* First and Third Departments of Internal Medicine, Miyazaki Medical College, University of Miyazaki, Miyazaki, Japan
Address correspondence to: Dr. Masao Kikuchi, First Department of Internal Medicine, Miyazaki Medical College, University of Miyazaki, Kihara 5200, Kiyotake, Miyazaki, 889-1692 Japan. Phone: +81-985-85-1510; Fax: +81-985-85-6596; E-mail: mkikuchi{at}fc.med.miyazaki-u.ac.jp
Uroguanylin induces natriuresis and diuresis in vivo as wellas in vitro and is found mainly in the intestine and the kidney.However, the roles of uroguanylin in nephrotic syndrome, whichis associated with sodium and water retention, have not beendetermined. Therefore, changes in the urine and plasma concentrationof immunoreactive uroguanylin (ir-uroguanylin) and its mRNAexpression in the kidney and intestine were examined using ratswith puromycin aminonucleoside (PAN)-induced nephrosis. MaleSprague-Dawley rats were separated into control and nephroticgroups, and then the urinary excretion of sodium, protein, andir-uroguanylin was examined over time. The plasma levels andrenal and intestinal mRNA expression of uroguanylin at the periodsof sodium retention and remarkable natriuresis also were evaluated.The sequential changes of urinary ir-uroguanylin excretion inthe nephrotic group were similar to those of urinary sodiumexcretion. When the urinary excretion of ir-uroguanylin andsodium peaked, the plasma level of ir-uroguanylin also increasedcompared with that of the control group. Uroguanylin mRNA expressionin the kidney increased during the period of sodium retentionand then decreased during the period of remarkable natriuresis.Uroguanylin mRNA expression in the small intestines of controland nephrotic rats were identical. However, in a unilateralPAN-induced proteinuria, uroguanylin expression significantlyincreased in the PAN-perfused kidney compared with that in theopposite kidney. Considering the natriuretic effect of uroguanylin,these results suggested that uroguanylin plays an importantrole as a natriuretic factor in nephrotic syndrome via boththe circulation and the kidney itself.
Uroguanylin is a small peptide that activates transmembraneguanylate cyclase (GC) C, influences cellular function via intracellularcyclic guanosine monophosphate (cGMP) (1), and induces the urinaryexcretion of sodium and water in isolated perfused rat kidneys(2) and in mice in vivo (3). Uroguanylin and guanylin are majorhormones in one family of cGMP agonists, whereas atriopeptins(atrial natriuretic peptide [ANP], brain natriuretic peptide,and C-type natriuretic peptide) are a separate and distinctfamily of peptides that act on different GC (GC-A, -B) to signalvia cGMP. We reported that uroguanylin excretion into the urineis increased in humans and rats on a high-salt diet comparedwith those on a low-salt diet (4,5), indicating that uroguanylinfunctions as an intestinal natriuretic peptide. Moreover, uroguanylinlevels are increased in the circulation of patients with renaldisease and congestive heart failure (6,7). Forte et al. (8)suggested that uroguanylin participates in the physiologic maintenanceof the sodium balance. However, how uroguanylin functions inthe pathophysiologic mechanism of nephrotic syndrome, a conditionassociated with sodium and water retention, remains obscure.The present study examined serial changes in the urine and plasmaconcentration of immunoreactive uroguanylin (ir-uroguanylin)and the renal expression of uroguanylin in rats with nephrosisinduced by puromycin aminonucleoside (PAN). We also compareduroguanylin expression between a PAN-perfused kidney and itsnormal counterpart in the same milieu using a unilateral modelof PAN-induced nephrosis.
PAN-Induced Nephrosis
Male Sprague-Dawley rats that weighed 160 to 180 g were housedin a temperature- and light-controlled environment with a 12:12-hlight/dark cycle and then placed in individual metabolic cages1 d before starting the experiments. The animals were randomizedinto control and nephrotic groups; the latter received a singleintraperitoneal injection of PAN (Sigma, St. Louis, MO) at adose of 150 mg/kg body wt, dissolved in saline (day 1). Controlrats received an injection of an equivalent volume of vehicle.Nephrotic rats were allowed free access to standard rat chow(Nihon CLEA, Tokyo, Japan) and water throughout the study, whereaspair-fed control animals had free access to water but were fedwith the mean daily intake of the corresponding nephrotic rats.Urinary sodium, protein, and creatinine were measured in 24-hurine samples by indirect potentiometry using an automatic analyzerwith ion-selective electrodes, by colorimetric reactions usingpyrogallol red, and by the enzymatic assay, respectively. Ondays 4, 7, and 8, we killed seven animals from each group bycervical dislocation for blood sampling and mRNA studies. Weavoided differences in the circadian expression of uroguanylinby standardizing the experimental schedule for both groups.
