Journal of the American Society of Nephrology
2008 JASN IMPACT FACTOR 7.505 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


Published ahead of print on November 2, 2005
J Am Soc Nephrol 16: 3527-3534, 2005
© 2005 American Society of Nephrology
doi: 10.1681/ASN.2005050544

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ASN.2005050544v1
16/12/3527    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, D.
Right arrow Articles by Dressler, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, D.
Right arrow Articles by Dressler, G. R.

Genetics and Development

Nephrogenic Factors Promote Differentiation of Mouse Embryonic Stem Cells into Renal Epithelia

Doyeob Kim and Gregory R. Dressler

Department of Pathology, University of Michigan, Ann Arbor, Michigan

Address correspondence to: Dr. Gregory R. Dressler, University of Michigan, Department of Pathology, MSRB1, Room 4510, 1150 West Medical Center Drive, Ann Arbor, MI 48109. Phone: 734-764-6490; Fax: 734-763-6640; dressler{at}umich.edu

Received for publication May 24, 2005. Accepted for publication September 28, 2005.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Embryonic stem (ES) cells have been induced to differentiate in vitro into a broad spectrum of specialized cell types, including hematopoietic, pancreatic, and neuronal cell types. Such ES-derived cells can provide a valuable source of progenitor cell types. Whereas undifferentiated ES cells can become integrated into a developing kidney and contribute to tubular epithelia, the ability to generate renal precursor cells in vitro has not been reported. This study used a combination of nephrogenic growth factors to differentiate ES cells into renal epithelial cells that are capable of integrating into a developing kidney with very high efficiency. Using a combination of retinoic acid, Activin-A, and Bmp7, cultured ES cells can be induced to express markers specific for the intermediate mesoderm, from which the kidneys arise. Embryoid bodies that are cultured in the presence of nephrogenic factors can respond to inductive signals and form epithelial structures in vitro. When injected into developing kidney rudiments, treated ES cells contribute to tubular epithelia with near 100% efficiency. These methods may facilitate the large-scale culture of renal epithelial precursor cells for a variety of applications.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Embryonic stem (ES) cells provide a potentially unlimited source for generating highly specialized cells and tissues in vitro. Such in vitro–produced cells can be excellent model systems for physiologic studies and may ultimately have therapeutic applications. Indeed, ES cells can be directed to differentiate along specific cell lineage pathways, such as pancreatic cells (1,2), motor neurons (3), and hematopoietic cells (4). The ability to differentiate ES cells selectively depends in part on secreted growth and differentiation factors that mimic the environment of a particular cell lineage. Recently, Steenhard et al. (5) injected undifferentiated ES cells into developing kidneys and showed integration into tubules with an efficiency approaching 50%. However, in vitro differentiation of ES cells into renal epithelial precursor cells has not been reported. Given the frequency of both chronic and acute renal failure in adults and the limited ability of renal tubular epithelial cells to regenerate in vivo, the possibility of cell replacement therapy by renal progenitor cells merits investigation. To begin directing ES cell differentiation toward the renal epithelial lineage, intimate knowledge of early development is essential.

In birds and mammals, the mesoderm is compartmentalized along the mediolateral axis into paraxial, intermediate, and the lateral plate mesoderm. Much of the urogenital system is derived from the intermediate mesoderm, which undergoes sequential patterning into pro-, meso-, and metanephric structures along the anterior-posterior axis (6). The Pax2 and Pax8 genes are expressed early in the intermediate mesoderm and are required for formation of the first epithelial ducts (7). In the chick embryo, activation of Pax2 expression requires signals from paraxial mesoderm, although these remain largely uncharacterized (8). The adult kidney, or metanephros, is formed by reciprocal inductive interactions between the ureteric bud epithelium and the metanephric mesenchyme. This induced mesenchyme is thought to provide a pool of renal stem cells that are capable of generating much of the tubular and glomerular epithelia (9). Among the early genes expressed in the metanephric mesenchyme are Pax2, Wt1, gdnf, six1, and six2 (6,10,11). Subsequent to induction, many additional secreted factors, including Wnts and bone morphogenic proteins (BMP), stimulate epithelia cell differentiation and refine the pattern of the developing nephron.

