Characterization of an Aquaporin-2 Water Channel Gene Mutation Causing Partial Nephrogenic Diabetes Insipidus in a Mexican Family: Evidence of Increased Frequency of the Mutation in the Town of Origin
Cristina Boccalandro*,
Fabrizio de Mattia,
Dong-Chuan Guo,
Li Xue,
Philip Orlander*,
Terri M. King,
Prateek Gupta,
Peter M.T. Deen,
Victor R Lavis* and
Dianna M. Milewicz
*Division of Endocrinology and Division of Medical Genetics, University of Texas Houston Medical School, Houston; and Department of Cell Physiology, University of Nijmegen, Nijmegen, The Netherlands.
Correspondence to Dr. Dianna M. Milewicz, University of Texas Medical School at Houston, 6431 Fannin, MSB 1.614, Houston, TX 77030. Phone: 713-500-6727; Fax: 713-500-0693; E-mail: Dianna.M.Milewicz{at}uth.tmc.edu
ABSTRACT. A Mexican family with partial congenital nephrogenicdiabetes insipidus (NDI) that resulted from a mutation in theaquaporin-2 water channel (AQP2) was characterized, and thesource of this rare mutation was traced to the family’stown of origin in Mexico. Affected individuals with profoundpolyuria and polydipsia were homozygous for an autosomal recessivemissense V168M mutation in the AQP2 gene. Expression in oocytesrevealed that, although retained in the endoplasmic reticulum(ER) to a great extent, a considerable amount of the partiallyfunctional AQP2-V168M was expressed at the plasma membrane,and that its ER retention was less than AQP2-T126M, a functionalmutant in severe recessive NDI. None of the affected AQP2-V168Mindividuals had neurologic deficits, which also suggested amilder form of the disease. The homozygous individuals reportedsubjective improvement in polyuria and polydipsia with the useof dDAVP (1-desamino-8-D-arginine-vasopressin). When clinicallytested, infusion of dDAVP at variable doses produced a partialincrease in the urinary osmolality in homozygous individualsand decreased their water intake. Heterozygotes were unaffectedwhen compared with controls. Samples were obtained from thepopulation of the Mexican town of origin of the family; 30%of the population was heterozygous for the V168M AQP2 mutationand 1% was homozygous for the mutation. The high frequency ofthis rare mutation in the town provides evidence for an importanthealth care problem in the village with consequences for futuregenerations.
Diabetes insipidus is defined by a 24-h urine volume greaterthan 3 L and urinary osmolality less than 300 mOsm/kg (1). Diabetesinsipidus can be of central or nephrogenic origin, and it canbe acquired or hereditary. Individuals affected with nephrogenicdiabetes insipidus (NDI) are prone to severe dehydration ifunable to access liquids and can experience failure to thrive,mental retardation, and death early in life (2–5). Adequateintake of water allows a normal lifespan and good physical andmental development (6).
Inherited NDI results from mutations in two different genes;90% occur in the gene that codes for the vasopressin 2 receptor(AVPR2) found on the X chromosome (7) and 10% in the gene foraquaporin-2 (AQP2) (8). The aquaporin membrane pore is locatedin the collecting duct cells and is the primary target by whichvasopressin regulates permeability of water. AQP2 (xm_006751)is located on chromosome 12q13, consists of four exons and encodesa 271–amino acid protein with six transmembrane domains.Thirty mutations in AQP2 have been reported, most commonly recessivemissense mutations that cause misfolding of the protein andretention in the endoplasmic reticulum (ER) (3,4,9–16).Dominant mutations are less common and are characterized byretention of AQP2 in the Golgi complex region, late endosomes/lysosomes,or basolateral membrane due to the formation of heterotetramersof normal and abnormal AQP2 (17–21).
We have identified a family from Mexico with familial NDI causedby a recessive mutation in the AQP2 gene. The mutant aquaporin-2is partially functional in Xenopus oocytes. Affected familymembers reported improvement in thirst and urination with theuse of nasal and oral dDAVP (1-desamino-8-D-arginine-vasopressin),prompting the study of the clinical differences between homozygous,heterozygous and controls. Finally, a genetic epidemiologicstudy was performed in the town of origin of the family in Mexico.
Water Deprivation Tests
The study was approved by the Institutional Review Board ofthe University of Texas Health Science Center at Houston. Writteninformed consent was obtained from the family members that participatedin the genetic and clinical studies, and verbal informed consentwas obtained from the townspeople in the genetic epidemiologicstudy done in Mexico. Clinical studies were done at the ClinicalResearch Center of The University of Texas Health Science Centerat Houston.
dDAVP was stopped 24 h before any testing. Baseline 24-h urinecollections were performed to measure volume and urine osmolality.The technique used for the water deprivation test has been previouslydescribed (22,23). Baseline samples for urine osmolality (Uosm),serum osmolality (Sosm), serum electrolytes, and plasma argininevasopressin (AVP) were taken. AVP samples were collected inheparinized plasma and immediately frozen for future processing.Hypertonicity was initiated with a continuous 3% saline infusionat a rate of 0.06 ml/kg/min. Sosm was checked hourly until alevel of 300 mOsm/kg was reached. Then, a second plasma samplefor AVP was obtained before 1 µg of dDAVP was providedintravenously to each subject. Urine volume, Uosm, and Sosmwere monitored hourly for the next 2 h.
dDAVP Challenge Test
Controls and homozygous and heterozygous family members underwenta dDAVP challenge test with water restriction as a surrogatefor a full water deprivation test (24–27). Fluid intakewas limited to 250 ml/h. Baseline samples for Uosm, Sosm, serumelectrolytes, blood urea nitrogen, glucose, creatinine, andcalcium were obtained. Urinary volume and fluid intake weremonitored hourly. Uosm was checked 3 h after each dose of dDAVPto ascertain maximal effect of the drug (24–28). No furtherdoses of dDAVP were provided when Uosm was above 800 mOsm/kg(22,24,29). All of the dDAVP doses were provided intravenously.The first dose of dDAVP consisted in 1 µg for controlsand heterozygotes and 5 µg for homozygotes. Three hourslater, those with Uosm below 800 mOsm/kg received a second doseof dDAVP, 4 µg for the heterozygotes and controls and0.4 µg/kg for the homozygotes. Uosm was checked 3 h later.