Unilateral PAN-Induced Proteinuria
Unilateral proteinuria was induced by selective perfusion ofthe left kidney using 15 mg of PAN in 1.5 ml of saline as detailedby Hoyer et al. (9). Seven days later, anesthesia was inducedby an intraperitoneal injection of 50 mg/kg body wt pentobarbital,and the right external jugular vein was cannulated. The ureterswere cannulated with polyethylene no. 10 tubing, and urine fromeach kidney was collected. Normal saline was infused at a rateof 0.05 ml/min. Urinary sodium, protein, and creatinine weremeasured as described above, and then the bilateral kidneyswere resected for mRNA studies. All experiments described aboveproceeded according to the regulations established by the AnimalResearch Committee of Miyazaki Medical College.
Uroguanylin RIA
The uroguanylin RIA for plasma and urine proceeded as describedby Fukae et al. (5). This RIA specifically recognizes uroguanylinand prouroguanylin, both of which contain reduced and S-carboxymethylated(RCM) forms.
Characterization of Ir-Uroguanylin in Urine
Urine was obtained from three control and nephrotic rats. Eachurine sample was treated by the same method to gain the RCMpeptides and separately applied to Sep-Pak C-18 columns (WatersAssociates, Milford, MA), which were preequilibrated with 0.1%trifluoroacetic acid (TFA)-H2O. The columns were washed with15% acetonitril (CH3CN)-0.1% TFA-H2O, eluted with 60% CH3CN-0.1%TFA-H2O, and lyophilized. The lyophilized samples were reconstructedwith H2O and subjected to reverse-phase HPLC (RP-HPLC) on TSKODS SIL 120 A column (4.6 x 150 mm). A 10 to 60% linear gradientof CH3CN in 0.1% TFA-H2O was run for 60 min at a flow rate of1.0 ml/min. Corresponding 1-min samples were collected and lyophilized.The samples were reconstructed with RIA buffer and subjectedto the RIA. Synthetic rat RCM uroguanylin and prouroguanylinwere chromatographed under the same conditions.
ANP Measurement
Blood samples taken from seven rats per group on days 4, 7,and 8 were also measured for ANP immunoreactivity with a commerciallyavailable kit (Peninsula Laboratories, Belmont, CA).
Real-Time Reverse Transcriptase–PCR
Total RNA (5 µg) that was extracted using the Total RNAIsolation Reagent (Invitrogen, Carlsbad, CA) was reverse-transcribedusing SuperScript reverse transcriptase (Invitrogen) into cDNA.Rat uroguanylin mRNA levels were measured by Real-Time QuantitativePCR (Prism 7700 Sequence Detector; Applied Biosystems, FosterCity, CA) as described by the manufacturer, and the followingoligonucleotide probes were labeled with 6-carboxylfluoresceinas the reporter and 6-carboxytetramethyl-rhodamine as the quencher:ATCCCAGGAAGCTGCCAGCACCTT (nucleotides 264 to 287) for uroguanylinand TGACCACAGTCCATGCCATCACTGCCACTC (nucleotides 548 to 577)for glyceraldehyde-3-phosphate dehydrogenase (GAPDH.) ComplementaryDNA were amplified using the following pairs of oligonucleotides:TCCCCGATGTGTGCTACAAC (nucleotides 209 to 228, forward primer)and AGCCCGTACAGGCAACATTT (nucleotides 343 to 352, reverse primer)for uroguanylin and TCCTGCACCACCAACTGCTTAG (nucleotides 475to 496, forward primer) and CACAGCCTTGGCAGCACCAGT (nucleotides655 to 675, reverse primer) for GAPDH. Levels of uroguanylinmRNA were normalized to those of internal control GAPDH mRNA.All PCR products were verified once by sequencing, and all reactionsproceeded in duplicate.
Statistical Analyses
Results are expressed as means ± SEM. Differences betweentwo groups were evaluated using t test. Statistical significancewas established at P < 0.05.