In this report, we use the known markers and biochemical pathways for early kidney development to differentiate ES cells into renal epithelial progenitor cells. On the basis of pioneering work in the Xenopus embryo (12,13), retinoic acid (RA) and Activin were used to stimulate expression of early intermediate mesodermal markers. Addition of Bmp7 further enhanced the ability of these cells to contribute to developing tubules in a kidney organ culture system. Our data define a nephrogenic cocktail of factors that promote differentiation into intermediate mesoderm-like cells and ultimately renal epithelial cells. Such in vitro–generated cells may be very useful for the development of bioartificial organs (14) or cell-based therapies in chronic or acute renal failure.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture and Microinjection into Kidneys
Mouse ES cells (R26) were grown in high-glucose DMEM (Life Technologies BRL, Gaithersburg, MD), 10% FBS (Atlanta Biologicals, Atlanta, GA), 0.1 mM {beta}-mercaptoethanol (Sigma, St. Louis, MO), 4 mM glutamine (Life Technologies BRL), 20 units/ml PEN/STREP (Life Technologies BRL), 0.1 mg/ml G418 (Life Technologies BRL), and 103 units/ml rat leukemia inhibitory factor (rLIF) (Chemicon, Temecula, CA) on a 0.1% gelatin-coated tissue culture plate at 37°C with 5% CO2 and 95% air for 2 d. The ES cells were dissociated with 0.05% trypsin plus 0.53 mM EDTA (Life Technologies BRL) and transferred to a 100-mm bacteriological petri dish (BD Falcon, San Jose, CA) to induce embryoid body (EB) formation. The EB suspension was cultured in the same medium without rLIF for 2 d and then transferred to 60-mm tissue culture plates coated with 0.1% gelatin. Each 60-mm tissue culture plate contained approximately 100 EB. The EB were grown without growth factors or in the presence of the following growth factors: 0.1 µM RA, 10 ng/ml activin-A, 50 ng/ml Bmp4, or 50 ng/ml Bmp7 (R & D Systems, Minneapolis, MN). The cells were trypsinized and resuspended with 10 µl of PBS to make a final concentration of 108 cells/ml and microinjected with a very fine needle into E11.5 or E12.5 embryonic kidneys on a Transwell plate in which 0.9 ml of DMEM was added. The kidneys were cultured at 37°C with 5% CO2 and 95% air for 3 to 5 d. For in vitro induction experiments, EB were cultured on methyl-cellulose plates for 5 d with or without nephrogenic factors and then placed next to a piece of E12.5 spinal cord on a transwell filter.

Reverse Transcription–PCR Analysis
Total RNA was extracted by using TRIZOL reagent (Life Technologies BRL). One unit of DNAse I (Roche, Indianapolis, IN) was added per microgram of RNA, and the mixture was incubated at 37°C for 30 min. Two micrograms of total RNA was reverse transcribed using Stratascript RT (Stratagene, La Jolla, CA) as the manufacturer’s protocol. Two reactions of a negative control were also performed with water, instead of RNA or without reverse transcriptase.

For real-time PCR, primer pairs were designed using the Primer3 program (15). The primer pairs spanning one intron were as follows: Pax-2 GGCATCTGCGATAATGACACA, GGTGGAAAGGCTGCTGAACTT; Lim-1 AATGCAACCTGACCGAGAAG, ACATCATGCAGGTGAAGCAG; GDNF ACGAAACCAAGGAGGAACTGA, TTTGTCGTACATTGTCTCGGC; Eya1 CTAACCAGCCCGCATAGCCG, TAGTTTGTGAGGAAGGGGTAGG; Six2 GCAAGTCAGCAACTGGTTCA, AACTGCCTAGCACCGACTTG; Wnt4 CATCTCTTCAGCAGGTGTGG, GGACGTCCACAAAGGACTGT; WT1 CAGGATGTTCCCCAATGC, CCTCGTGTTTGAAGGAATGG; Cadherin-6 TTTGTGGTCCAAGTCACGGC, CATCGGCATCACTGGCTTTG; Oct-4 AGCTGCTGAAGCAGAAGAGG, GGTTCTCATTGTTGTCGGCT; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) TCCGCCCCTTCTGCCGATG, CACGGAAGGCCATGCCAGTGA; and Synapsin1 GGTCATCGACGAACCGCACA, TCCACCATTGGCATGAGCCA. All pairs are written 5' to 3' with the top and bottom strands in order.

Real-time PCR was performed using a BioRad iQ iCycler Detection System (BioRad Laboratories, Ltd, Hercules, LA) with SYBR green fluorophore. Reactions were performed in a total volume of 20 µl, including 10 µl of SYBR Green Supermix (BioRad Laboratories, Ltd), 0.1 µl of each primer of a 10-µM stock, and 10 µl of the 10-fold diluted reverse-transcribed cDNA template. The cycling conditions were as follows: Predenaturation (95°C for 3 min) and PCR amplification (40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s). All reactions were carried out in triplicate for every sample. The standard serial 10-fold dilutions of template cDNA and two reactions of negative control were repeated on every plate. GAPDH was used for normalization, and relative quantification was analyzed using iCycler iQ Optical System Software Version 3.0a (BioRad Laboratories, Ltd).

Immunocytochemistry
EB were fresh frozen in OCT and sectioned at 10 µ in a cryostat. After air drying, sections were fixed in 3% paraformaldehyde for 10 min and washed in PBS and 0.1% Tween 20 (PBST). Antibodies were incubated for 2 h at room temperature in PBST and 2% goat serum. The primary antibodies used were rabbit anti-Pax2 (Covance Inc., Princeton, NJ), mouse anti-pan-cytokeratin (Sigma), mouse anti–E-cadherin (Cell Signaling Technology, Beverly, MA), mouse anti–b-catenin (Cell Signaling Technology), rabbit anti-laminin (Sigma), and FITC-lotus tetragonobulus agglutinin (LTA; Sigma). After washing two times in PBST, fluorescence-conjugated secondary antibodies were used. Controls included second antibodies only to ensure specificity. Images were captured on a Nikon ES800 fluorescence scope with a SPOT digital camera.