Mutational Analysis
Genomic DNA from the family members was isolated from peripheralblood samples in adults and from buccal samples in children.The DNA was extracted with the Pure Gene genomic DNA isolationkit (Gentra Systems). Intron-based primers were used to PCR-amplifythe four exons of AQP2 (10). PCR amplifications were carriedout with HotstarTaq DNA polymerase (Qiagen, Valencia, CA) ina two-cycle amplification program to amplify the genomic DNA.The DNA fragments were sequenced with ABI Big Dye terminatorkit on an ABI Prism 310 DNA Analyzer (Applied Biosystems, FosterCity, CA).
Generation of the Mutant AQP2 cDNA Construct
PCR techniques were used to introduce a G502A transversion inhuman AQP2 cDNA, which was cloned into the plasmid pT7Ts-AQP2.The forward primer, TGCCATGGCGTTTGGCTTGG, has a NcoI restrictionsite at the 5' end. The reverse primer, 5'-ATGGATCCCAAGGAGGTGGCCCAGGGCCATAGAGAAGCC-3'has a BamHI site at the 5' end. A G502A transition was introducedinto the middle of the reverse primer. PCR was performed byusing the plasmid pT7Ts-AQP2 as the template. The PCR productwas digested by NcoI and BamHI and inserted into the correspondingsites of pT7Ts-AQP2. The G502A mutation of AQP2 was confirmedby sequencing.
Oocyte Experiments
Linearization of the pT7Ts-AQP2 and pT7Ts-AQP2-V168M constructs,cRNA synthesis, preparation and injection of oocytes, cell swellingassays, immunoblotting, and immunocytochemistry were performedas described (30). The obtained water permeabilities were expressedas means ± SEM. Differences between groups were testedby t test corrected by the Bonferroni multiple-comparisons procedure.Differences were considered statistically significant for P< 0.05. To determine the functionality of AQP2 mutants inrelation to wt-AQP2, all immunoblot signals of AQP2 proteinsin the plasma membrane of oocytes were semiquantified by densitometricscanning and compared with the signals of a twofold dilutionseries of wt-AQP2, which was blotted in parallel.
Because the quality of cRNA preparations and injected amountsshow variation for different cRNAs, the expressed amounts ofthe AQP2 proteins from determined cRNA amounts is not reliable.Therefore, our analyses with AQP2-V168M focused on whether AQP2-V168Mis a functional water channel and if so, to what extent comparedwith wt-AQP2. Also, we wanted to determine whether it is retainedthe ER, and if so, whether its retention is different from wt-AQP2and from AQP2-T126M, another AQP2 mutant that confers severeinstead of partial NDI in patients. For these analyses, similarprotein expression levels are needed, which is much better controlledin oocytes than in mammalian cells. For determination whethera mutant is retained in the cell, the plasma membrane expressionlevels have to be compared for those oocytes that show similartotal membrane expression levels because the level of plasmamembrane expression goes up with increased expression levels.
In a second analysis, by comparing the water permeabilitiesconferred by similar plasma membrane expression levels of differentaquaporins, one can estimate the single channel permeability.For this, the different amounts of wt-AQP2 expressed in theplasma membrane fraction of oocytes and the corresponding waterpermeability (Pf) values were fitted to the exponential functiony = a[1 – exp(–bx)] + c, where y is Pf and x isthe amount of protein in arbitrary units. The amount of wt-AQP2that would be necessary to obtain the Pf value observed forthe mutants was calculated from the equation. The ratio of theamount of wt-AQP2 and mutant AQP2 for the Pf that had been obtainedfor the mutant indicates the single channel water permeabilityof the mutant in relation to wt-AQP2 in percentage.
Genetic Epidemiologic Data
Samples were collected from individuals in a town in Mexico.Subjects were asked for voluntary participation at their homesor in public areas with the aid of the local physician and nurse.Participants were over 18 yr old, born in the town, and hadat least one parent native to the town. Only one sibling ofeach family was sampled. Buccal cell samples were collectedwith the Scope mouthwash technique (31,32). The samples hadno personal identifiers and were stored at 4°C until processed.DNA was extracted and AQP2 mutation in exon 2 was analyzed bydirect sequencing. The genotype frequencies observed were comparedwith those expected under the assumption of random mating; a2 test was used for deviation from Hardy-Weinberg equilibrium.
Statistical Analyses
Comparison between water deprivation and dDAVP tests, age groupsin the population samples, and the percentage of permeabilityof the mutant relative to wt-AQP2 was determined by t test (33).Deviation from the Hardy-Weinberg equilibrium was evaluatedwith the bootstrapping and permutation techniques availablein the genetics library as programmed in R (34).