PAN-Induced Nephrosis and Urinary Uroguanylin Figure 1A shows that the time course of PAN-induced nephrosisconsisted of three periods that were based on variations inurinary sodium excretion. During the first period between 2and 6 d after the PAN injection, urinary sodium excretion significantlydecreased. This phenomenon was not related to decreases in foodintake, because urinary sodium excretion in pair-fed controlrats was significantly higher during the same period. Urinarysodium excretion abruptly increased during the second periodfrom 8 to 9 d after the PAN injection and returned to the samelevels as the pair-fed control during the third period on day10. Proteinuria increased on day 4, which was 2 d after thereduction in urinary sodium excretion, and reached a plateauon day 8 (Figure 1C). Urinary ir-uroguanylin excretion startedto increase in the nephrotic group on day 4, rapidly increasedon day 7, peaked on day 8, and then gradually decreased (Figure 1B).Changes in body weights of control or nephrotic rats wereas follows: control (n = 6) versus nephrotic (n = 6) rats, day4, 214.3 ± 1.2 versus 219.3 ± 2.1 g (P = 0.053);day 7, 220.7 ± 0.7 versus 246.8 ± 6.2 g (P = 0.02).
Figure 1. Urinary excretion of sodium, immunoreactive uroguanylin (ir-uroguanylin), and protein in control and nephrotic male Sprague-Dawley rats. Time courses of urinary excretion of sodium (A), ir-uroguanylin (B), and protein (C) during 15 d after a single intraperitoneal injection of puromycin aminonucleoside (PAN; open symbols) or saline (filled symbols). Creatinine, protein, and sodium levels in 24-h urine samples. Results for day 0 correspond with those from 24-h urine samples collected 1 d before PAN or saline injection. Values are means ± SEM from six animals. *P < 0.05, t test.
Characterization of Ir-Uroguanylin in Urine
Uroguanylin molecules in control and nephrotic urine were analyzedby RP-HPLC coupled with RIA. Representative RP-HPLC profilesof molecules in the urine are shown in Figure 2. In nephroticurine, two major immunoreactive peaks were found, the main oneat elution position of rat RCM uroguanylin and the minor restat that of prouroguanylin.
Figure 2. Representative reverse phase HPLC profiles of uroguanylin immunoreactivity in urine of control and nephrotic rats. (A) Sample: 3 ml of urine from nephrotic rat. (B) Sample: 3 ml of urine from control rat. Black bars show uroguanylin immunoreactivity. Arrows indicate the elution positions of rat reduced and S-carboxymethylated uroguanylin (1) and prouroguanylin (2).
Uroguanylin mRNA Expression of Kidney and Intestine
We also evaluated uroguanylin expression in the kidney and intestineon days 4 and 7 or 8 as representative periods of sodium retentionand remarkable natriuresis, respectively. Uroguanylin mRNA levelsincreased in the kidneys of the nephrotic group compared withthe control group on day 4 (179.7 ± 41.8 versus 100 ±12.4%; n = 7; P < 0.05) but decreased on days 7 and 8 (35.4± 7.2 versus 100 ± 23.2%; n = 7; P < 0.01;Figure 3A). Intestinal levels did not significantly differ betweenthe groups (Figure 3B).
Figure 3. Changes in renal and intestinal uroguanylin mRNA expression in control and nephrotic groups on day 4 and on days 7 and 8. Columns, mean ± SEM of data from two separate quantitative reverse transcriptase–PCR (RT-PCR) reactions. *P < 0.05, t test.
Plasma Ir-Uroguanylin and ANP
Plasma levels of ir-uroguanylin in the nephrotic group weresignificantly higher than those in the control group on days4 and 7 or 8 (1887.4 ± 122.2 versus 936.5 ± 63.9fmol/ml [n = 7; P < 0.00001]; 3441.9 ± 594.4 versus1084.3 ± 43.8 fmol/ml [n = 7; P = 0.0019], respectively;Figure 4A). Plasma levels of ANP in the nephrotic group didnot differ from the control group on day 4 (124.7 ± 18.0versus 136.9 ± 28.4 pg/ml; n = 7; P = 0.36) but significantlyincreased on days 7 and 8 (240.0 ± 31.1 versus 102.7± 41.9 pg/ml; n = 7; P = 0.01; Figure 4B).
Figure 4. Changes in plasma ir-uroguanylin and atrial natriuretic peptide in control and nephrotic groups on day 4 and on days 7 and 8. Columns, mean ± SEM from five animals. *P < 0.05, t test.
