(18). Nonselective cation channel activation results in entryof Na+ and Ca2+, causing depolarization. At the same time, intracellularCa2+ is raised, as a result both of Ca2+ influx (19) and releasefrom intracellular stores (20). This increase in Ca2+ is accompaniedby an increase in BK channel activity, which acts to moderatethe degree of membrane depolarization (21); this is seen asa protective mechanism in limiting the degree of smooth musclecontraction such that the vessels remain patent. By analogy,one might hypothesize that the role of BK channels in podocytesis in the negative-feedback control of the membrane potential,thus moderating the degree of podocyte contraction in responseto membrane stretch.
In conclusion, this article provides the first evidence of theexpression and activity of BK channels in human podocytes. Thesechannels do not contribute to the resting membrane potentialbut are activated by a rise in intracellular Ca2+, membranedepolarization, membrane stretch, and an increase in cell volume.The stretch sensitivity lends further support to the idea thatpodocytes may be myogenic, capable of responding to changesin the glomerular capillary pressure and potentially affectingthe GFR.
Acknowledgments
We thank the Wellcome Trust for generous financial support.
Pavenstadt H, Kriz W, Kretzler M: Cell biology of the glomerular podocyte. Physiol Rev 83: 253–307, 2003[Abstract/Free Full Text]
Pagtalunan ME, Miller PL, Jumping-Eagle S, Nelson RG, Myers BD, Rennke HG, Coplon NS, Sun L, Meyer TW: Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 99: 342–348, 1997[Medline]
Kriz W, Gretz N, Lemley KV: Progression of glomerular diseases: Is the podocyte the culprit? Kidney Int 54: 687–697, 1998[CrossRef][Medline]
Saleem MA, O’Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing CY, Ni L, Mathieson PW, Mundel P: A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J Am Soc Nephrol 13: 630–638, 2002[Abstract/Free Full Text]
Pavenstadt H, Bek M: Podocyte electrophysiology, in vivo and in vitro. Microsc Res Tech 57: 224–227, 2002[CrossRef][Medline]
Gloy J, Henger A, Fischer KG, Nitschke R, Mundel P, Bleich M, Schollmeyer P, Greger R, Pavenstadt H: Angiotensin II depolarizes podocytes in the intact glomerulus of the Rat. J Clin Invest 99: 2772–2781, 1997[Medline]
Gloy J, Reitinger S, Fischer KG, Schreiber R, Boucherot A, Kunzelmann K, Mundel P, Pavenstadt H: Amino acid transport in podocytes. Am J Physiol Renal Physiol 278: F999–F1005, 2000[Abstract/Free Full Text]
Knaus HG, McManus OB, Lee SH, Schmalhofer WA, Garcia-Calvo M, Helms LM, Sanchez M, Giangiacomo K, Reuben JP, Smith AB III: Tremorgenic indole alkaloids potently inhibit smooth muscle high-conductance calcium-activated potassium channels. Biochemistry 33: 5819–5828, 1994[CrossRef][Medline]
Valverde MA, Rojas P, Amigo J, Cosmelli D, Orio P, Bahamonde MI, Mann GE, Vergara C, Latorre R: Acute activation of Maxi-K channels (hSlo) by estradiol binding to the beta subunit. Science 285: 1929–1931, 1999[Abstract/Free Full Text]
Pechere-Bertschi A, Maillard M, Stalder H, Bischof P, Fathi M, Brunner HR, Burnier M: Renal hemodynamic and tubular responses to salt in women using oral contraceptives. Kidney Int 64: 1374–1380, 2003[CrossRef][Medline]
Hille B. Ion channels of excitable membranes. 3rd edition. Sinauer Associates, Mass, USA, 2001
Witherden IR, Mathieson PW, Saleem MA. The differentiated glomerular podocyte displays key features of a contractile smooth muscle cell. J Am Soc Nephrol 14: 159A, 2003
Harder DR: Pressure-dependent membrane depolarization in cat middle cerebral artery. Circ Res 55: 197–202, 1984[Abstract/Free Full Text]
Setoguchi M, Ohya Y, Abe I, Fujishima M: Stretch-activated whole-cell currents in smooth muscle cells from mesenteric resistance artery of guinea-pig. J Physiol 501 [Suppl]: 343–353, 1997[CrossRef][Medline]
Davis MJ, Meininger GA, Zawieja DC: Stretch-induced increases in intracellular calcium of isolated vascular smooth muscle cells. Am J Physiol 263: H1292–H1299, 1992
Tanaka Y, Hata S, Ishiro H, Ishii K, Nakayama K: Stretching releases Ca2+ from intracellular storage sites in canine cerebral arteries. Can J Physiol Pharmacol 72: 19–24, 1994[Medline]
Kirber MT, Ordway RW, Clapp LH, Walsh JV Jr, Singer JJ: Both membrane stretch and fatty acids directly activate large conductance Ca2+-activated K+ channels in vascular smooth muscle cells. FEBS Lett 297: 24–28, 1992[CrossRef][Medline]
Received for publication April 8, 2004.