LacZ Staining
For whole mounts, kidney rudiments were fixed in 0.2% glutaraldehyde, 1% formaldehyde, and 0.02% NP-40 in PBS for 10 min at room temperature; washed in PBS; and stained overnight at room temperature in PBS with 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, and 1 mg/ml X-Gal. After washing in PBS, whole rudiments were incubated with anti-laminin (Sigma; 1:100) in PBS, 0.1% Tween-20, 2% goat serum, or FITC-conjugated lectin tetragonobulus (Sigma; 1:50). Detection of anti-laminin was with TRITC-conjugated anti-rabbit secondary antibodies. Washes were done at room temperature three or four times in PBS and 0.1% Tween-20. For staining of sections, fresh-frozen kidney rudiments were cut at 25 µ and fixed as above. Staining was done at 32°C overnight in X-gal buffer, and sections were washed in PBST. Anti-laminin and FITC-conjugated LTA were used to visualize tubules.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To examine the ability of ES cells to differentiate into intermediate mesoderm under controlled conditions, we first formed EB in culture over a 5-d period. The Rosa26 ES cell line was used in this study as it is tagged with a ubiquitously expressed lacZ gene. Subsequently, the EB were cultured with increasing concentrations of BMP, RA, or Activin-A and grown for an additional 5 d and analyzed for Pax2 protein expression (Figure 1A). The concentrations of RA and Activin-A and BMP ranged in 10-fold increments from 10–6 to 10–12 M and 1 to 100 ng/ml, respectively. BMP are known to induce mesoderm and hemangioblasts in ES cell cultures (16,17), whereas RA and Activin in combination are able to expand the pronephric field in the Xenopus embryo (18). Experiments with RA and Activin in combination generated the highest levels of Pax2 protein (Figure 1A). Bmp4 alone showed some increase in Pax2 at low doses but none at higher doses, whereas Bmp7 treatment showed low levels of Pax2 at high doses. Although Pax2 is one of the earliest markers in the intermediate mesoderm, it is also expressed in differentiated commissural neurons of the spinal cord and in the midbrain/hindbrain junction.



View larger version (35K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Gene expression analysis in embryoid bodies (EB) after addition of differentiation promoting factors. (A) Western blotting for Pax2 after addition of factors to EB. Activin-A, bone morphogenic protein 4 (BMP4), BMP7, or retinoic acid (RA) was added at increasing concentrations to EB and cultured for 5 d. Equal amounts of protein lysates were loaded and probed with anti-Pax2. EB that were cultured without factors served as a negative control (C). Activin-A was also added in combination with 10–7 M RA. The arrow indicates the 48-kD Pax2b protein. (B) Total RNA was extracted from cells after 5 d of culture with control medium or addition of growth factors and assayed for gene-specific expression by semiquantitative (top) and real-time reverse transcription–PCR (mean and SD). Lanes are as follows: ES, undifferentiated ES cells; EB, embryoid bodies without growth factors or rLIF; RA, EB with 0.1 µM RA and 10 ng/ml Activin-A; RA4, 0.1 µM RA, 10 ng/ml Activin-A, and 50 ng/ml BMP4; RA7, 0.1 µM RA, 10 ng/ml Activin-A, and 50 ng/ml BMP7. For semiquantitative PCR, input RNA were adjusted so that equal amounts of glyceraldehyde-3-phosphate dehydrogenase were amplified in each sample. Real-time data are shown below each panel as the mean relative amount of three independent runs with 1 SD. The neuronal marker Synapsin-1 was tested by real-time PCR only. The amount of RNA measured in untreated EB was arbitrarily assigned the value of 1.0.

 
To assess the efficacy of growth and differentiation factors more completely, we isolated RNA from EB and tested them by real-time reverse transcription–PCR for the expression of early nephrogenic markers (6,19). The Pax2 and lim1 genes are among the earliest markers of the intermediate mesoderm, from which the renal epithelial cells arise. Subsequently, Pax2 is expressed in all epithelial precursors of the kidney. The Wt1 gene is expressed at low levels in renal mesenchyme and epithelial cells and at high levels in the podocytes. The Eya1, Six2, and gdnf genes are expressed in early kidney mesenchyme but not their epithelial derivatives. Wnt4 is highly expressed in early mesenchymal aggregates and their epithelial derivatives, whereas cadherin-6 is an early marker for proximal tubule (PT) precursors. Oct4 expression is a marker of pluripotency in ES cells and is not found in more differentiated lineages (20).

A significant shift in the pattern of gene expression was evident upon addition of RA and differentiation promoting factors (Figure 1B). In the absence of LIF, the EB express a large set of markers that reflect, in part, the heterogeneity of the EB. Some of the markers, such as Wnt4, Six2, and lim1, were increased in EB, compared with ES cells, in the absence of any factors. This may reflect their heterogeneous expression patterns in many cell types other than intermediate mesoderm, as the EB differentiate randomly. However, the combination of RA and Activin-A was highly effective in stimulating Pax2 and Wt1 induction more than 20- and 30-fold, respectively. Consistent with the loss of pluripotency, the expression of Oct4 was suppressed in EB and in all treated cultures. The expression of Eya1, gdnf, and cadherin-6 also increased in RA-treated EB. Further addition of Bmp4 (RA4) suppressed expression of early intermediate mesoderm-specific markers, such as lim1, Pax2, and Wt1. However, Bmp7-treated EB (RA7) reduced Pax2 and Wt1 levels to a much lesser extent than Bmp4 while increasing cadherin-6, gdnf, lim1, and Eya1 levels. The neural specific marker synapsin-1 showed approximately a two-fold increase in expression upon RA treatment that was unaffected by Bmp7.