Unilateral PAN-Induced Proteinuria
We studied an intrarenal mechanism of uroguanylin to be distinguishedfrom the effects of alterations in the systemic or circulatingfactors (ANP and plasma uroguanylin) by using the model of unilateralPAN-induced proteinuria. Uroguanylin mRNA expression increasedin the unilaterally PAN-perfused kidney compared with the nonperfusedcounterpart (164.6 ± 21.1 versus 100 ± 14.7%;n = 5; P < 0.05; Figure 5A). The excretion of ir-uroguanylinincreased in the PAN-perfused kidney compared with the oppositekidney (18.05 ± 2.43 versus 5.68 ± 0.83 nmol/mmol;n = 5; P = 0.0013; Figure 5B).
Figure 5. Renal uroguanylin mRNA expression and urinary excretion of ir-uroguanylin in unilateral PAN nephrosis. (A) Renal uroguanylin mRNA expression determined by quantitative RT-PCR in PAN-perfused and nonperfused kidneys. (B) Urinary excretion of protein, sodium, and ir-uroguanylin in PAN-perfused and nonperfused kidneys. Values are means ± SEM from five animals. *P < 0.05, t test.
Various peptides and chemical mediators involved in nephroticsyndrome have generally been evaluated using the model of PAN-inducednephrosis. In addition to proteinuria, urinary sodium excretionin PAN-induced nephrotic rats significantly differs from thatof controls (10). The time course of PAN-induced nephrosis consistsof sodium retention and remarkable natriuresis followed by natriuresisthat is comparable to controls. Uroguanylin has a natriureticactivity, the mRNA for which is expressed in many tissues ofthe body as well as the kidney and intestinal tract (11). Thepresent study established how uroguanylin levels vary and howuroguanylin mRNA is expressed in experimental nephrosis.
The pathogenesis of sodium retention in nephrotic syndrome remainssomewhat obscure. Ichikawa et al. (12) reported the importanceof intrarenal mechanisms in sodium retention in the unilateralPAN-induced nephrosis model. Investigators have proposed thata reduced GFR and glomerular coefficient, decreased tubule sensitivityto ANP through cGMP phosphodiesterase activation, and increasedtubular reabsorption through Na+/K+ ATPase activation are associatedwith sodium retention (10,13–17). The present study foundthat uroguanylin mRNA levels in the nephrotic kidney increasedduring the period of sodium retention but decreased during thenatriuretic phase. Thus, the values for urinary sodium excretionwere inversely correlated with uroguanylin mRNA expression levelsin the kidney. Furthermore, we identified the same relationshipin unilateral PAN nephrosis, in which model fractional sodiumexcretion was lower in the proteinuric than in the intact kidney(12). The effects of nephrosis on the kidney can be evaluateddirectly in this model, as the influence of systemic hemodynamicsand the humoral environment can be excluded. Therefore, ourfindings indicate that uroguanylin functions as an intrarenalresponse to sodium retention.
Remarkable natriuresis in PAN-induced nephrosis has not beenaddressed in depth. We found that the urinary ir-uroguanylinexcretion of nephrotic rats reached a maximum (approximatelymore than eightfold control levels) on day 8, when sodium excretionwas significantly higher than that of controls. Plasma levelsof ir-uroguanylin in the nephrotic group also increased on days7 and 8, in contrast to decreased uroguanylin expression inthe kidney. Therefore, the increased urinary ir-uroguanylinexcretion after day 7 or 8 seems to be derived mainly from theincreased plasma uroguanylin. Several laboratories, includingours, have shown that 10-kD prouroguanylin is the main molecularform of ir-uroguanylin in plasma (4,18), and it is a moleculesmaller than albumin (66 kD) (19), the main protein in the urineof the PAN-induced nephrotic rats (20). Filtered loads of low-molecular-weightproteins, in general, do not increase despite an increase inthe permeability of the glomerular barrier, because the glomerularsieving coefficient values for small proteins are high evenunder normal conditions (21). Decreased reabsorption in thetubules therefore may be the reason for the higher uroguanylinexcretion in the nephrotic group. Indeed, the result of characterizationof ir-uroguanylin in urine of the nephrotic group showed twoimmunoreactive peaks indicating its bioactive form and precursor.However, the former was more detected and the total amount ofuroguanylin bioactivity was increased as shown in Figure 2.Because uroguanylin has another cGMP-independent pathway unlikeANP (22) and downregulates the message for the Na+/K+ ATPase-subunit in mice (23), uroguanylin may be a candidate of natriureticfactor for nephrotic animals. However, ANP was previously suspectedto be a causative factor for sodium retention in nephrotic syndrome.At present, the nephrotic state is considered as a conditionof ANP resistance. The models with experimental nephrosis arecharacterized by no change or an increase in the plasma concentrationof ANP, with reference to the volume status. Each plasma ANPlevel at day 4 (no change) or days 7 and 8 (increase) seemedto reflect the volume status, considering the body weight ofrats at each point.
