Rescue of Defective Branching Nephrogenesis in Renal-Coloboma Syndrome by the Caspase Inhibitor, Z-VAD-fmk
Patsy Clark*,
Alison Dziarmaga*,
Michael Eccles, and
Paul Goodyer*,
*Department of Human Genetics, McGill University, Montreal, Quebec, Canada; Department of Pathology, University of Otago, Dunedin, New Zealand; Department of Pediatrics, McGill University, Montreal, Quebec, Canada.
Correspondence to Dr. Paul Goodyer, McGill University Montreal Children’s Hospital, 2300 Tupper Street, Room E222A, Montreal, Quebec, Canada H3H 1P3. Phone: 514-412-4400 ext 22584; Fax: 514-412-4359; E-mail: Paul.Goodyer{at}muhc.mcgill.ca
ABSTRACT. In renal-coloboma syndrome (RCS), null mutations ofthe PAX2 gene cause renal hypoplasia due to a congenital deficitof nephrons; affected individuals may develop renal insufficiencyin childhood. During normal kidney development, PAX2, is expressedat high levels throughout the arborizing ureteric bud (UB);recent observations suggest that one of its key roles is tosuppress apoptosis in this collecting duct lineage. The authorshypothesized that increased UB cell apoptosis due to PAX2 haploinsufficiencymust directly influence the rate of branching morphogenesisin developing kidney and the number of nephrons that can beformed before birth, when nephrogenesis in humans comes to anend. If so, the authors reasoned that caspase inhibitors mightbe used to suppress unwanted UB cell apoptosis during kidneydevelopment in Pax21Neu mutant mice and rescue the genetic UBbranching defect. E17.5 kidneys from Pax21Neu mutant mice hadsmaller (-25%) longitudinal cross-sectional area and 3.5-foldincrease in collecting duct cell apoptosis versus wild-typelittermates; mutant E13.5 kidney explants allowed to arborizefor 50 h in vitro had 18% fewer terminal branches than wild-types.However, exposure to the caspase inhibitor, Z-VAD-fmk (25 µM),significantly increased terminal branch number in mutant explants(23%). It also increased branching in wild-type explants, apparentlyreflecting an effect of Z-VAD-fmk on basal apoptosis inducedby ex vivo culture conditions. Similarly, when pregnant micewere injected daily with Z-VAD-fmk (10 µg/g weight fromE10.5 to E17.5), apoptosis of Pax21Neu fetal collecting ductcells was suppressed to 40% of untreated mutants; by E14, terminalbranch number was increased to 152% that of untreated litters.These studies support the hypothesis that PAX2 normally optimizesthe rate of branching morphogenesis in fetal kidney by suppressingUB apoptosis. Furthermore, it suggests that caspase inhibitorscan rescue the branching defect caused by PAX2 mutations.
During normal kidney development, interactions between the arborizingureteric bud (UB) and the metanephric mesenchyme (MM) generatethe nephrons of each kidney. This process begins at 5 to 6 wkfetal age, when the UB emerges from the nephric duct, growslaterally into the undifferentiated mesenchyme, and begins toarborize. Each terminal branch of the UB signals adjacent MMcells to form the proximal portion of a nephron, which thenfuses to the common collecting system. By about 1 mo beforebirth, when nephrogenesis comes to a halt, final nephron numberhas been determined by how many UB branching events have occurredin the intervening period. This crop of fetal nephrons willconstitute the individual’s nephron endowment for life.
Nephron number varies widely from 0.3 to 1.3 million/kidneyamong normal humans (1,2). Children born at the lower end ofthis spectrum may have increased risk of hypertension or susceptibilityto acquired renal disease later in life (3). In families withthe autosomal dominant renal-coloboma syndrome (RCS), more severerenal hypoplasia and ocular colobomas are caused by mutationsof a key developmental gene, PAX2 (4). Histopathologic studiesof this condition indicate that patients with heterozygous PAX2mutations have oligomeganephronia—residual nephrons arenormally formed and glomeruli exhibit appropriate compensatoryhypertrophy, but an absolute nephron deficit causes renal insufficiency(5).