The induction of Pax2, Wt1, lim1, gdnf, and cadherin-6 indicated that at least some of the cells within the EB expressed markers that are appropriate but not necessarily exclusive for intermediate mesoderm and early derivatives of the metanephric mesenchyme. To gauge the proportion of cells within the EB that express these markers, we used immunohistochemistry on sections through treated and control EB (Figure 2). Widespread nuclear Pax2 staining was evident in EB that were cultured in our nephrogenic cocktail but not in control EB (Figure 2, A and B). Large patches of E-cadherin–positive cells were also observed, exhibiting the characteristic cell surface staining. These E-cadherin–positive regions covered much more area in the EB that were cultured with nephrogenic factors. Similarly, cytokeratins were observed in control EB, but many more positive areas were seen in treated EB. In treated cultures, some Pax2-positive cell clusters also expressed E-cadherin and epithelial cytokeratins and were surrounded by a laminin-containing basement membrane (Figure 2, C and D). In treated cultures, cytokeratin-expressing cells were frequently near cells that expressed cadherin-6, but these markers were rarely expressed in the same cells (Figure 2, E and F). In control EB, few cells exhibited the characteristic cell surface expression of cadherin-6. Strong laminin staining was found throughout the treated EB, although this was mostly not in defined tubular structures but rather more filamentous throughout the EB (Figure 2, G and H). In control EB, laminin staining was not very prominent. Secondary antibodies alone showed no staining in any sections examined (data not shown).



View larger version (63K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Immunostaining of EB. EB were cultured for 5 d in methylcellulose-treated dishes with and without nephrogenic factors (RA7) and sectioned. (A) RA7-treated EB stained for Pax2 (red) and {beta}-catenin (green). Note the high percentage of Pax2-positive cells. (B) Control EB that were cultured without factors stained for Pax2 (red) and {beta}-catenin (green). (C) RA7-treated EB stained for Pax2 (red) and E-cadherin (green). Note Pax2 expression in E-cadherin–positive structures (arrow). (D) Neighboring section to C stained for laminin (red) and cytokeratin (green). (E) RA7-treated EB stained for cadherin-6 (red) and cytokeratin (green). Note the juxtaposition of cytokeratin-positive cells (arrowhead) and cadherin-6–positive cells (arrow). Expression of these markers did not overlap. (F) Control EB stained for cadherin-6 (red) and cytokeratin (green). No cadherin-6 staining was observed. (G) RA7-treated EB stained for laminin (red). Strong, filamentous laminin staining was found throughout the EB but was generally not consistent with basement membrane–type staining. (H) Control EB stained for laminin (red). Magnification bars = 100 µ.

 
The metanephric mesenchyme expresses both Pax2 and Wt1 before induction by the ureteric bud and epithelial cell polarization. Induction can be mimicked in vitro by co-culturing metanephric mesenchyme with embryonic spinal cord, a strong heterologous inducer. Thus, EB that were cultured in nephrogenic factors were placed next to isolated embryonic spinal cord on Transwell filters (Figure 3). After 4 d in culture, spinal cord induced multiple epithelial cysts and tubule-like structures in EB that were treated with nephrogenic factors (Figure 3, A, C, and E through G). Many but not all of these epithelial structures expressed Pax2, and all expressed E-cadherin. Pax2-positive epithelial structures were frequently surrounded by laminin-containing basement membranes. EB that were cultured in control medium alone did not respond well to inductive signals. Some E-cadherin–positive regions were observed, but these remained flattened and did not resemble epithelial cysts or tubules (Figure 3, D and H).



View larger version (120K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Co-culture of EB with spinal cord. EB were cultured for 5 d with or without nephrogenic factors, placed next to embryonic spinal cord on a transwell filter, and cultured for an additional 4 d. (A) Phase contrast of RA7-treated EB surrounding a piece of E12.5 spinal cord (sc). (B) Phase contrast of control EB surrounding a piece of E12.5 sc. (C through H) Whole-mount antibody staining for Pax2 (red), E-cadherin (green), and laminin (blue) of EB after co-culture with sc. (C) RA7-treated EB exhibit Pax2-positive tubules (arrows) that also express E-cadherin and are surrounded by laminin-containing basement membrane. Some large E-cadherin–positive aggregates that do not express Pax2 (arrowhead) are also present. (D) Control EB exhibit no Pax2-positive tubules, diffuse laminin staining, and the occasional E-cadherin–positive aggregate. (E through G) Examples of tubules found in RA7-treated EB after co-culture with sc. (H) Typical control EB after co-culture with sc. Magnification bars = 500 µ for A and B and 100 µ for C through H.