Accepted for publication August 24, 2004.
Related Article
This Month’s Highlights
J. Am. Soc. Nephrol. 2004 15: 2955-2958.
[Full Text][PDF]
This article has been cited by other articles:
M. A. Saleem, J. Zavadil, M. Bailly, K. McGee, I. R. Witherden, H. Pavenstadt, H. Hsu, J. Sanday, S. C. Satchell, R. Lennon, et al. The molecular and functional phenotype of glomerular podocytes reveals key features of contractile smooth muscle cells
Am J Physiol Renal Physiol,
October 1, 2008;
295(4):
F959 - F970.
[Abstract][Full Text][PDF]
E. Y. Kim, K.-J. Choi, and S. E. Dryer Nephrin binds to the COOH terminus of a large-conductance Ca2+-activated K+ channel isoform and regulates its expression on the cell surface
Am J Physiol Renal Physiol,
July 1, 2008;
295(1):
F235 - F246.
[Abstract][Full Text][PDF]
C. R. Neal, P. R. Muston, D. Njegovan, R. Verrill, S. J. Harper, W. M. Deen, and D. O. Bates Glomerular filtration into the subpodocyte space is highly restricted under physiological perfusion conditions
Am J Physiol Renal Physiol,
December 1, 2007;
293(6):
F1787 - F1798.
[Abstract][Full Text][PDF]
A. H. J. Salmon, I. Toma, A. Sipos, P. R. Muston, S. J. Harper, D. O. Bates, C. R. Neal, and J. Peti-Peterdi Evidence for restriction of fluid and solute movement across the glomerular capillary wall by the subpodocyte space
Am J Physiol Renal Physiol,
December 1, 2007;
293(6):
F1777 - F1786.
[Abstract][Full Text][PDF]
P. R. Grimm, R. M. Foutz, R. Brenner, and S. C. Sansom Identification and localization of BK-beta subunits in the distal nephron of the mouse kidney
Am J Physiol Renal Physiol,
July 1, 2007;
293(1):
F350 - F359.
[Abstract][Full Text][PDF]
R. Ma, J. L. Pluznick, and S. C. Sansom Ion Channels in Mesangial Cells: Function, Malfunction, or Fiction
Physiology,
April 1, 2005;
20(2):
102 - 111.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
40 nM in width (1). Although the role of these slit pores in filtration is conjectural, there is clear evidence that changes in podocyte morphology are associated with changes in the integrity of the glomerular filter; for example, the loss of podocytes and progressive nephropathy of diabetes (2). Importantly, congenital forms of nephrotic syndrome are associated with mutations of podocyte-specific genes (1). The limited ability of the podocyte to repair and/or regenerate is believed to be crucial in progressive renal disease (3). 
when filled with pipette solution. After filling, patch pipettes were dipped briefly, to a depth of 
and 
subunits of BK channels (KCNMA1, KCNMB1–4) and SLACK (KCNT1). Primer sequences were as follows (5' to 3'): KCNMA1 sense AACCCGCCCTATGAGTTTG and antisense GGATGGGATGGAGTGAACAG; 
, mean values ± SEM.