The PAX2 gene encodes a nuclear transcription factor expressedin early stages of nephric duct formation, then in the UB, andfinally in proximal elements of the metanephric mesenchyme duringrenal development. Recent evidence suggests that PAX2 may havemultiple functions during renal development. It may determinecell fate during nephric duct formation (6), activate GDNF inmetanephric mesenchyme (7), and activate cell adhesion moleculesand cytoskeletal elements during conversion of metanephric mesenchymeinto epithelial cells of the emerging nephron (8). However,the highest levels of PAX2 expression during renal developmentare seen in the arborizing UB, and we have recently shown thatit appears to suppress programmed cell death pathways in thatlineage (8,9). PAX2 strongly suppresses apoptosis in culturedrenal cells (8), and we noted a striking increase in apoptotic(TUNEL-positive) UB cells of E15 fetal kidneys of mice heterozygousfor the PAX21Neu mutation (9). We have hypothesized (10) thatthe principal factor causing oligomeganephronia in RCS is lossof PAX2 anti-apoptotic function in the branching UB. If so,we reasoned that it might be possible to rescue defective nephrogenesisin RCS by administration of a caspase inhibitor during renaldevelopment.
Genotyping of Pax21Neu Mutant Mice
To genotype 1NEU mice, a method was used that combined the useof polymerase chain reaction (PCR) and digestion by the restrictionenzyme, XcmI (New England Biolabs, Beverly, MA). Specially designedprimers were used to create a restriction site for XcmI thatwould not otherwise have been present (Figure 1A). The senseand antisense primers used were 5' GTGTGAACCAGCTCGGGGGTG 3'and 5' GCCCAGGATTTTGCTGACACAGCC 3', respectively. The actualreaction was done using 1x PCR buffer (Life Technologies-BRL,Burlington, ON), 0.7 mM MgCl2 (Life Technologies-BRL), 1 µMeach of the sense and antisense primers, 0.06 mM dNTPs, 1 unitTaq polymerase (Life Technologies-BRL), 0.25 to 0.75 µgof DNA and distilled water to reach a final volume of 20 µl.The cycle began with a "hotstart" at 95°C for 3 min, followedby 35 cycles of 10 s at 95°C, 10 s at 61°C, and 20 sat 72°C, ending with an additional 3 min at 72°C anda 4°C soak. Three microliters of each of the amplified sampleswere digested for 1 h at 37°C with 1 unit XcmI restrictionenzyme (New England Biolabs), 2 units NEB2 buffer and distilledwater to reach the 20 µl final volume. The digested sampleswere then run on 10% polyacrylamide gels and visualized by ethidiumbromide staining. Wild-type mice displayed one band at 166 bp,and heterozygous 1Neu mice showed two bands, one at 166 bp andanother at 151 bp (Figure 1B). Homozygous 1Neu mice, if genotyped,would show one band at 151 bp. All samples of DNA used for genotypingwere obtained using the Wizard DNA Purification Kit (Promega,Madison, WI).
Figure 1. Genotyping Pax21Neu mice. For genotyping of Pax21Neu mice, PCR primers were designed to include a G for T substitution, creating a recognition site for XcmI in the 1Neu mutant but not the wild-type sequence (A). Xcm1 restriction of the resultant PAX2 PCR products from genomic DNA allowed identification of a shorter (151-bp) band in heterozygous mutants versus the 166-bp wild-type product after resolution in polyacrylamide gels. Representative wild-type (166-bp) and Pax21Neu mutant (151-bp) bands are seen (B).
Microdissection and Culture of Whole Fetal Kidneys in Presence of Z-VAD-fmk
Once C3H females (Charles River, St. Constant, QC) were impregnated,the litters were allowed to mature to embryonic day 13.5. Atthat time, the mother was sacrificed, and the embryos were removedfor dissection. The embryos were then transported on ice toa sterile tissue culture area, where their kidneys were removedwith the aid of a dissecting microscope (Leica, Nussloch, Germany)and fine dissecting instruments. Once microdissected, E13.5wild-type and Pax21Neu mutant fetal mouse kidneys were culturedat 37°C under 5% Co2/air for 50 h on 0.4-µm floatingfilters (Millipore, Bedford, MA). All explants were culturedin the presence of DMEM 10% FBS 1% Pen/Strep/Fungizone (LifeTechnologies BRL). Treated explants were cultured with 25 µMof the apoptosis inhibitor, Z-VAD-fmk (Calbiochem, Darmstadt,Germany).