 
If cells within the treated EB differentiated along the intermediate mesodermal lineage, then they should be able to become integrated into a developing kidney. Thus, we isolated EB after 5 to 7 d of culture, using the cocktail of nephrogenic factors described above, and microinjected approximately 10 to 20 nl of the cell suspension (1000 to 2000 cells) into cultured kidney rudiments that had been dissected from E12.5 embryos and placed on Transwell filters. After the kidney rudiments were cultured for an additional 4 to 5 d, lacZ staining on whole mounts and cryosections and fluorescence antibody staining were performed with the kidney rudiments (Figure 4). Kidneys that were injected with cells that were isolated from treated EB exhibited lacZ staining in tubules throughout the organ culture (Figure 4, A through D). These lacZ-positive cells were almost exclusively found in tubular structures, as determined by staining with anti-laminin. In contrast, cells that were isolated from EB without any further treatment exhibited far fewer lacZ-positive tubules and large patches of lacZ-positive cells along the peripheral mesenchyme and within the interstitium (Figure 4, E through H) that more closely resembled undifferentiated cells, much like small EB. Using images that were obtained from sections of five independently injected kidney rudiments, we calculated the area of lacZ staining in tubules and nontubular structures. For RA7-treated cells, it was difficult even to find and measure lacZ-positive cells or regions that were not epithelial. Thus, we believe that the efficiency of incorporation of treated EB cells approaches 100%. For untreated EB-derived cells, the area of lacZ-positive staining found in nontubular structures ranged from 31 to 85% with a mean of 60% (± 19.7%). Thus, approximately 40% of lacZ-positive staining was found in epithelial tubules when untreated EB cells were injected into kidney rudiments. These, numbers reflect percentage of surface area and not numbers of cells. In the absence of Bmp7, the proportion of lacZ-positive tubules was reduced, whereas addition of 100 ng/ml Bmp4 completely inhibited the ability of EB cells to contribute to tubules in vitro (data not shown).



View larger version (54K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Injection of EB-derived cells into E12.5 cultured kidneys. Cryosections from kidney rudiments were stained for lacZ expression (A, C, E, and G) and with anti-laminin antibodies (B, D, F, and H). (A through D) LacZ-positive cells from RA7-treated EB were found predominantly in tubular structures (arrows), with virtually no detectable lacZ-positive cells in interstitial or mesenchymal cells. (E through H) Many lacZ-positive cells from control EB were found in large and small aggregates (arrows) that remained mesenchymal in appearance and were not surrounded by laminin-containing basement membranes. Some blue cells from control EB were also found in tubules. Magnification bars = 100 µ. More images can be seen in supplemental Figures 1 and 2 (available online at http://www.jasn.org).

 
To characterize better the nature of the lacZ-positive tubules that were derived from treated EB cells, we used whole mounts and sections from kidney rudiments 4 or 5 d after injection (Figure 5). LacZ-positive cells could be found in tubules that connected to developing Bowman’s capsules but were never found in glomerular tufts (Figure 5, A and B). That many lacZ-positive tubules were developing PT was confirmed by co-staining with anti-laminin and LTA (Figure 5, C through F). FITC-LTA stains the lumens of PT during development (21) and co-localized with some but not all LacZ-positive cells in treated cultures. Untreated control EB cells rarely co-localized with LTA-positive tubules, and LacZ-positive clusters were mesenchymal in appearance (Figure 5, G and H). Thus, EB cells that were treated with the RA7 nephrogenic cocktail were able to contribute to developing tubules with increased frequency, compared with untreated EB cells.



View larger version (77K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Characterization of EB-derived tubule cells. E12.5 kidney rudiments were injected with RA7-treated EB cells (A through F) or control EB cells (G and H) and stained for lacZ, laminin, and lotus tetragonobulus agglutinin (LTA) binding. (A) Whole-mount lacZ staining of tubule shows lacZ-positive cells at the developing glomerular/proximal tubule (PT) junction. Arrows point to glomerular tufts. (B) Laminin staining of same tissue as in A. (C and D) Co-localization of lacZ-positive cells in developing PT (arrows) that also stain with LTA lectin (green) and are surrounded by laminin-containing basement membranes (red). (E and F) Another developing PT derived from RA7-treated EB cells (arrow) stained as above. (G and H) Many control EB cells localize to interstitial and peripheral mesenchyme (arrows), although a small number of lacZ-positive cells are also found in tubules.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this report, we examine the ability of ES cells to differentiate into the renal progenitor cells of the intermediate mesoderm. A combination of RA, Activin-A, and Bmp7 effectively induced the expression of intermediate mesodermal markers in EB. These data are consistent with the observation that both RA and Activin can induce pronephric markers in the Xenopus animal cap assay (12). Although the EB are still a heterogeneous mixture of cells, many expressed more differentiated markers found in the derivatives of the metanephric mesenchyme when treated with RA7. Furthermore, when placed into the environment of a developing kidney rudiment, these EB cells could generate tubules with very high efficiency, at least some of which expressed PT markers. Thus, we believe that pretreatment of EB with the RA7 nephrogenic cocktail, although not generating true epithelial cells in vitro, predisposes the EB cells to differentiate along the renal epithelial lineage similar to the potential of the intermediate mesoderm.