We previously reported that fluid retention in nephrotic patientscorrelates with changes in plasma ir-uroguanylin between admissionand remission, indicative that the plasma concentration increaseswith the severity of the nephrotic state (24). Considering thenatriuretic activity of uroguanylin, this observation indicatesthat uroguanylin plays an important role in the impaired saltexcretion associated with nephrotic syndrome. In this study,we examined uroguanylin mRNA expression in the heart on theassumption that enhanced cardiac expression is responsible forincreased plasma levels of ir-uroguanylin, because uroguanylinmRNA expression in both the kidney and the small intestine didnot increase. However, uroguanylin mRNA expression in the heartwas too low for comparing between both groups.
Previous studies revealed that uroguanylin acts as a renal regulatorof dietary salt intake, that is, an intestinal natriuretic hormone.Recently, increases in dietary NaCl were shown to raise uroguanylinmRNA levels in the kidney in addition to the intestine, suggestingthat both endocrine and paracrine/autocrine actions of uroguanylincould participate in maintaining sodium balance (5,25). Lorenzet al. (26) reported that BP is increased and that the natriureticresponse to enteral NaCl load is impaired in uroguanylin knockoutmice, and they suggested that uroguanylin plays a significantphysiologic role in the regulation of Na+ excretion from thekidney in addition to its likely role as a regulator of intestinalsecretion. The present study suggests that uroguanylin actsas a natriuretic factor also in the state with sodium/fluidretention, which was unrelated to enteral NaCl load. Furtherstudies may clarify the role of uroguanylin that governs bodysodium balance and BP as well as the other cGMP-regulating agonists,nitric oxide, and the atriopeptins (27).
Although uroguanylin could be involved in the pathophysiologyof PAN-treated rats as a natriuretic hormone, it is also possiblethat more fundamental mechanisms are involved. For example,it is becoming clear that uroguanylin regulates the turnoverof epithelial cells within the intestinal mucosa via activationof a cGMP signaling mechanism that elicits apoptosis of targetenterocytes (28). Thus, uroguanylin may have a direct effecton cellular proliferation at least in injury models and influencekidney repair mechanisms that are initiated by the treatmentof rats with the renal toxin.
In summary, we studied levels of uroguanylin in PAN-inducednephrosis, which is associated with sodium and water retention.Urinary ir-uroguanylin excretion and plasma levels of ir-uroguanylinin the nephrotic group peaked at the same time as urinary sodiumexcretion significantly increased compared with controls. Movementof urinary sodium excretion inversely correlated with uroguanylinmRNA expression levels in the kidney, suggesting that urinarysodium excretion regulates uroguanylin mRNA expression in thekidney. In conclusion, uroguanylin might participate in directingrenal sodium transport in the nephrotic kidney as an endocrineand as a paracrine/autocrine factor.
Acknowledgments
Part of this work was published as an abstract at the AmericanSociety of Nephrology 35th Annual Meeting.
We thank Dr. Akiko Baba for technical assistance.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
Forte LR, London RM, Freeman RH, Krause WJ: Guanylin peptides: Renal actions mediated by cyclic GMP.
Am J Physiol Renal Physiol 278
: F180
–F191, 2000[Abstract/Free Full Text]
Fonteles MC, Greenberg RN, Monteiro HSA, Currie MG, Forte LR: Natriuretic and kaliuretic activities of guanylin and uroguanylin in the isolated perfused rat kidney.
Am J Physiol 275
: F191
–F197, 1998
Greenberg RN, Hill M, Crytzer J, Krause WJ, Eber SL, Hamra FK, Forte LR: Comparison of effects of uroguanylin, guanylin, Escherichia coli heat-stable enterotoxin in mouse intestine and kidney: Evidence that uroguanylin is an intestinal natriuretic hormone
J Invest Med 45
: 276
–282, 1997[Medline]
Kinoshita H, Fujimoto S, Nakazato M, Yokota N, Date Y, Yamaguchi H, Hisanaga S, Eto T: Urine and plasma levels of uroguanylin and its molecular forms in renal disease.
Kidney Int 52
: 1028
–1034, 1997[Medline]
Fukae H, Kinoshita H, Fujimoto S, Kita T, Nakazato M, Eto T: Changes in urinary levels and renal expression of uroguanylin on low or high salt diets in rats.
Nephron 92
: 373
–378, 2002[CrossRef][Medline]
Carrithers SL, Eber SL, Forte LR, Greenberg RN: Increased urinary excretion of uroguanylin in patients with congestive heart failure.
Am J Physiol Heart Circ Physiol 278
: H538
–H547, 2000[Abstract/Free Full Text]
Nakazato M, Yamaguchi H, Kinoshita H, Kangawa K, Matsuo H, Chino N, Matsukura S: Identification of biologically active and inactive human uroguanylin in plasma and urine and their increases in renal insufficiency.
Biochem Biophys Res Commun 220
: 586
–593, 1996[CrossRef][Medline]
Forte LR, Fan X, Hamra FK: Salt and water homeostasis: Uroguanylin is a circulating peptide hormone with natriuretic activity.
Am J Kidney Dis 28
: 296
–304, 1996[Medline]
Hoyer JR, Mauer SM, Michael AF: Unilateral renal disease in the rat. Clinical, morphologic, and glomerular mesangial functional features of the experimental model produced by renal perfusion with aminonucleoside.
J Lab Clin Med 85
: 756
–768, 1975[Medline]
Deschenes G, Doucet A: Collecting duct Na+/K+-ATPase activity is correlated with urinary sodium excretion in rat nephrotic syndromes.
J Am Soc Nephrol 11
: 604
–615, 2000[Abstract/Free Full Text]
Fan X, Wang Y, London RM, Eber SL, Krause WJ, Freeman RH, Forte LR: Signaling pathways for guanylin and uroguanylin in the digestive, renal, central nervous, reproductive, and lymphoid systems.
Endocrinology 138
: 4636
–4648, 1997[Abstract/Free Full Text]
Ichikawa I, Rennke HG, Hoyer JR, Badr KF, Schor N, Troy JL, Lechene CP, Brenner BM: Role for intrarenal mechanisms in the impaired salt excretion of experimental nephrotic syndrome.
J Clin Invest 71
: 91
–103, 1983
Koomans HA: Pathophysiology of oedema in idiopathic nephrotic syndrome.
Nephrol Dial Transplant 18[Suppl 6]
: vi30
–vi32, 2003[Medline]
Perico N, Delaini F, Lupini C, Benigni A, Galbusera M, Boccardo P, Remuzzi G: Blunted excretory response to atrial natriuretic peptide in experimental nephrosis.
Kidney Int 36
: 57
–64, 1989[Medline]
Valentine JP, Ying WZ, Sechi LA, Ling KT, Qiu C, Couser WG, Humphreys MH: Phosphodiesterase inhibitors correct resistance to natriuretic peptides in rat with Heymann nephritis.
J Am Soc Nephrol 7
: 582
–593, 1996[Abstract]
Feraille E, Vogt B, Rousselot M, Barlet-Bas C, Cheval L, Doucet A, Favre H: Mechanism of enhanced Na-K-ATPase activity in cortical collecting duct from rats with nephrotic syndrome.
J Clin Invest 91
: 1295
–1300, 1993
Fan X, Hamra FK, Freeman RH, Eber SL, Krause WJ, Lim RW, Pace VM, Currie MG, Forte LR: Uroguanylin: Cloning of preprouroguanylin cDNA, mRNA expression in the intestine and heart and isolation of uroguanylin and prouroguanylin from plasma.
Biochem Biophys Res Commun 219
: 457
–462, 1996[CrossRef][Medline]
Sargent TD, Yang M, Bonner J: Nucleotide sequence of cloned rat serum albumin messenger RNA.
Proc Natl Acad Sci U S A 78
: 243
–246, 1981[Abstract/Free Full Text]
Pedraza-Chaverri J, Cruz C, Chavez MT, Lopez A, Ibarra-Rubio ME, Tapia E, Pena JC: Pathophysiology of experimental nephrotic syndrome induced by puromycin aminonucleoside in rats. II. In vitro release of renin, angiotensinogen and aldosterone.
Rev Invest Clin 42
: 120
–126, 1990[Medline]
Maack T, Park CH, Camargo MJF: Renal filtration, transport, and metabolism of proteins. In:
The Kidney: Physiology and Pathophysiology, Vol. 3, edited by Seldin DW, Giebisch G, New York, Raven Press, 1992
, pp 3005
–3038
Sindice A, Basoglu C, Cerci A, Hirsch JR, Potthast R, Kuhn M, Ghanekar Y, Visweswariah SS, Schlatter E: Guanylin, uroguanylin, and heat-stable euterotoxin activate guanylate cyclase C and/or a pertussis toxin-sensitive G protein in human proximal tubule cells.
J Biol Chem 277
: 17758
–17764, 2002[Abstract/Free Full Text]
Carrithers SL, Hill MJ, Johnson BR, O’Hara SM, Jackson BA, Ott CE, Lorenz J, Mann EA, Giannella RA, Forte LR, Greenberg RN: Renal effects of uroguanylin and guanylin in vivo.
Braz J Med Biol Res 32
: 1337
–1344, 1999[Medline]
Kinoshita H, Fujimoto S, Fukae H, Yokota N, Hisanaga S, Nakazato M, Eto T: Plasma and urine levels of uroguanylin, a new natriuretic peptide, in nephrotic syndrome.
Nephron 81
: 160
–164, 1999[CrossRef][Medline]
Potthast R, Ehler E, Scheving LA, Sindic A, Schlatter E, Kuhn M: High salt intake increases uroguanylin expression in mouse kidney.
Endocrinology 142
: 3087
–3097, 2001[Abstract/Free Full Text]
Lorenz JN, Nieman M, Sabo J, Sanford LP, Hawkins JA, Elitsur N, Gawenis LR, Clarke LL, Cohen MB: Uroguanylin knockout mice have increased blood pressure and impaired natriuretic response to enteral NaCl load.
J Clin Invest 112
: 1244
–1254, 2003[CrossRef][Medline]
Forte LR: A novel role for uroguanylin in the regulation of sodium balance.
J Clin Invest 112
: 1138
–1141, 2003[Medline]
Shailubhai K, Yu HH, Karunanandaa K, Wang JY, Eber SL, Wang Y, Joo NS, Kim HD, Miedema BW, Abbas SZ, Boddupalli SS, Currie MG, Forte LR: Uroguanylin treatment suppresses polyp formation in the ApcMin/+ mouse and induces apoptosis in human colon adenocarcinoma cells via cyclic GMP.
Cancer Res 60
: 5151
–5157, 2000[Abstract/Free Full Text]
Received for publication April 25, 2004.
Accepted for publication October 21, 2004.
Related Article
This Month’s Highlights
J. Am. Soc. Nephrol. 2005 16: 279-283.
[Full Text][PDF]
This article has been cited by other articles:
N. G. Moss, R. C. Fellner, X. Qian, S. J. Yu, Z. Li, M. Nakazato, and M. F. Goy Uroguanylin, an Intestinal Natriuretic Peptide, Is Delivered to the Kidney as an Unprocessed Propeptide
Endocrinology,
September 1, 2008;
149(9):
4486 - 4498.
[Abstract][Full Text][PDF]
A. Sindic and E. Schlatter Mechanisms of action of uroguanylin and guanylin and their role in salt handling
Nephrol. Dial. Transplant.,
November 1, 2006;
21(11):
3007 - 3012.
[Full Text][PDF]
A. Sindic and E. Schlatter Cellular Effects of Guanylin and Uroguanylin
J. Am. Soc. Nephrol.,
March 1, 2006;
17(3):
607 - 616.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
-subunit in mice (23), uroguanylin may be a candidate of natriuretic factor for nephrotic animals. However, ANP was previously suspected to be a causative factor for sodium retention in nephrotic syndrome. At present, the nephrotic state is considered as a condition of ANP resistance. The models with experimental nephrosis are characterized by no change or an increase in the plasma concentration of ANP, with reference to the volume status. Each plasma ANP level at day 4 (no change) or days 7 and 8 (increase) seemed to reflect the volume status, considering the body weight of rats at each point. 