Clinical Description of the Mexican Family
The family studied was originally from a small town northeastof Monterrey, Mexico (Figure 1). Both parents were born in thesame town but denied consanguinity. The town started as a ranchfounded in 1600s and consists of a larger central area and sixsatellite communities that share the same ancestry. The totalpopulation of the town was 2078, according to the Mexican censusfrom the year 2000 (35). Both parents of the studied familyhad normal thirst and urination and were healthy except formoderate hypertension in the father. The mother had experiencedno miscarriages, and none of her children had died. The firstfour of their five children had polydipsia and polyuria soonafter birth, and all had normal physical and mental developmentwithout other medical problems. At the age of 20 yr, an affectedsibling (III-5) had a severe hypernatremic episode during acesarean section. After recovering from the episode, she wastreated with dDAVP and reported a 50% decrease in nocturnalthirst and urination. The index patient, the fourth child ofthe family, approached the endocrinology clinic at the Universityof Texas Houston and was the first one to be studied by ourgroup. He worked as a construction worker in the Houston areaand was able to work in hot climates without experiencing dehydrationby drinking large amounts of water. He also reported a decreasein nocturnal polydipsia and polyuria by 50% when treated withdDAVP.
Figure 1. Pedigree of the Mexican family. Darkened symbols indicate individuals with nephrogenic diabetes insipidus (NDI) and the proband is indicated with an arrow. The amino acid alteration in the aquaporin-2 (AQP2) protein is indicated below the symbol. V, valine (wild-type sequence); M, methionine (mutant sequence). Individuals marked M/M were affected, and individuals marked V/V or V/M (heterzygotes) were unaffected.
Mutational Analysis
DNA from the proband was used to sequence the exons and flankingintronic sequences of AQP2. A homozygous G to A nucleotide alterationwas found at the position 502 in exon 2, leading to a valineto methionine alteration at amino acid 168 in the fifth transmembranedomain of the aquaporin-2 water channel. Exon 2 was sequencedusing DNA from all family members. All of the affected familymembers were homozygous for the mutation, and all other sequencedfamily members were heterozygous, except the maternal grandmotherwho did not carry the mutation (Figure 1). Analysis of DNA from31 white and 29 Hispanic individuals obtained from the Houstonarea failed to reveal the mutation. A C/T polymorphism immediatelyadjacent to the mutation (position 501 in exon 2) was identifiedin the Hispanic controls. The polymorphism did not alter anamino acid, and the frequency of the polymorphism was 14%.
Functional Analysis of AQP2-V168M
To determine the biologic basis for NDI in this family, theV168M encoding mutation was introduced in the human AQP2 cDNAcontained in an oocyte expression vector, the cRNA was transcribedand then injected into oocytes. cRNA coding for AQP2-T126M,a functional mutant in recessive NDI (14), was taken along.Determination of the water permeability (Pf) of noninjectedcontrol and cRNA-injected oocytes revealed that oocytes expressingAQP2-V168M had a significantly higher Pf than control oocytes,indicating that AQP2-V168M is a functional water channel (Figure 2).At the dosages used here, AQP2-T126M did not confer anywater permeability, but at high expression levels, AQP2-T126Mhas shown to be a functional water channel (14,36,37).
Figure 2. Osmotic water permeability of oocytes expressing aquaporin-2 (AQP2)–V168M. Oocytes were not injected (c) or were injected with the indicated amounts (ng) of cRNAs encoding wild-type AQP2 (WT-AQP2), AQP2-V168M, or AQP2-T126M. Two days after injection, the mean water permeabilities (Pf ± SEM in µm/s; n = 12) were determined in a standard swelling assay. Significant differences between samples (P < 0.05) are indicated by asterisks.
Because the quality of produced cRNA and the injected amountscan vary, total membranes of these oocytes were immunoblottedfor AQP2 to reveal their expression levels (Figure 3). At moderateexpression levels, AQP2-V168M and AQP2-T126M were expressedas 29 kD nonglycosylated and 32 kD high-mannose glycosylatedproteins (Figure 3, upper panel), which is characteristic forER-retained AQP2 proteins (30), whereas wt-AQP2 was only detectedas a 29-kD band. At higher expression levels (10 ng cRNA), however,complex-glycosylated (40 to 45 kD; wt-AQP2 and AQP2-V168M) anda 27-kD degradation product (AQP2-V168M, AQP2-T126M) were detectedas well.
Figure 3. Immunoblot analysis of aquaporin-2 (AQP2)-V168M expressed in oocytes. From 12 oocytes, injected as described in Figure 2, total membranes (top) or plasma membranes (middle) were isolated and immunoblotted for AQP2. Total membrane samples were also immunoblotted for AQP2 after removal of all sugar moieties with endoglycosidase F (bottom). The masses of unglycosylated (29 kD), high-mannose glycosylated (32 kD), complex-glycosylated (40 to 45 kD), and a degradation product (27 kD) are indicated.
Immunoblotting of plasma membranes of these oocytes revealeda clear plasma membrane expression for wt-AQP2 and AQP2-V168Mat every injected amount, whereas AQP2-T126M was not detectedin the plasma membranes (Figure 3, middle panel). To relatethe plasma membrane and total membrane expression levels, totalmembranes equivalents of 1-, 3-, and 10-ng injections were treatedwith endoglycosidase F, which removes all sugar moieties, andimmunoblotted for AQP2 (Figure 3, lower panel). The immunoblotsignals were densitometrically scanned and semiquantified bycomparison with the immunoblot signals obtained from a twofolddilution series of wt-AQP2 (data not shown). As reported, adecreased ratio of plasma membrane versus total membrane expressionfor an AQP2 mutant compared with that of wt-AQP2 indicates thatthe mutant protein is retained within the cell (38).