The metanephric mesenchyme by itself does not form tubules unless induced by the ureteric bud or a heterologous inducer, such as spinal cord or exogenous Wnt proteins (22). Pax2 expression in the mesenchyme is essential for enabling these mesenchymal cells to respond to inductive signals (23). Although few tubules are observed in the EB that are cultured with the RA7 nephrogenic cocktail, many Pax2-positive tubules are observed after these EB are co-cultured with embryonic spinal cord. These data suggest that the treated EB are primed to respond to inductive signals, similar to the metanephric mesenchyme. Furthermore, once injected into a developing kidney rudiment, RA7-pretreated cells were found exclusively in epithelial tubules. We also observed that untreated EB cells can contribute to kidney tubules in the absence of any pretreatment. After untreated EB cells were injected into kidney rudiments, the mean area of lacZ-positive tubules was approximately 40% of the total lacZ-positive area in a kidney section. Given that the epithelial cells are in general much larger than the less differentiated, nonepithelial component, the number of cells that contribute to tubules is likely to be even less than 40%. Steenhard et al. (5) showed that undifferentiated ES cells were capable of integrating into a developing kidney with approximately 50% efficiency. In these experiments, ES were not allowed to form EB and thus may retain more plasticity. Clearly, the environment of the developing kidney can direct differentiation even in the absence of any treatment.

Injection of RA7-primed EB cells into kidney organ cultures takes full advantage of an environment that is conducive to tubule formation. Just as the host metanephric mesenchymal cells are induced, form aggregates, and become polarized epithelia, the injected cells from treated EB are able to integrate into polarized epithelial tubules. However, a major concern regarding the cell injection experiments is the potential for cell fusion. This has been a contentious issue within the stem cell field, as some of the early reports of stem cell–derived tissue replacement may have been due to cell–cell fusion rather than differentiation and integration into the target tissue (24). One argument against cell fusion in our system is that we obtain less integration of ES-derived cells into tubules without the addition of exogenous factors. Terada et al. (25) showed that the spontaneous cell fusion in their study occurred at a very low rate, two to 11 clones per 106 bone marrow (BM)-derived cells. Compared with that rate, it is unlikely that the many lacZ-positive cells observed upon injection of 103 RA7-treated cells are due to cell fusion events, yet it is still formally possible that treatment of ES cells with cocktails of differentiation factors alters the potential of cells to fuse in the kidney rudiment system. We tested the issue of cell fusion with a genetic approach. The reporter ES cell line R26R-EYFP (26) contains a targeted insertion of enhanced yellow fluorescence protein (EYFP) into the ROSA26 locus, preceded by a loxP-flanked stop sequence. These ES cells were treated with the nephrogenic cocktail and microinjected into kidney rudiments that were isolated from Ksp-Cre transgenic mice (27), which express Cre recombinase in the some but not all kidney epithelia. Cell fusion of R26R-EYFP with Cre-expressing host cells should activate the fluorescence marker. After injection of eight Ksp-Cre transgenic kidney rudiments, we did not observe a single EYFP-expressing cell in live or fixed cultures, suggesting little to no cell fusion with host tubules at this level of detection (data not shown).

The ability to differentiate ES cells along certain lineage pathways may provide an unlimited source of stem cells for a variety of applications. In the kidney, PT cells can regenerate after toxic or ischemic injury, yet despite many advances in understanding the cell physiology of acute renal failure, the high frequency of mortality in the clinical setting has not dipped significantly below 50% (28). The apparent rate-limiting step in the ability of patients to recover from acute tubular necrosis (ATN) is the regeneration of the PT. Recent reports have demonstrated BM-derived PT cells in mice that were subjected to ischemia-reperfusion (29,30) and cisplatin treatment (31). In these experiments, the majority of regenerated PT cells seemed to be derived from donor BM stem cells that were injected intravenously after injury, yet in three independent studies using either the folic acid model of ATN (32) or the ischemia model (33,34), regenerated PT cells that were derived from BM months after transplantation were not observed with any significant frequency. However, in one study, human mesenchymal stem cells that were derived from BM were able to become incorporated into a developing kidney in culture (35). Given the conflicting results obtained with BM-derived stem cells, it seems appropriate to try other cell-based therapies, including cells derived from the only true pluripotential cell, the ES cell. Furthermore, cell-based dialysis machines, or bioartificial kidneys, are currently undergoing clinical trials for ATN (14). As promising as such devices may be, they suffer from the limitations of available cell sources for seeding the filtration barriers, high manufacturing costs, and limited storage potential. Thus, it seems prudent to try to develop new sources of potential PT precursors that could be infused rapidly into patients, shortly after suffering renal damage, or could be used for improved bioartificial dialysis. Our finding that ES cells can give rise to an unlimited and economically viable source of PT precursor cells may provide a starting point for developing new cell-based therapies in the treatment of chronic and acute renal disease.


    Acknowledgments
 
This project was supported by a fellowship from the American Foundation for Urologic Disease to D.K. and National Institutes of Health grants DK054740 and DK069689 to G.R.D.