Administration of Z-VAD-fmk In Vivo
Impregnated females carrying litters of wild-type and Pax21Neumutant embryos received daily intraperitoneal (IP) injectionsof Z-VAD-fmk (Calbiochem) (10 µg/g body weight) from E10.5to E17.5, at which time the mother was sacrificed and the embryosremoved. The kidneys of the embryos were isolated by microdissectionand immediately fixed with 4% formaldehyde. After approximately1 h of fixation in 4% formaldehyde, kidneys were transferredto 70% ethanol for longer-term storage.
Dolichos Biflorus Agglutinin Immunostaining
Explants were immediately fixed in 4% formaldehyde. After havingbeen fixed for 1 to 7 d, explants were washed four times for10 min with PBS 1% Triton X-100 and incubated overnight at 4°Cin a 1:100 dilution of Dolichos biflorus agglutinin (VectorLaboratories, Burlingame, CA) in PBS. The following day explantswere washed one time for 10 min and allowed to incubate overnightat 4°C in PBS 1% Triton X-100. The kidneys were visualizedby fluorescence microscopy.
Quantification of Branching Morphogenesis
Once images were obtained through the use of fluorescence microscopy,the pattern of branching of the collecting duct was traced outand the complexity of branching morphogenesis assessed by countingthe terminal ends. The counting of terminal branches was doneblindly, without knowledge of the genotypes or treatment status.Significance of the difference in means was determined by thepaired t test.
TUNEL Staining
The in situ cell death detection POD kit (Roche Diagnostics,Laval, QC) was used to detect apoptosis by terminal dUTP nick-endlabeling (TUNEL) in serial sagittal sections of paraffin-embeddedwild-type and Pax21Neu mutant kidneys. Tissue sections wereheated to 60°C for 1 h, deparaffinized, and rehydrated.They were then treated with 15 µg/ml proteinase K in 10mM Tris/HCl pH 7.5 for 20 min at room temperature. Next endogenousperoxidases were blocked by incubating the sections in 2% H2O2for 20 min at room temperature. The tissue sections were thenincubated in labeling solution for 85 min at 37°C and washedthree times for 3 min with PBS. The sections were then incubatedwith the peroxidase converter for 60 min at room temperature.After three washes of 3 min each with PBS, the tissue sectionswere incubated for 5 min at room temperature with DAB substratesolution (Vector Laboratories), counterstained with methyl greenand mounted using Permount (Fisher Scientific, Nepean, ON).
Quantification of Apoptosis
TUNEL-stained sections of fetal mouse kidney were imaged bylight microscopy and Spot Advanced digital imaging software.The images obtained were examined at high magnification (x400)to determine the number of TUNEL-positive cells present in thecollecting duct of each section of fetal kidney. All quantificationof apoptosis was done blindly and without knowledge of the genotypesor treatment status.
Identification of PARP Cleavage by Western Blot Analysis as a Measure of Apoptosis
Fetal explant kidneys were thoroughly lysed using an abrasiveWestern lysis buffer consisting of 62.5 mM Tris, pH 6.8, 10%Glycerol, 6 M urea, 2% SDS, and 5% -mercaptoethanol; sampleswere also sonicated for about 10 s (frequency: 25 W; amplitude:80). The samples were then heated to 65°C for 15 min andthe loading dye (to 1x) added. Once the loading dye had beenadded, the samples were boiled at 100°C for 5 min, spundown briefly in a microcentrifuge, and loaded on a polyacrylamidegel consisting of two layers; a top (stacking) layer (4%) anda lower (separating) layer (10%). The gel was run at 100 V forapproximately 2 h followed by an overnight transfer at 30 V.Once the transfer of protein from gel to membrane was complete,the membrane or "blot" went through a series of steps to tagthe protein of interest (PARP). The first step was to blockany nonspecific protein by incubating the blot in PBS-T (0.1%)+ 5% milk at room temperature for 2 h. The blot was then probedwith a primary antibody (1/100 PARP antibody; Oncogene, Hornby,ON) for an additional 2 h at room temperature, followed by 2washes of 10 min each with PBS-T (0.1%). The blot was then probedwith a secondary antibody (1/1000 Anti-Mouse; Amersham PharmaciaBiotech, England) and washed three times for 5 min with PBS-T(0.1%). The final step was to develop the blot by immersingit in a developing solution (ECL; Amersham Pharmacia Biotech)and immediately exposing it to film. PARP in its intact formwill appear at 115 kD; once cleaved, PARP will appear as a slightlysmaller 85- to 90-kD fragment.
Pax21Neu Mutant Kidneys Compared with Wild-Type Kidneys Cross-Sectional Surface Area.
Kidneys were microdissected from E17.5 fetal mice, fixed in4% formaldehyde, and embedded in paraffin. Serial sagittal sectionswere stained with hematoxylin and eosin. The largest cross-sectionwas identified, and kidney surface area was quantified by SpotAdvanced imaging software. The maximal cross-sectional areaof Pax21Neu mutant kidneys (0.06 ± 0.003 mm2) was 25%smaller than wild-type kidneys (0.08 ± 0.003 mm2), P= 0.003 (Figure 2C).
Figure 2. Maximal cross-sectional area of heterozygous Pax21Neu mutant kidneys compared with that of wild-type littermates. Serial sagittal sections of E17.5 Pax21Neu mutant (A) and wild-type (B) fetal mouse kidneys were stained with hematoxylin and eosin. Mean maximal cross-sectional area of Pax21Neu mutant fetal mouse kidneys was 20% smaller than wild-type littermates, P = 0.003 (C). Kidney surface area was calculated by Spot Image Analysis software in the maximal cross-section at x100 magnification.
Branching Morphogenesis.
Kidneys were microdissected from E13.5 fetal mice, culturedfor 50 h, immunostained with Dolichos biflorus agglutinin, andimaged by fluorescence microscopy. The number of terminal UBbranch tips was quantified in each explant. Pax21Neu mutantexplants (53 ± 5.5 branch tips/kidney) had 18% fewerbranches than their wild-type counterparts (64 ± 4.7branch tips/kidney), P = 0.04 (Figure 3C).
Figure 3. Complexity of branching morphogenesis in heterozygous Pax21Neu mutant kidneys compared with that of wild-type littermates. Branching of the ureteric bud (UB) was quantified in Pax21Neu mutant (A) and wild-type (B) E13.5 fetal mouse kidneys stained with fluorescein-labeled Dolichos biflorus agglutinin after 50 h in culture and visualized under ultraviolet light. Pax21Neu mutant kidneys had 18% fewer terminal branches than wild-type kidneys, P = 0.04 (C).
UB Apoptosis.
Peroxidase TUNEL immunohistochemistry was used to identify apoptoticcells in E17.5 fetal mouse kidneys (Figure 4, A and B). Thenumber of TUNEL-positive cells in the heterozygous mutant fetalkidneys (741 ± 104 apoptotic cells/mm2) was significantlygreater than in wild-type littermates (290 ± 56 apoptoticcells/mm2), P = 0.001 (Figure 4C). However, apoptosis in metanephricblastema and mesenchymal derivatives of the nephron (comma-shapedand S-shaped bodies) was similar in heterozygous mutants andwild-types; increased apoptosis was restricted primarily tothe UB. The percent of TUNEL-positive UB cells in mutant kidneys(7 ± 0.02%) was 3.5-fold increased above the apoptoticfrequency in UB of E17.5 wild-type littermates (2 ± 0.003%),P = 0.008 (Figure 4D).
Figure 4. Collecting duct apoptosis in heterozygous Pax21Neu mutant mice. Apoptotic cells in the collecting duct were identified in maximal cross-sections from Pax21Neu (+/-) mutant (A) and wild-type (B) E17.5 fetal mouse kidneys by TUNEL staining. Mutant kidneys had 53% more apoptosis than wild-type counterparts, P = 0.007 (C).
Increased Apoptosis Due to In Vitro Culture Conditions
To examine the effect of the Pax21Neu mutation on the rate ofUB branching ex vivo, we excised E13.5 mutant and wild-typekidneys and cultured them for 50 h (Figure 5, A and B). To assessbasal apoptosis induced by ex vivo culture conditions, we assessedtime-dependent appearance of PARP cleavage by Western immunoblotting(Figure 5C). In freshly microdissected E13.5 fetal kidneys (T= 0), 93% of PARP protein appears in the uncleaved form at 115kD; only 7% appears as cleaved PARP at 85 to 90 kD. In E13.5kidneys cultured for 50 h, 29% of PARP protein appeared in thecleaved form, indicating a modest basal level of apoptosis exvivo.
Figure 5. Branching morphogenesis of wild-type fetal mouse kidneys ex vivo. E13.5 kidneys (A) were cultured on floating filters for 50 h (B). To examine basal apoptosis under ex vivo culture conditions, protein of interest (PARP) cleavage was assessed at 0 and 50 h by Western immunoblotting (C). At T = 0, only 7% of PARP appeared in its cleaved form (85 to 90 kD). At T = 50 h, 29% of PARP protein was cleaved, indicating increased apoptosis. Uncleaved PARP at T = 0 (B1); cleaved PARP at T = 0 (B2); uncleaved PARP at T = 50 h (B3); cleaved PARP at T = 50 h (B4).
Rescue of Renal Hypoplasia in Pax21Neu Mutant and Wild-Type Fetal Kidneys Ex Vivo
To assess the effect of caspase inhibition on UB branching exvivo, Pax21Neu mutant (Figure 6A) and wild-type (Figure 6B)kidneys were cultured for 50 h in the presence or absence of25 µM Z-VAD-fmk. The explants were then fixed and stainedwith fluorescence-tagged Dolichos biflorus agglutinin to visualizethe branching UB. In Pax21Neu mutant explants, Z-VAD-fmk treatmentresulted in a significant increase (23%) in UB branching (65± 6.8 terminal branches/kidney) versus untreated mutantexplants (53 ± 5.5 terminal branches), P = 0.0003). Asignificant but lesser effect was observed in treated versusuntreated wild-type explants (71 ± 5 versus 64 ±4.7), P = 0.003 (Figure 6C).
Figure 6. Rescue of branching morphogenesis in Pax21Neu mutant explants ex vivo. Pax21Neu mutant (A) and wild-type (B) fetal kidney explants were cultured in the presence and absence of Z-VAD-fmk for 50 h, stained with fluorescein-labeled Dolichos biflorus agglutinin, and visualized under ultraviolet light. Treated Pax21Neu mutant kidneys showed an increase in terminal branch number of 25% (P = 0.001). A lesser, but significant increase in terminal branch number (10%) was seen in wild-type kidneys treated with Z-VAD-fmk (P = 0.003) (C).
Caspase Inhibition of Pax21Neu Mutant and Wild-Type Mice In Vivo
In view of the results above, we reasoned that it might be possibleto reverse the deleterious effect of PAX2 mutations on UB branchingin vivo. Pregnant C3H females mated to Pax21Neu mutant malesreceived daily intraperitoneal injections of Z-VAD-fmk (10 µg/gbody weight) from day 10.5 of pregnancy through day 17.5. Apoptosis(TUNEL) in maximal cross-sections (Figure 7, A through D) ofE17.5 Pax21Neu mutant kidneys (741 ± 104 apoptotic cells/mm2)was significantly reduced (40% of control, P = 0.0004) by Z-VAD-fmktreatment (290 ± 56 apoptotic cells/mm2) (Figure 7E).Again, this effect was largely due to a decrease in TUNEL-positivecells in UB structures: treated (2.0 ± 0.001% of UB cells)versus untreated (7.0 ± 0.02 % of UB cells), P = 0.005(Figure 7F). Z-VAD-fmk also reduced basal apoptosis in wild-typekidneys (145 ± 24 versus 290 ± 56 apoptotic cells/mm2,P = 0.013 (Figure 7E). No obvious malformations of kidneys orother organs were observed in Z-VAD-fmk-treated pregnancies.
Figure 7. Inhibition of Pax21Neu mutant collecting duct apoptosis in vivo. Apoptotic cells in the collecting duct of 1Neu (+/-) mutant (A) and wild-type (C) E17.5 fetal mouse kidneys were identified by TUNEL staining. Heterozygous pregnant Pax21Neu mice were injected intraperitoneally daily from E11-E17 with 10 µg/g of Z-VAD-fmk. Pax21Neu (+/-) fetuses had 60% reduction in collecting duct cell apoptosis (P = 0.002) (B). There was a lesser (45% decrease) but significant effect on wild-type E17.5 kidneys as well (P = 0.01) (D and E).
Rescue of UB Branching Morphogenesis In Vivo
To determine whether the anti-apoptotic effects of Z-VAD-fmkcould rescue the renal branching defect in vivo as it did invitro, fetal kidneys were excised and stained with tagged Dolichosbiflorus agglutinin after treatment from E10 through E14 asabove. Following treatment, heterozygous Pax21Neu fetal mousekidneys exhibited increased (152%) arborization of the UB (79± 10 terminal branches/kidney) versus mutants from untreatedpregnancies (52 ± 4 terminal branches/kidney), P = 0.014(Figure 8).
Figure 8. Rescue of Pax21Neu fetal kidney collecting duct branching in vivo. UB branching morphogenesis was quantified in Pax21Neu (+/-) mutant E14.5 fetal mouse kidneys stained with fluorescein-labeled Dolichos biflorus agglutinin and visualized under ultraviolet light. Kidneys of fetuses from mothers treated with Z-VAD-fmk (10 µg/g body weight) showed a 34% increase in branching morphogenesis (P = 0.01).
In previous studies, we have shown that PAX2 haploinsufficiencycauses renal hypoplasia associated with reduced nephron number(oligonephronia), detectable in the early stages (E15) of kidneydevelopment in the mouse (9). Here, we confirm that heterozygousPax21Neu fetal (E17.5) mice have a selective increase in apoptosisof UB cells; we also directly demonstrate a significant deficitin arborization of the PAX2 mutant UB. Although the 18% reductionin terminal branches seen in E13.5 kidneys cultured for 50 his, at first glance, a modest reduction in nephron number unlikelyto have clinical consequences, it should be remembered thatnephrogenesis appears to proceed in logarithmic (versus linear)fashion during fetal kidney development. A modest decrease inthe rate of UB branching from an early stage will be amplifiedmany times over in subsequent generations of nephrons and shouldsubstantially reduce final nephron endowment.
Although PAX2 may regulate a variety of developmental genes,we have shown elsewhere that the identical phenotype (pure nephrondeficit) can be mimicked by targeting pro-apoptotic genes tothe fetal UB and have proposed a model in which stochastic UBapoptosis might account for slowed UB arborization and fewerfinal nephrons in PAX2 mutant kidneys (10). If this hypothesisis correct, we reasoned that anti-apoptotic agents, such asthe caspase inhibitor Z-VAD-fmk, should be able to rescue theUB branching defect in Pax21Neu mice. Indeed, we found in mutantE15 kidney explants allowed to continue branching morphogenesisex vivo that the caspase inhibitor, Z-VAD-fmk, suppressed apoptosisand produced a 23% increase in terminal branch number within50 h. Interestingly a significant but smaller effect of Z-VAD-fmkwas also seen in wild-type kidneys under the same conditions.Although the frequency of UB cell apoptosis is very low in normalfetal kidney, it was clear from the progressive increase ofPARP cleavage that ex vivo culture conditions exert a considerablepro-apoptotic stimulus on the explant. Presumably, this reflectsincreasingly suboptimal diffusion of oxygen and nutrients tothe center of the expanding kidney.
Z-VAD-fmk has been used by others to inhibit caspases in vivo,but no formal studies have been done to demonstrate that thedrug can cross the placenta and exert its anti-apoptotic effectson fetal tissue. In preliminary experiments, we injected normalpregnant mice with Z-VAD-fmk, but we were unable to detect thedrug by HPLC/mass spectrophotometry in either maternal or fetaltissues. Nevertheless, daily intraperitoneal injections of Z-VAD-fmk(10 µg/g body weight) to pregnant mice during the periodof early nephrogenesis (E10.5-E14) were effective in suppressingUB apoptosis and increasing terminal branch number in mutantfetal kidneys. This suggests that the drug can cross the placentalbarrier and exerts its anti-apoptotic effect on fetal tissue.
Programmed cell death is now thought to be an important normalevent during development, necessary for producing luminal cavities,selection of neurons, and sculpting of organs. Nevertheless,we found no obvious teratogenic effects of maternal Z-VAD-fmkin our studies. Other investigators have noted that normal regressionof interdigital skin webs can proceed in the presence of Z-VAD-fmk(11). These authors argue that certain apoptotic events duringdevelopment do not seem to require the Z-VAD-fmk-sensitive caspases(11).
In conclusion, we report that in heterozygous Pax21Neu mutantmouse kidneys with increased UB apoptosis and decreased terminalUB branch number, that the genetically determined defect inbranching morphogenesis can be rescued in vitro and in vivoby drugs that restore UB resistance to caspase-mediated programmedcell death. These observations strongly support the hypothesisthat loss of the normal anti-apoptotic function of PAX2 duringdevelopment is the primary cause of nephron deficit in RCS.They also support our proposed model of branching morphogenesisin which optimal rates of arborization require maximal survivalof UB cells (10). Conceivably, caspase-inhibitory drugs maybe useful for the in utero rescue of congenital abnormalitiescaused by mutation of other anti-apoptotic genes.
Acknowledgments
This work was supported by an operating grant from the CanadianInstitutes of Health Research. Dr. Goodyer was the recipientof a Sessenwein Pediatric Research Award, and Dr. Eccles wasa James Cook Fellow of the Royal Society of New Zealand.
Gundersen HJ, Bagger P, Bendtsen TF, Evans SM, Korbo L, Marcussen N, Moller A, Nielsen K, Nyengaard JR, Pakkenberg B, et al: The new stereological tools: Dissector, fractionator, nucleator and point sampled intercepts and their use in pathological research and diagnosis. APMIS 96: 857–881, 1988[Medline]
Nyengaard JR, Bendtsen TF: Glomerular number and size in relation to age, kidney weight, and body surface in nirmal man. Anat Record 232: 194–201, 1992[CrossRef][Medline]
Keller G, Zimmer G, Mall G, Ritz E, Amann K: Nephron number in patients with hypertension. N Engl J Med 348: 102–108, 2003
Eccles MR, Schimmenti LA: Renal-coloboma syndrome: A multi-system developmental disorder caused by PAX2 mutations. Clin Genet 56: 1–9, 1999[CrossRef][Medline]
Salomon R, Tellier AL, Attie-Bitach T, Amiel J, Vekemans M, Lyonnet S, Dureau P, Niaudet P, Gubler MC, Broyer M: PAX2 mutations in oligomeganephronia. Kidney Int 59: 457–62, 2001[CrossRef][Medline]
Bouchard M, Souabni A, Mandler M, Neubuser A, Busslinger M: Nephric lineage specification by PAX2 and Pax8. Genes Dev 16: 2958–2970, 2002[Abstract/Free Full Text]
Brophy PD, Ostrom L, Lang KM, Dressler GR: Regulation of ureteric bud outgrowth by PAX2-dependent activation of the glial derived neurotrophic factor gene. Development 128: 4747–56, 2001[Abstract/Free Full Text]
Torban E, Eccles MR, Favor J, Goodyer P: PAX2 suppresses apoptosis in renal collecting duct cells. Am J Path 157: 833–842, 2000[Abstract/Free Full Text]
Porteous S, Torban E, Cho NP, Cunliffe H, Chua L, McNoe L, Ward T, Souza C, Gus P, Giugliani R, Sato T, Yun K, Favor J, Sicotte M, Goodyer P, Eccles M: Primary renal hypoplasia in humans and mice with PAX2 mutations: Evidence of increased apoptosis in fetal kidneys of PAX21Neu +/- mutant mice. Hum Mol Gen 9: 1–11, 2000[Abstract/Free Full Text]
Dziarmaga A, Clark P, Stayner C, Julien JP, Torban E, Goodyer P, Eccles M: Ureteric bud apoptosis and renal hypoplasia in transgenic PAX2-Bax fetal mice mimics the renal-coloboma syndrome. J Am Soc Nephrol 14: 2767–2774, 2003[Abstract/Free Full Text]
Jacobsen MD, Weil M, Raff MC: Role of Ced-3/ICE-family proteases in staurosporine-induced programmed cell death. J Cell Biol 133: 1041–1051, 1996[Abstract]
Received for publication May 11, 2003.
Accepted for publication October 28, 2003.
This article has been cited by other articles:
M. Moosajee, K. Gregory-Evans, C. D. Ellis, M. C. Seabra, and C. Y. Gregory-Evans Translational bypass of nonsense mutations in zebrafish rep1, pax2.1 and lamb1 highlights a viable therapeutic option for untreatable genetic eye disease
Hum. Mol. Genet.,
December 15, 2008;
17(24):
3987 - 4000.
[Abstract][Full Text][PDF]
I. J. Murawski, D. B. Myburgh, J. Favor, and I. R. Gupta Vesico-ureteric reflux and urinary tract development in the Pax21Neu+/ mouse
Am J Physiol Renal Physiol,
November 1, 2007;
293(5):
F1736 - F1745.
[Abstract][Full Text][PDF]
J. Quinlan, M. Lemire, T. Hudson, H. Qu, A. Benjamin, A. Roy, E. Pascuet, M. Goodyer, C. Raju, Z. Zhang, et al. A Common Variant of the PAX2 Gene Is Associated with Reduced Newborn Kidney Size
J. Am. Soc. Nephrol.,
June 1, 2007;
18(6):
1915 - 1921.
[Abstract][Full Text][PDF]
T. Cohen, O. Loutochin, M. Amin, J.-P. Capolicchio, P. Goodyer, and R. Jednak PAX2 is reactivated in urinary tract obstruction and partially protects collecting duct cells from programmed cell death
Am J Physiol Renal Physiol,
April 1, 2007;
292(4):
F1267 - F1273.
[Abstract][Full Text][PDF]
C. Stayner, D. M. Iglesias, P. R. Goodyer, L. Ellis, G. Germino, J. Zhou, and M. R. Eccles Pax2 gene dosage influences cystogenesis in autosomal dominant polycystic kidney disease
Hum. Mol. Genet.,
December 15, 2006;
15(24):
3520 - 3528.
[Abstract][Full Text][PDF]
D. Park, H. Jia, V. Rajakumar, and H. M. Chamberlin Pax2/5/8 proteins promote cell survival in C. elegans
Development,
November 1, 2006;
133(21):
4193 - 4202.
[Abstract][Full Text][PDF]
A. Dziarmaga, P.-A. Hueber, D. Iglesias, N. Hache, A. Jeffs, N. Gendron, A. MacKenzie, M. Eccles, and P. Goodyer Neuronal apoptosis inhibitory protein is expressed in developing kidney and is regulated by PAX2
Am J Physiol Renal Physiol,
October 1, 2006;
291(4):
F913 - F920.
[Abstract][Full Text][PDF]
E. Torban, A. Dziarmaga, D. Iglesias, L. L. Chu, T. Vassilieva, M. Little, M. Eccles, M. Discenza, J. Pelletier, and P. Goodyer PAX2 Activates WNT4 Expression during Mammalian Kidney Development
J. Biol. Chem.,
May 5, 2006;
281(18):
12705 - 12712.
[Abstract][Full Text][PDF]
J. Fletcher, M. Hu, Y. Berman, F. Collins, J. Grigg, M. McIver, H. Juppner, and S. I. Alexander Multicystic Dysplastic Kidney and Variable Phenotype in a Family with a Novel Deletion Mutation of PAX2
J. Am. Soc. Nephrol.,
September 1, 2005;
16(9):
2754 - 2761.
[Abstract][Full Text][PDF]
X. Shi, P. G. Gillespie, and A. L. Nuttall Na+ influx triggers bleb formation on inner hair cells
Am J Physiol Cell Physiol,
June 1, 2005;
288(6):
C1332 - C1341.
[Abstract][Full Text][PDF]
Q. Cai, N. I. Dmitrieva, J. D. Ferraris, H. L. Brooks, B. W. M. van Balkom, and M. Burg Pax2 expression occurs in renal medullary epithelial cells in vivo and in cell culture, is osmoregulated, and promotes osmotic tolerance
PNAS,
January 11, 2005;
102(2):
503 - 508.
[Abstract][Full Text][PDF]
,
Top
Abstract
Introduction
-mercaptoethanol; samples were also sonicated for about 10 s (frequency: 25 W; amplitude: 80). The samples were then heated to 65°C for 15 min and the loading dye (to 1x) added. Once the loading dye had been added, the samples were boiled at 100°C for 5 min, spun down briefly in a microcentrifuge, and loaded on a polyacrylamide gel consisting of two layers; a top (stacking) layer (4%) and a lower (separating) layer (10%). The gel was run at 100 V for approximately 2 h followed by an overnight transfer at 30 V. Once the transfer of protein from gel to membrane was complete, the membrane or "blot" went through a series of steps to tag the protein of interest (PARP). The first step was to block any nonspecific protein by incubating the blot in PBS-T (0.1%) + 5% milk at room temperature for 2 h. The blot was then probed with a primary antibody (1/100 PARP antibody; Oncogene, Hornby, ON) for an additional 2 h at room temperature, followed by 2 washes of 10 min each with PBS-T (0.1%). The blot was then probed with a secondary antibody (1/1000 Anti-Mouse; Amersham Pharmacia Biotech, England) and washed three times for 5 min with PBS-T (0.1%). The final step was to develop the blot by immersing it in a developing solution (ECL; Amersham Pharmacia Biotech) and immediately exposing it to film. PARP in its intact form will appear at 115 kD; once cleaved, PARP will appear as a slightly smaller 85- to 90-kD fragment. 