As can be seen in Figure 3, AQP2-V168M showed a reduced plasmamembrane versus total membrane ratio than wt-AQP2 (e.g., comparesignals of 3 ng AQP2-V168M to 10 ng wt-AQP2). Densitometricanalysis revealed a fourfold reduced plasma membrane expressionof AQP2-V168M compared with wt-AQP2. Compared with AQP2-T126M,however, the trafficking of AQP2-V168M to the plasma membranewas much better because the total membrane expression levelfrom 3 ng AQP2-T126M cRNA was in between those of 1 and 3 ngAQP2-V168M (Figure 3, bottom), whereas no plasma membrane expressionwas detected for AQP2-T126M, in contrast to that of oocytesinjected with 1 ng AQP2-V168M cRNA. This indicated that AQP2-V168Mis impaired in its transport to the membrane compared with wt-AQP2,but that its trafficking to the plasma membrane is significantlybetter than of AQP2-T126M. Determining the conferred water permeabilities(Figure 2) for similar plasma membrane expression levels ofwt-AQP2 and AQP2-V168M revealed that the ability of AQP2-V168Mto confer water permeation is about 58% of that of wt-AQP2.
Immunocytochemical analysis of these oocytes showed a dispersedintracellular expression for AQP2-V168M and AQP2-T126M, althoughAQP2-V168M also revealed a weak plasma membrane expression (Figure 4, A and B),which is consistent with ER retention for bothmutants and a partial plasma membrane expression of AQP2-V168M.As anticipated, wt-AQP2 was only detected in the plasma membrane(Figure 4C). Uninjected oocytes, which were taken as controls,did not show any staining (Figure 4D), confirming the specificityof the AQP2 antibodies.
Figure 4. Localization of aquaporin-2 (AQP2)-V168M in oocytes. Two days after injection, uninjected oocytes (D) and oocytes injected with 1 ng cRNA encoding AQP2-V168M (A), wt-AQP2 (C), or 3 ng for AQP2-T126M (B) were fixed in paraformaldehyde and embedded in paraffin; 5-µm sections were cut and incubated with rabbit -AQP2 antibodies, followed by Alexa-594.
Effect of the Mutation on Aquaporin-2 Function on Water Excretion and dDAVP Response
Family members who were homozygous for the mutation (III-3,III-5, and III-7) had a mean 24-h urinary volume of 10,542 ±941 ml and mean Uosm of 69 ± 9 mOsm/kg (Table 1). Themean 24-h urine volume of the family members heterozygous forthe mutation (II-2 and III-9) was 1500 ± 0 ml, whichwas similar to spousal controls (III-4 and III-6) 1275 ±530 ml (P = 0.66). The mean Uosm in the heterozygotes was 648± 41 mOsm/kg, also similar to the controls (641 ±257 mOsm/kg; P = 0.96).
Two homozygous (III-5 and III-7) and one heterozygous (II-2)family members participated in the water deprivation study (Table 2and Figure 5). All of the baseline electrolytes, blood ureanitrogen, glucose, creatinine, and calcium levels were withinnormal limits. After the Sosm reached 300 mOsm/kg, and 2 h after1 µg of dDAVP was provided intravenously, the homozygoteshad Uosm of 146 mOsm/kg and 216 mOsm/kg. The urine volume didnot decrease after the dose of dDAVP. In III-7, the mean urinevolume before dDAVP was 417 ± 40 ml/h, and the mean post-dDAVPtreatment was 720 ± 113 ml/h (P = 0.14). In III-5, theurine volumes were 625 ± 240 ml/h and 700 ± 283ml/h (P = 0.78) before and after dDAVP, respectively. The 2-hUosm in the heterozygote subject was 521 mOsm/kg, consistentwith partial NDI. Only one of the homozygous individuals (III-5)had high levels of AVP (29.6 pg/ml) at the maximum Sosm of 320mOsm/kg.
Figure 5. Results of the water deprivation test in three family members.
Three homozygous (III-3, III-5, and III-7), two heterozygous(II-2 and III-9), and two control (III-4 and III-6) family membersparticipated in the dDAVP challenge test (Table 3 and Figure 6).Baseline electrolytes, blood urea nitrogen, glucose, creatinine,and calcium levels were within normal limits. The father (II-2)had elevated systolic and diastolic BP, with means of 152 ±12 mm Hg and 79 ± 6 mm Hg, respectively. In the homozygousindividuals, the mean Uosm was 70 ± 3 mOsm/kg at baseline,116 ± 16 mOsm/kg after the first dose, and 173 ±15 mOsm/kg after the second dose of dDAVP. In these same individuals,the water intake had decreased, with a mean intake of 252 ±131 ml/h between the first and second dose of dDAVP and 199± 143 ml/h between the second and third dose of dDAVP(P = 0.07). The mean urine volume did not decrease significantlybetween the first and second dose of dDAVP (P = 0.81).
Figure 6. Results of the dDAVP (1-desamino-8-D-arginine-vasopressin) challenge test in affected and unaffected family members.
The heterozygous individuals had a baseline urinary osmolalityof 762 ± 274 mOsm/kg, which was not significantly differentfrom 697 ± 34 mOsm/kg observed in controls (P = 0.76).Similarly, the results of the urinary osmolality after the firstdose of dDAVP between the heterozygotes (874 ± 247 mOsm/kg)and controls (803 ± 46 mOsm/kg) were not significantlydifferent (P = 0.78). One of the controls and one of the heterozygousrequired only one dose of dDAVP of 1 µg to increase urineosmolarity above 800 mOsm/kg.