We thank F. Costantini for the R26R-EYFP ES cells, P. Soriano for the Rosa26 ES cells, and K.S. O’Shea for initial help with the generation of EB.


    Footnotes
 
Supplemental information for this article is available online at http://www.jasn.org/


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lumelsky N, Blondel O, Laeng P, Velasco I, Ravin R, McKay R: Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science292 :1389 –1394,2001[Abstract/Free Full Text]
  2. Kania G, Blyszczuk P, Czyz J, Navarrete-Santos A, Wobus AM: Differentiation of mouse embryonic stem cells into pancreatic and hepatic cells. Methods Enzymol365 :287 –303,2003[CrossRef][Medline]
  3. Wichterle H, Lieberam I, Porter JA, Jessell TM: Directed differentiation of embryonic stem cells into motor neurons. Cell110 :385 –397,2002[CrossRef][Medline]
  4. Daley GQ: From embryos to embryoid bodies: Generating blood from embryonic stem cells. Ann N Y Acad Sci996 :122 –131,2003[Medline]
  5. Steenhard BM, Isom KS, Cazcarro P, Dunmore JH, Godwin AR, St John PL, Abrahamson DR: Integration of embryonic stem cells in metanephric kidney organ culture. J Am Soc Nephrol16 :1623 –1631,2005[Abstract/Free Full Text]
  6. Dressler GR: Development of the excretory system. In: Mouse Development: Patterning, Morphogenesis, and Organogenesis, edited by Rossant J, Tam PT, San Diego, Academic Press,2002 , pp395 –420
  7. Bouchard M, Souabni A, Mandler M, Neubuser A, Busslinger M: Nephric lineage specification by Pax2 and Pax8. Genes Dev16 :2958 –2970,2002[Abstract/Free Full Text]
  8. Mauch TJ, Yang G, Wright M, Smith D, Schoenwolf GC: Signals from trunk paraxial mesoderm induce pronephros formation in chick intermediate mesoderm. Dev Biol220 :62 –75,2000[CrossRef][Medline]
  9. Herzlinger D, Koseki C, Mikawa T, al-Awqati Q: Metanephric mesenchyme contains multipotent stem cells whose fate is restricted after induction. Development114 :565 –572,1992[Abstract]
  10. Yu J, McMahon AP, Valerius MT: Recent genetic studies of mouse kidney development. Curr Opin Genet Dev14 :550 –557,2004[CrossRef][Medline]
  11. Bouchard M: Transcriptional control of kidney development. Differentiation72 :295 –306,2004[CrossRef][Medline]
  12. Osafune K, Nishinakamura R, Komazaki S, Asashima M: In vitro induction of the pronephric duct in Xenopus explants. Dev Growth Differ44 :161 –167,2002[CrossRef][Medline]
  13. Carroll TJ, Vize PD: Synergism between Pax-8 and lim-1 in embryonic kidney development. Dev Biol214 :46 –59,1999[CrossRef][Medline]
  14. Fissell WH, Humes HD: Cell therapy of renal failure. Transplant Proc35 :2837 –2842,2003[CrossRef][Medline]
  15. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol132 :365 –386,2000[Medline]
  16. Wiles MV, Johansson BM: Analysis of factors controlling primary germ layer formation and early hematopoiesis using embryonic stem cell in vitro differentiation. Leukemia11[Suppl 3] :454 –456,1997
  17. Wiles MV, Johansson BM: Embryonic stem cell development in a chemically defined medium. Exp Cell Res247 :241 –248,1999[CrossRef][Medline]
  18. Ariizumi T, Asashima M: In vitro induction systems for analyses of amphibian organogenesis and body patterning. Int J Dev Biol45 :273 –279,2001[Medline]
  19. Davies JA, Fisher CE: Genes and proteins in renal development. Exp Nephrol10 :102 –113,2002[CrossRef][Medline]
  20. Fuhrmann G, Chung AC, Jackson KJ, Hummelke G, Baniahmad A, Sutter J, Sylvester I, Scholer HR, Cooney AJ: Mouse germline restriction of Oct4 expression by germ cell nuclear factor. Dev Cell1 :377 –387,2001[CrossRef][Medline]
  21. Cho EA, Patterson LT, Brookhiser WT, Mah S, Kintner C, Dressler GR: Differential expression and function of cadherin-6 during renal epithelium development. Development125 :4806 –4815,1998
  22. Kispert A, Vainio S, McMahon AP: Wnt-4 is a mesenchymal signal for epithelial transformation of metanephric mesenchyme in the developing kidney. Development125 :4225 –4234,1998[Abstract]
  23. Brophy PD, Ostrom L, Lang KM, Dressler GR: Regulation of ureteric bud outgrowth by Pax2-dependent activation of the glial derived neurotrophic factor gene. Development128 :4747 –4756,2001[Abstract/Free Full Text]
  24. Ying QL, Nichols J, Evans EP, Smith AG: Changing potency by spontaneous fusion. Nature416 :545 –548,2002[CrossRef][Medline]
  25. Terada N, Hamazaki T, Oka M, Hoki M, Mastalerz DM, Nakano Y, Meyer EM, Morel L, Petersen BE, Scott EW: Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature416 :542 –545,2002[CrossRef][Medline]
  26. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, Costantini F: Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol1 :4 ,2001[CrossRef][Medline]
  27. Shao X, Somlo S, Igarashi P: Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract. J Am Soc Nephrol13 :1837 –1846,2002[Abstract/Free Full Text]