Genetic Studies of the Mexican Town
Buccal cell samples were collected from 222 individuals fromthe town of origin of the family. We evaluated DNA from 218of the samples. We were unable to evaluate four samples (2%)because of poor DNA harvest. Fifty-nine percent of the sampleswere from women, and 41% were from men. The mean age of theindividuals sampled was 48 ± 20 yr (women, 48 ±19 yr; men, 49 ± 20 yr). The age distribution of thesample had a preponderance of older individuals when comparedwith the Mexican estate where the town is located, the NuevoLeon estate (Figure 7). Of the total 218 samples processed,151 samples (69%) did not have the V168M mutation in AQP2. Sixty-fivesamples (30%) were heterozygous for the V168M AQP2 mutation,and two samples (1%) were homozygous for the mutation. The C/Tpolymorphism immediately adjacent to the mutation was also observedin this population at a frequency of 8% T allele. The polymorphismdid not associate with the mutation and was in Hardy-Weinbergequilibrium.
Figure 7. Age distribution of the sample collected in the Mexican town compared with the XII Censo General de Poblacion y Vivienda (Nuevo Leon) 2000 Census.
The gender distribution of the group heterozygous for the mutationwas similar to the sample: 63% women and 37% men. The mean ageof the individuals heterozygous for the V168M was 59 yr ±20, 11 ± 0 yr older than the sample (P < 0.01). Thetwo homozygous individuals were both women, 25 and 60 yr ofage. Deviation from Hardy-Weinberg equilibrium for the V168Mpolymorphism was evaluated, and the population was found notto deviate significantly from the expectation on the basis ofthe marginal genotype frequencies (2 = 3.094, P = 0.080).
We have characterized a V168M mutation in AQP2 in a family withrecessive NDI from Mexico. This mutation caused a partial defectin the affected individuals. No previous AQP2 mutation has beendescribed in individuals of Mexican or Latin American ethnicorigin, although five Brazilian families of European ancestorswere reported with AQP2 mutations (15). The V168M mutation inAQP2 has been described in a family of European descent, inwhich clinically affected individuals were compound heterozygotesfor the V168M and a S126P mutation (16). The functional effectof the V168M mutation on AQP2 was not previously studied, asopposed to the S216P mutation (3,4). The studies in oocytesand the immunocytochemistry results revealed that AQP2-V168Mwas retained in the ER, a molecular defect that is common withAQP2 mutants causing recessive NDI (30). However, compared withAQP2-T126M, which is another mutant in recessive NDI, AQP2-V168Mis clearly less impaired in its trafficking to the plasma membrane,because even at lower total membrane expression levels, moreAQP2-V168M is detected in the plasma membrane (Figures 3 and 4). Because it is well known that an impaired exit from theER is a consequence of misfolding and retention by molecularchaperones that exert the ER quality control, this reduced levelof ER retention of AQP2-V168M compared with AQP2-T126M mightindicate that AQP2-168M is less misfolded than AQP2-T126M. Thisis underscored by the single channel permeability of about 58%for AQP2-V168M in relation to wt-AQP2, whereas 20% was foundfor AQP2-T126M (36). Our oocyte studies do not reveal whetherAQP2-V168M mRNA and protein are less stable than of AQP2-T126M.However, if these stabilities are similar in vivo, the observeddifferences in permeability and trafficking to the plasma membraneof these AQP2 mutants would provide a cell biologic explanationfor the partial improvement of the urinary concentrating capacityand thirst reduction with the use of dDAVP in the AQP2-V168Mindividuals and the absence of any increased urine-concentratingability with dDAVP in the NDI patients encoding AQP2-T126M (14).
Only homozygous individuals in the family were clinically affectedwith partial NDI, a finding based on very high 24-h urine volumesand low urinary osmolalities in the NDI range, even after waterdeprivation and administration of dDAVP. The baseline AVP levelswere lower than expected for patients with severe NDI. In addition,during the water deprivation and saline infusion, the AVP levelsonly increased outside the normal range for the Sosm in III-5,in whom the second AVP drawn was 29.6 pg/ml for a Sosm of 320mOsm/kg, supporting the possibility of a milder type of disease.
Family members heterozygous for the AQP2 mutation (II-2 andIII-9) were not clinically affected and had Uosm and urine volumessimilar to those of controls. The father (II-2), 55 yr old,showed partial NDI in two separate tests with a maximal urineosmolarity of 699 mOsm/Kg, when a normal 80-yr-old individualshould be able to reach at least a urinary osmolality of 823mOsm/Kg (22,24,29). It is possible that he had limited urinaryconcentrating capacity as a result of other causes, such aslong-standing hypertension.
Usually NDI does not respond to treatment with dDAVP unlesssome vasopressin and AQP2 activity remains at the kidney level(39). Because of the rarity of this mutation, we had no familieswith other mutations available to be used as controls. The majorityof the subjects with AQP2 mutations did not respond to dDAVP(3,4,11–13,15,16). Three previous studies in patientswith AQP2 mutations have demonstrated partial diabetes insipidus,one individual with an autosomal recessive mutation (9) andthe other two individuals with autosomal dominant mutations(17,20). AVPR2 mutations have also been reported to producepartial response to dDAVP with milder phenotypes and with mothersaffected with partial NDI (15,16).
The homozygotes in our study repeatedly reported subjectiveimprovement of thirst and urination when dDAVP was used at home,as expected if principal collecting duct cells are still respondingdemonstrating some AQP2 function. This was confirmed by theoocyte functional studies and the clinical studies. The Uosmincreased marginally with water deprivation and dDAVP, and somefunctional aquaporin-2 was found in the plasma membrane of theoocytes. The urinary output in homozygotes treated with dDAVPor water deprivation was not significantly changed, but a decreasein their water intake was observed during the dDAVP challengetest.
None of the affected individuals in the Mexican family had mentalor developmental abnormalities despite symptoms of polyuriaand polydipsia from an early age. In addition, two undiagnosedaffected individuals were identified in the Mexican town. Theseresults indicate that some AQP2 mutations causing partial recessiveNDI permits normal growth and mental development, even if thedisease is undiagnosed. Members of other large kindreds affectedwith NDI have reported mental retardation or failure to thriveas a result of untreated NDI. In a family with recessive AQP2mutations, 6 of 11 individuals had slow psychomotor developmentor mental retardation and short stature (2). Another study reportedthe death of three children with symptoms of diabetes insipidusin a family with recessive AQP2 gene mutations (4). None ofthe affected individuals in the Mexican family had mental ordevelopmental abnormalities, despite symptoms of polyuria andpolydipsia from an early age. In addition, two undiagnosed affectedindividuals were identified in the Mexican town.
The fact that each of the parents of the proband carried thesame rare recessive AQP2 mutation led us to do a genetic epidemiologicstudy in the town of origin. The population sampled in the townwas older when compared with the national census. In addition,more women than men were sampled. Young men in the town wereoften employed as seasonal migrant farm workers, and this factmay have affected the population sampled. Thirty percent ofthe individuals in the sample were heterozygous for the mutation,and 1% were homozygous. The frequency of individuals affectedby mutations in the AQP2 gene in the general population of Mexicois unknown, but it is likely to be less than one in a million(8,40). The high frequency of the mutant allele in the population(15.8%) suggests a founder effect of the mutation in the population.The extraordinarily high prevalence of this recessive mutationin the town, along with the distribution of the mutation alongall ages, suggests a relatively high risk of having more affectedindividuals born in this town. The heterozygote individualshad a similar gender distribution when compared with the entiresample, but had a mean age 11 yr older, which could be suggestiveof increased admixture with other populations in the youngergenerations.
The polymorphism immediately adjacent to the mutation was clearlyin equilibrium and was on a separate allele from the mutation.None of the individuals in the family had the polymorphism atnucleotide 501 present in their DNA. In addition, none of theindividuals in the town that were homozygous for the polymorphismhad the mutation. The health care workers in the town were previouslyunaware of the presence of NDI in the community. The life-threateningcomplications of NDI can be easily treated if an individualand the health care providers are aware of the condition. Asan attempt to increase the alertness in the town about the disease,we have provided medical information concerning this conditionto the health care workers and the population.
In summary, individuals affected with partial NDI in a familyof Mexican origin were found to be homozygous for a V168M mutationin AQP2. Consistent with this phenotype, AQP2-V168M was retainedin the ER of oocytes, but was still partially functional andless impaired in its trafficking to the cell surface than anotherfunctional AQP2 mutant involved in severe recessive NDI. Theaffected homozygous individuals reported subjective improvementof thirst and urination with the use of dDAVP. This findingwas consistent with the clinical studies, which showed partialNDI. dDAVP treatment partially increased Uosm and decreasedfluid intake. Heterozygotes compared with controls showed nourinary concentrating defects. In the genetic epidemiologicstudy of the town of origin, we found a high prevalence of theV168M mutation, suggesting a founder effect. The mutation inthe population was in Hardy-Weinberg equilibrium. Affected individualshad no neurologic deficits from untreated NDI. This raises thespeculation that undiagnosed cases of NDI may exist in otherpopulations. Preventive and educational measures were implementedin the town with the cooperation of the local health authorities.
Acknowledgments
Clinical and genetic studies were supported by NIH grant MO1RR02558. The cell biological studies were supported by grantsfrom the European Union (QLRT-2000-00778; QLK3-CT-2001-00987)to P.M.T.D. D.M.M. is a Doris Duke Distinguished Clinical Scientist.
Footnotes
F.M. and D.-C.G. contributed equally to this study.
Robertson GL: Diabetes insipidus. Endocrinol Metab Clin North Am 24: 549–572, 1995[Medline]
Hochberg Z, Van Lieburg A, Even L, Brenner B, Lanir N, van Oost BA, Knoers NV: Autosomal recessive nephrogenic diabetes insipidus caused by an aquaporin-2 mutation. J Clin Endocrinol Metab 82: 686–689, 1997[Abstract/Free Full Text]
Pasel K, Schulz A, Timmermann K, Linnemann K, Hoeltzenbein M, Jaaskelainen J, Gruters A, Filler G, Schoneberg T: Functional characterization of the molecular defects causing nephrogenic diabetes insipidus in eight families. J Clin Endocrinol Metab 85: 1703–1710, 2000[Abstract/Free Full Text]
van Lieburg AF, Verdijk MA, Knoers VV, van Essen AJ, Proesmans W, Mallmann R, Monnens LA, van Oost BA, van Os CH, Deen PM: Patients with autosomal nephrogenic diabetes insipidus homozygous for mutations in the aquaporin 2 water-channel gene. Am J Hum Genet 55: 648–652, 1994[Medline]
Crawford JD, Bode HH: Diabetes and the amplifier hypothesis. N Engl J Med 282: 1266–1267, 1970
van Os CH, Deen PM: Aquaporin-2 water channel mutations causing nephrogenic diabetes insipidus. Proc Assoc Am Physicians 110: 395–400, 1998[Medline]
Canfield MC, Tamarappoo BK, Moses AM, Verkman AS, Holtzman EJ: Identification and characterization of aquaporin-2 water channel mutations causing nephrogenic diabetes insipidus with partial vasopressin response. Hum Mol Genet 6: 1865–1871, 1997[Abstract/Free Full Text]
Deen PM, Verdijk MA, Knoers NV, Wieringa B, Monnens LA, van Os CH, van Oost BA: Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science 264: 92–95, 1994[Abstract/Free Full Text]
Goji K, Kuwahara M, Gu Y, Matsuo M, Marumo F, Sasaki S: Novel mutations in aquaporin-2 gene in female siblings with nephrogenic diabetes insipidus: Evidence of disrupted water channel function. J Clin Endocrinol Metab 83: 3205–3209, 1998[Abstract/Free Full Text]
Hochberg Z, Even L, Danon A: Amelioration of polyuria in nephrogenic diabetes insipidus due to aquaporin-2 deficiency. Clin Endocrinol Oxf 49: 39–44, 1998[CrossRef][Medline]
Lin SH, Bichet DG, Sasaki S, Kuwahara M, Arthus MF, Lonergan M, Lin YF: Two novel aquaporin-2 mutations responsible for congenital nephrogenic diabetes insipidus in Chinese families. J Clin Endocrinol Metab 87: 2694–2700, 2002[Abstract/Free Full Text]
Mulders SM, Knoers NV, van Lieburg AF, Monnens LA, Leumann E, Wuhl E, Schober E, Rijss JP, van Os CH, Deen PM: New mutations in the AQP2 gene in nephrogenic diabetes insipidus resulting in functional but misrouted water channels. J Am Soc Nephrol 8: 242–248, 1997[Abstract]
Rocha JL, Friedman E, Boson W, Moreira A, Figueiredo B, Liberman B, de Lacerda L, Sandrini R, Graf H, Martins S, Punales MK, De Marco L: Molecular analyses of the vasopressin type 2 receptor and aquaporin-2 genes in Brazilian kindreds with nephrogenic diabetes insipidus. Hum Mutat 14: 233–239, 1999[CrossRef][Medline]
Vargas-Poussou R, Forestier L, Dautzenberg MD, Niaudet P, Dechaux M, Antignac C: Mutations in the vasopressin V2 receptor and aquaporin-2 genes in 12 families with congenital nephrogenic diabetes insipidus. J Am Soc Nephrol 8: 1855–1862, 1997[Abstract]
Mulders SM, Bichet DG, Rijss JP, Kamsteeg EJ, Arthus MF, Lonergan M, Fujiwara M, Morgan K, Leijendekker R, van der SP, van Os CH, Deen PM: An aquaporin-2 water channel mutant which causes autosomal dominant nephrogenic diabetes insipidus is retained in the Golgi complex. J Clin Invest 102: 57–66, 1998[Medline]
Kamsteeg EJ, Wormhoudt TA, Rijss JP, van Os CH, Deen PM: An impaired routing of wild-type aquaporin-2 after tetramerization with an aquaporin-2 mutant explains dominant nephrogenic diabetes insipidus. EMBO J 18: 2394–2400, 1999[CrossRef][Medline]
Marr N, Bichet DG, Lonergan M, Arthus MF, Jeck N, Seyberth HW, Rosenthal W, van Os CH, Oksche A, Deen PM: Heteroligomerization of an aquaporin-2 mutant with wild-type aquaporin-2 and their misrouting to late endosomes/lysosomes explains dominant nephrogenic diabetes insipidus. Hum Mol Genet 11: 779–789, 2002[Abstract/Free Full Text]
Kuwahara M, Iwai K, Ooeda T, Igarashi T, Ogawa E, Katsushima Y, Shinbo I, Uchida S, Terada Y, Arthus MF, Lonergan M, Fujiwara TM, Bichet DG, Marumo F, Sasaki S: Three families with autosomal dominant nephrogenic diabetes insipidus caused by aquaporin-2 mutations in the C-terminus. Am J Hum Genet 69: 738–748, 2001[CrossRef][Medline]
Kamsteeg EJ, Bichet DG, Konings IB, Nivet H, Lonergan M, Arthus MF, van Os CH, Deen PM: Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus. J Cell Biol 163: 1099–1109, 2003[Abstract/Free Full Text]
Zerbe RL, Robertson GL: A comparison of plasma vasopressin measurements with a standard indirect test in the differential diagnosis of polyuria. N Engl J Med 305: 1539–1546, 1981[Abstract]
Baylis PH, Robertson GL: Plasma vasopressin response to hypertonic saline infusion to assess posterior pituitary function. J R Soc Med 73: 255–260, 1980[Medline]
Tryding N, Berg B, Ekman S, Nilsson JE, Sterner G, Harris A: DDAVP test for renal concentration capacity: Age-related reference intervals. Scand J Urol Nephrol 22: 141–145, 1988[Medline]
Tryding N, Sterner G, Berg B, Harris A, Lundin S: Subcutaneous and intranasal administration of 1-deamino-8-D-arginine vasopressin in the assessment of renal concentration capacity. Nephron 45: 27–30, 1987[Medline]
Somerfield SD, Hocken AG: Desamino arginine vasopressin (DDAVP) as a diagnostic agent. N Z Med J 86: 472–473, 1977[Medline]
Fjellestad-Paulsen A, Hoglund P, Lundin S, Paulsen O: Pharmacokinetics of 1-deamino-8-D-arginine vasopressin after various routes of administration in healthy volunteers. Clin Endocrinol (Oxf) 38: 177–182, 1993[Medline]
Marr N, Bichet DG, Hoefs S, Savelkoul PJ, Konings IB, De Mattia F, Graat MP, Arthus MF, Lonergan M, Fujiwara TM, Knoers NV, Landau D, Balfe WJ, Oksche A, Rosenthal W, Muller D, van Os CH, Deen PM: Cell-biologic and functional analyses of five new aquaporin-2 missense mutations that cause recessive nephrogenic diabetes insipidus. J Am Soc Nephrol 13: 2267–2277, 2002[Abstract/Free Full Text]
Lum A, Le Marchand L: A simple mouthwash method for obtaining genomic DNA in molecular epidemiological studies. Cancer Epidemiol Biomarkers Prev 7: 719–724, 1998[Abstract]
Garcia-Closas M, Egan KM, Abruzzo J, Newcomb PA, Titus-Ernstoff L, Franklin T, Bender PK, Beck JC, Le Marchand L, Lum A, Alavanja M, Hayes RB, Rutter J, Buetow K, Brinton LA, Rothman N: Collection of genomic DNA from adults in epidemiological studies by buccal cytobrush and mouthwash. Cancer Epidemiol Biomarkers Prev 10: 687–696, 2001[Abstract/Free Full Text]
Snedecor GW, Cochran WG: Statistical Methods, 8th Ed., Ames, Iowa State University Press, 1989
Warnes G, Leisch F. The Genetics Package for R-Plus (1.6-40). www.R-project.org, GNU General Public License V2, 3-19-2003
Instituto Nacional de Estadistica GeIM: Estados Unidos Mexicanos: XII censo general de poblacion y vivienda, Mexico City, Mexico, Aguascalientes, Ags., Instituto Nacional de Estadistica, Geografia e Informatica, 2000
Marr N, Kamsteeg EJ, van Raak M, van Os CH, Deen PM: Functionality of aquaporin-2 missense mutants in recessive nephrogenic diabetes insipidus. Pflugers Arch 442: 73–77, 2001[CrossRef][Medline]
Tamarappoo BK, Yang B, Verkman AS: Misfolding of mutant aquaporin-2 water channels in nephrogenic diabetes insipidus. J Biol Chem 274: 34825–34831, 1999[Abstract/Free Full Text]
Kamsteeg EJ, Deen PM: Importance of aquaporin-2 expression levels in genotype-phenotype studies in nephrogenic diabetes insipidus. Am J Physiol Renal Physiol 279: F778–F784, 2000[Abstract/Free Full Text]
Arthus MF, Lonergan M, Crumley MJ, Naumova AK, Morin D, De Marco LA, Kaplan BS, Robertson GL, Sasaki S, Morgan K, Bichet DG, Fujiwara TM: Report of 33 novel AVPR2 mutations and analysis of 117 families with X-linked nephrogenic diabetes insipidus. J Am Soc Nephrol 11: 1044–1054, 2000[Abstract/Free Full Text]
Received for publication May 5, 2003.
Accepted for publication February 10, 2004.
This article has been cited by other articles:
M. A. Linshaw Back to Basics: Congenital Nephrogenic Diabetes Insipidus
Pediatr. Rev.,
October 1, 2007;
28(10):
372 - 380.
[Full Text][PDF]
P. M. T. Deen Mouse models for congenital nephrogenic diabetes insipidus: what can we learn from them?
Nephrol. Dial. Transplant.,
April 1, 2007;
22(4):
1023 - 1026.
[Full Text][PDF]
J. H. Robben, N. V. A. M. Knoers, and P. M. T. Deen Cell biological aspects of the vasopressin type-2 receptor and aquaporin 2 water channel in nephrogenic diabetes insipidus.
Am J Physiol Renal Physiol,
August 1, 2006;
291(2):
F257 - F270.
[Abstract][Full Text][PDF]
F. de Mattia, P. J.M. Savelkoul, E.-J. Kamsteeg, I. B.M. Konings, P. van der Sluijs, R. Mallmann, A. Oksche, and P. M.T. Deen Lack of Arginine Vasopressin-Induced Phosphorylation of Aquaporin-2 Mutant AQP2-R254L Explains Dominant Nephrogenic Diabetes Insipidus
J. Am. Soc. Nephrol.,
October 1, 2005;
16(10):
2872 - 2880.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
2 test was used for deviation from Hardy-Weinberg equilibrium. 
). Because it is well known that an impaired exit from the ER is a consequence of misfolding and retention by molecular chaperones that exert the ER quality control, this reduced level of ER retention of AQP2-V168M compared with AQP2-T126M might indicate that AQP2-168M is less misfolded than AQP2-T126M. This is underscored by the single channel permeability of about 58% for AQP2-V168M in relation to wt-AQP2, whereas 20% was found for AQP2-T126M (36). Our oocyte studies do not reveal whether AQP2-V168M mRNA and protein are less stable than of AQP2-T126M. However, if these stabilities are similar in vivo, the observed differences in permeability and trafficking to the plasma membrane of these AQP2 mutants would provide a cell biologic explanation for the partial improvement of the urinary concentrating capacity and thirst reduction with the use of dDAVP in the AQP2-V168M individuals and the absence of any increased urine-concentrating ability with dDAVP in the NDI patients encoding AQP2-T126M (14). 
-AQP2 antibodies, followed by Alexa-594.