  28. Liu KD: Molecular mechanisms of recovery from acute renal failure. Crit Care Med31 :S572 –581,2003[CrossRef][Medline]
  29. Lin F, Cordes K, Li L, Hood L, Couser WG, Shankland SJ, Igarashi P: Hematopoietic stem cells contribute to the regeneration of renal tubules after renal ischemia-reperfusion injury in mice. J Am Soc Nephrol14 :1188 –1199,2003[Abstract/Free Full Text]
  30. Kale S, Karihaloo A, Clark PR, Kashgarian M, Krause DS, Cantley LG: Bone marrow stem cells contribute to repair of the ischemically injured renal tubule. J Clin Invest112 :42 –49,2003[CrossRef][Medline]
  31. Morigi M, Imberti B, Zoja C, Corna D, Tomasoni S, Abbate M, Rottoli D, Angioletti S, Benigni A, Perico N, Alison M, Remuzzi G: Mesenchymal stem cells are renotropic, helping to repair the kidney and improve function in acute renal failure. J Am Soc Nephrol15 :1794 –1804,2004[Abstract/Free Full Text]
  32. Szczypka MS, Westover AJ, Clouthier SG, Ferrara JL, Humes HD: Rare incorporation of bone marrow-derived cells into kidney after folic acid-induced injury. Stem Cells23 :44 –54,2005[Abstract/Free Full Text]
  33. Lin F, Moran A, Igarashi P: Intrarenal cells, not bone marrow-derived cells, are the major source for regeneration in postischemic kidney. J Clin Invest115 :1756 –1764,2005[CrossRef][Medline]
  34. Duffield JS, Park KM, Hsiao LL, Kelley VR, Scadden DT, Ichimura T, Bonventre JV: Restoration of tubular epithelial cells during repair of the postischemic kidney occurs independently of bone marrow-derived stem cells. J Clin Invest115 :1743 –1755,2005[CrossRef][Medline]
  35. Yokoo T, Ohashi T, Shen JS, Sakurai K, Miyazaki Y, Utsunomiya Y, Takahashi M, Terada Y, Eto Y, Kawamura T, Osumi N, Hosoya T: Human mesenchymal stem cells in rodent whole-embryo culture are reprogrammed to contribute to kidney tissues. Proc Natl Acad Sci U S A102 :3296 –3300,2005[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
DevelopmentHome page
E. Preger-Ben Noon, H. Barak, N. Guttmann-Raviv, and R. Reshef
Interplay between activin and Hox genes determines the formation of the kidney morphogenetic field
Development, June 15, 2009; 136(12): 1995 - 2004.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Rosines, R. V. Sampogna, K. Johkura, D. A. Vaughn, Y. Choi, H. Sakurai, M. M. Shah, and S. K. Nigam
Staged in vitro reconstitution and implantation of engineered rat kidney tissue
PNAS, December 26, 2007; 104(52): 20938 - 20943.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
E. Lazzeri, C. Crescioli, E. Ronconi, B. Mazzinghi, C. Sagrinati, G. S. Netti, M. L. Angelotti, E. Parente, L. Ballerini, L. Cosmi, et al.
Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3128 - 3138.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Reggiani, D. Raciti, R. Airik, A. Kispert, and A. W. Brandli
The prepattern transcription factor Irx3 directs nephron segment identity
Genes & Dev., September 15, 2007; 21(18): 2358 - 2370.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Vigneau, K. Polgar, G. Striker, J. Elliott, D. Hyink, O. Weber, H.-J. Fehling, G. Keller, C. Burrow, and P. Wilson
Mouse Embryonic Stem Cell-Derived Embryoid Bodies Generate Progenitors That Integrate Long Term into Renal Proximal Tubules In Vivo
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1709 - 1720.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
D. Kim, M. Wang, Q. Cai, H. Brooks, and G. R. Dressler
Pax Transactivation-Domain Interacting Protein Is Required for Urine Concentration and Osmotolerance in Collecting Duct Epithelia
J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1458 - 1465.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
K. L. Price, D. A. Long, N. Jina, H. Liapis, M. Hubank, A. S. Woolf, and P. J. D. Winyard
Microarray interrogation of human metanephric mesenchymal cells highlights potentially important molecules in vivo
Physiol Genomics, January 17, 2007; 28(2): 193 - 202.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. H. Little
Regrow or Repair: Potential Regenerative Therapies for the Kidney
J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2390 - 2401.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Sagrinati, G. S. Netti, B. Mazzinghi, E. Lazzeri, F. Liotta, F. Frosali, E. Ronconi, C. Meini, M. Gacci, R. Squecco, et al.
Isolation and Characterization of Multipotent Progenitor Cells from the Bowman's Capsule of Adult Human Kidneys
J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2443 - 2456.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
ASN.2005050544v1
16/12/3527    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, D.
Right arrow Articles by Dressler, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, D.
Right arrow Articles by Dressler, G. R.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP