Journal of the American Society of Nephrology
2008 JASN IMPACT FACTOR 7.505 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


Published ahead of print on August 23, 2006
J Am Soc Nephrol 17: 2792-2798, 2006
© 2006 American Society of Nephrology
doi: 10.1681/ASN.2006020159

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
ASN.2006020159v1
17/10/2792    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, Y.-C.
Right arrow Articles by Yang, C.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, Y.-C.
Right arrow Articles by Yang, C.-W.

Pathophysiology of Renal Disease and Progression

Leptospiral Outer Membrane Protein Induces Extracellular Matrix Accumulation through a TGF-beta1/Smad-Dependent Pathway

Ya-Chung Tian*, Yung-Chang Chen*, Cheng-Chieh Hung*, Chiz-Tzung Chang*, Mai-Szu Wu*, Aled O. Phillips{dagger} and Chih-Wei Yang*

* Kidney Institute, Department of Nephrology, Chang Gung Memorial Hospital, Taipei, and Chang Gung University, Tao Yuan, Taiwan; and {dagger} Institute of Nephrology, Cardiff University, Wales, United Kingdom

Address correspondence to: Dr. Chih-Wei Yang, Kidney Institute, Department of Nephrology, Chang Gung Memorial Hospital, 199 Tun-Hwa North Road, Taipei 105, Taiwan. Phone: +886-3-3281200 ext. 8181; Fax: +886-3-3282173; E-mail: cwyang{at}adm.cgmh.org.tw

Received for publication February 21, 2006. Accepted for publication July 10, 2006.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Leptospirosis is an underestimated cause of renal failure in Taiwan and elsewhere. The consequence of leptospira-induced acute tubulointerstitial nephritis is tubulointerstitial fibrosis if left untreated. The aim of the study was to examine the effect of an outer membrane protein (OMP) of Leptospira santarosai serovar Shermani on extracellular matrix (ECM) accumulation in proximal tubular cells, HK-2 cells. The addition of Leptospira santarosai serovar Shermani OMP for 72 h led to an increase of type I and type IV collagens, measured by real-time PCR and Western blot analysis in a dose-response manner. After addition of Leptospira santarosai serovar Shermani OMP, active TGF-beta1 secretion was increased by nearly two-fold. The addition of anti–TGF-beta1–neutralizing antibodies attenuated the Leptospira santarosai serovar Shermani OMP–induced type I and type IV collagen production, implicating TGF-beta1 in this process. Overexpression of the dominant negative Smad3 prevented the Leptospira santarosai serovar Shermani OMP–induced increase of type I or type IV collagen production. In conclusion, this study clearly demonstrated the stimulatory effect of Leptospira santarosai serovar Shermani OMP on ECM production by enhancing ECM synthesis, which was mediated by a TGF-beta1/Smad-dependent pathway.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Leptospirosis that is caused by leptospiral infection is a fatal infectious disease of humans and animals and frequently leads to multiple-organ failure (1). One of the most commonly affected organs is the kidney. However, acute renal failure that is caused by leptospirosis usually is ignored, and the outcome may be fatal if severe leptospirosis is left untreated. We have demonstrated that leptospirosis is an underestimated cause of acute renal failure in Taiwan (2,3). Among pathogenic leptospira, Leptospira santarosai serovar Shermani is the main serovar encountered in Taiwan (4) and can colonize in the kidney after hematogenous dissemination. Through the effect of leptospira endotoxin and immunologic response, these organisms can cause tubulointerstitial nephritis (1,5). The consequence of tubulointerstitial nephritis that is caused by leptospiral infection is tubular atrophy and interstitial fibrosis if chronic leptospiral infection is untreated (6). In canine and rat leptospirosis, the disease may undergo a chronic course, leading to tubulointerstitial fibrosis and thus chronic renal failure (6,7). From human biopsy studies, chronic infection of leptospirosis has been shown to be associated with chronic interstitial nephritis and fibrosis (8). Recently, it was reported that leptospirosis led to irreversible tubulointerstitial fibrosis in a young male patient, who subsequently required chronic hemodialysis (9).

Leptospiral lipoproteins, the membrane component of leptospiral endotoxin that is associated with tubulointerstitial nephritic changes, have been found to be expressed in infected renal tubules and vascular lumen of the interstitium (10). We previously found that outer membrane protein (OMP) extracts from Leptospira santarosai serovar Shermani induced early inflammation through a Toll-like receptor 2 (TLR2) pathway and an increase of inflammatory cytokines and chemokines including inducible nitric oxide (iNOS), monocyte chemoattractant protein-1 (MCP-1), and TNF-{alpha}. Our previous findings provided in vitro evidence of the association between leptospiral infection and tubulointerstitial nephritis (11,12).

Tubulointerstitial fibrosis is characterized by excessive accumulation of extracellular matrix (ECM) proteins such as type I and IV collagens (13). During progression of tubulointerstitial fibrosis, the delicate balance between ECM synthesis and degradation is altered. As ECM synthesis is increased and ECM degradation simultaneously is reduced, ECM proteins accumulate in the interstitium. The degradation of ECM depends on the function of mainly metalloproteinases (MMP) and their inhibitors, tissue inhibitor of metalloproteinases (TIMP), which ensure adequate removal of damaged matrix components. Lines of evidence indicate that TGF-beta is a major culprit of renal fibrosis in a variety of in vivo and in vitro models (1416). It has been demonstrated that persistent overproduction of TGF-beta1 may lead to ECM accumulation through an increase of ECM synthesis and a decrease of ECM degradation by inducing TIMP production and inhibiting MMP activity (17,18).

TGF-beta1 exerts its diverse effects by binding to TGF-beta1 receptor II (TGF-beta1 RII), which subsequently phosphorylates serine/threonine residues of TGF-beta1 receptor I (TGF-beta1 RI or ALK5) (19,20). After phosphorylation, the activated TGF-beta1 RI can further activate downstream target proteins, receptor-activated Smad proteins (R-Smad), Smad2/3. Once activated, Smad2/3 complex recruits Smad4 to form a Smad2/3/4 complex, which finally enters the nucleus to activate target genes such as type I collagen, type IV collagen, and fibronectin (21,22), indicating a crucial role of the Smad signaling pathway in the ECM production. The aim of this study was to investigate the effect of Leptospira santarosai serovar Shermani OMP on ECM protein production using a renal proximal tubular cell culture system and to elucidate the mechanisms by which leptospira caused ECM accumulation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Preparation of OMP Extract of Leptospira
The method of extraction of Leptospira santarosai serovar Shermani OMP has been described previously (23). Briefly, a frequently encountered pathogenic leptospires serovar Leptospira santarosai serovar Shermani (ATCC number 43286) and a nonpathogenic Leptospira biflexa serovar Patoc (ATCC number 23582), were obtained from ATCC (Rockville, MD) and grown in 10% EMJH leptospiral enrichment medium (Difco, Detroit, MI). The OMP was extracted with 1% Triton X-114, 10 mM Tris (pH 8), and 1 mM EDTA at 4°C. After centrifugation, the Triton X-114 concentration in the supernatant was increased to 2%. Phase separation was performed by warming the supernatant to 37°C and subjecting it to centrifugation for 10 min at 2000 x g. The detergent and aqueous phases were separated and precipitated with acetone. The precipitant then was dissolved in water and quantified before further experiments. More than 90% of OMP could be extracted in the Triton X-114 detergent phase.

Cell Culture and Transfection
HK-2 cells, immortalized human renal proximal tubular cells, were cultured in DMEM/Ham’s F12 supplemented with 5% FCS, 2 mM glutamine, 20 mM HEPES buffer, 0.4 µg/ml hydrocortisone, 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml sodium selenite. The flag-tagged dominant negative Smad3 was a gift from Dr. Yu-Sun Chang (Biomedical Department, Chang-Gung University, Tao Yuan, Taiwan). To introduce the plasmid cDNA into cells, we used the Fugen-6 system (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s manual.

Real-Time PCR
The method of real-time PCR was described previously (24). Briefly, total RNA was isolated from HK-2 cells and reverse-transcribed to DNA. Real-time PCR was performed on an ABI-Prism 7700 using SYBR Green I as a double-stranded DNA-specific dye according to the manufacturer’s instructions (PE-Applied Biosystems, Cheshire, UK). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a standard housekeeping gene. Primers (human type IV collagen: forward TCAATCACTGTCTTGCCCCA, reverse ACTCTTTTGTGATGCACACCA; GAPDH: forward TTCCAGGAGCGAGATCCCT, reverse CACCCATGACGAACATGGG) were constructed to be compatible with a single reverse transcription–PCR thermal profile (95°C for 10 min, 40 cycles of 95°C for 30 s, and 60°C for 1 min). Accumulation of the PCR product was monitored in real time (PE-Applied Biosystems). Type IV collagen gene mRNA expression was expressed relative to GAPDH expression. Fold changes in gene expression in comparison with control were determined.

Western Blot Analysis
Total cellular protein extraction was performed as described previously (23). Equal amounts of proteins were mixed with the equal volume of reducing SDS sample buffer and boiled for 5 min at 95°C. Protein samples were resolved on a 10% SDS-PAGE and then electroblotted on nitrocellulose membranes (Bio-Rad, Hercules, CA). After electroblotting, nonspecific binding was blocked with 5% nonfat milk solution. The membrane then was incubated with primary antibodies overnight at 4°C followed by incubation with an horseradish peroxidase–conjugated secondary antibodies for 1 h at room temperature. Proteins were visualized using enhanced chemiluminescence (Amersham, Buckinghamshire, UK) as described previously (25).

Zymography
The conditioned medium was mixed with the nonreducing sample buffer and left at room temperature for 10 min. Electrophoresis was performed using 7.5% nonreducing SDS polyacrylamide gels that contained gelatin (1 mg/ml). The gels first were placed in 2.5% Triton at room temperature for 1 h and then incubated in the enzyme buffer that was composed of 50 mM Tris HCl (pH 7.6), 10 mM CaCl2, and 0.05% Brij overnight at 37°C. The presence of MMP-2 or MMP-9 activity shown as the zones of lysis was demonstrated by staining gels in 0.5% Coomassie Brilliant Blue.

ELISA
Total TGF-beta1 in the cell culture supernatant was measured by specific ELISA (R&D Systems, Minneapolis, MN) of conditioned cell culture supernatant samples. This assay has <1% cross-reactivity for TGF-beta2 and TGF-beta3. TGF-beta1 concentration was normalized to number of cells, determined by cell counting with a Hemocytometer. Data were expressed as pg TGF-beta1/ml per 105 cells.

Immunocytochemistry
Cells were fixed with 3% paraformaldehyde for 15 min at room temperature and subsequently were permeabilized with 0.2% Triton in PBS for 5 min at room temperature followed by incubation in 1% albumin in PBS at room temperature for 1 h. Subsequently, cells were incubated with rabbit anti-Smad3 antibodies at 4°C overnight and incubated with FITC-conjugated rabbit anti-mouse antibody at room temperature for 1 h. After washing with PBS, slides were mounted with fluorSave reagent (Calbiochem, Nottingham, UK).

Statistical Analyses
All of the data were presented as means ± SEM. Statistical analysis was performed using ANOVA with Tukey post hoc test. P < 0.05 was considered to represent a significant difference.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Leptospira Santarosai Serovar Shermani OMP Induced an Increase of Type I and Type IV Collagen Production
To assess whether pathogenic leptospira, Leptospira santarosai serovar Shermani, increased extracellular matrix production, we first assessed production of type I and type IV collagens in response to Leptospira santarosai serovar Shermani OMP in HK-2 cells. After addition of 0.01, 0.1, or 0.3 µg/ml of Leptospira santarosai serovar Shermani OMP in HK-2 cells for 72 h, Western blot analysis demonstrated a dose-dependent increase of type I collagen (Figure 1A) and type IV collagen (Figure 1B). A maximal increase of type I collagen and type IV collagen in response to Leptospira santarosai serovar Shermani OMP was detected when 0.1 or 0.3 µg/ml Leptospira santarosai serovar Shermani OMP was added. TGF-beta1–induced increase of type I and type IV collagens, which was in accordance with our previous study (21), was used as a positive control. To confirm the specificity of Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen, we added the OMP from a nonpathogenic serovar, Leptospira biflexa serovar Patoc, to HK-2 cells. In contrast to Leptospira santarosai serovar Shermani OMP, Leptospira biflexa serovar Patoc OMP did not result in an increase of type IV collagen (Figure 2A).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. The increase of types IV and I collagen production induced by Leptospira santarosai serovar Shermani outer membrane protein (OMP). HK-2 cells were grown to confluence and then serum-deprived for 2 d. HK-2 cells subsequently were grown in the absence (C) or presence of various concentrations (0.01, 0.1, or 0.3 µg/ml) of Leptospira santarosai serovar Shermani OMP (as indicated) under serum-free conditions for 3 d. TGF-beta1 (10 ng/ml) was added to HK-2 cells under serum-free conditions for 3 d as positive control. Supernatants were collected and subjected to Western blot analysis for type I collagen (A) and type IV collagen (B). One representative experiment of at least three individual replicate experiments is shown.

 

Figure 2
View larger version (27K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. The increase of type IV collagen production that specifically is induced by Leptospira santarosai serovar Shermani OMP. HK-2 cells were grown to confluence and serum-deprived for 48 h. (A) Leptospira santarosai serovar Shermani (LS; lane 2; 0.1 µg/ml) or nonpathogenic Leptospira biflexa serovar Patoc OMP (LP; lane 3; 0.1 µg/ml) was added to growth-arrested HK-2 cells under serum-free conditions for 3 d. In the control experiments, HK-2 cells were grown in the serum-free condition only for 3 d (C). (B) Leptospira santarosai serovar Shermani OMP (0.1 µg/ml) was inactivated by boiling (100°C) for 30 min or treatment with proteinase K (10 mg/ml) at 37°C for 30 min. Subsequently, growth-arrested HK-2 cells were incubated in the absence (C) or presence of nontreated (LS), heat-treated (heated LS), or proteinase K–treated Leptospira santarosai serovar Shermani OMP in the serum-free condition for 3 d. Type IV collagen in the supernatant of culture was measured by Western blot analysis. One representative experiment of at least three individual replicate experiments is shown.

 
We previously demonstrated that the lipoprotein was the major component of Leptospira santarosai serovar Shermani OMP corresponding to the increase of MCP-1 and TNF-{alpha} as Leptospira santarosai serovar Shermani OMP that was inactivated by pretreatment with the heat or proteinase K was unable to induce correspondence to the increase of type IV collagen. In our study, Leptospira santarosai serovar Shermani OMP (0.1 µg/ml) was inactivated by boiling (100°C) for 30 min or treatment with proteinase K (10 mg/ml) at 37°C for 30 min. HK-2 cells then were incubated in the medium that contained the heat- or proteinase K–treated Leptospira santarosai serovar Shermani OMP for 72 h. Western blot analysis showed that neither the heat- nor proteinase K–treated Leptospira santarosai serovar Shermani OMP led to an increase of type IV collagen (Figure 2B), suggesting that the active component of the Leptospira santarosai serovar Shermani OMP was heat labile and digestible by proteinase K.

Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type IV Collagen Was Associated with the Induction of Its Gene Expression
To determine whether the increase of type IV collagen that was stimulated by Leptospira santarosai serovar Shermani OMP involved an enhancement of gene expression, we used real-time PCR to assess type IV collagen gene expression. Real-time PCR revealed that addition of Leptospira santarosai serovar Shermani OMP (0.1 µg/ml) for 48 h in HK-2 cells led to an increased expression of type IV collagen mRNA (Figure 3). The deposition of matrix proteins is a dynamic process that involves a balance of synthesis and degradation of these proteins. To address whether the Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen production was associated with a decrease of type IV collagen degradation, we performed zymography to assess alteration of gelatinases. After addition of Leptospira santarosai serovar Shermani OMP (0.1 or 0.3 µg/ml) for 3 d, zymography did not detect a difference in MMP-9 (Figure 4) and MMP-2 (data not shown) expression when compared with that of the control. Similarly, the addition of Leptospira santarosai serovar Shermani OMP for 3 d did not cause alteration of TIMP-1 and TIMP-2 secretion as measured by Western blot analysis (data not shown). These results suggested that ECM degradation was not implicated in the Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen.


Figure 3
View larger version (7K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. An increase of type IV collagen mRNA expression that is induced by Leptospira santarosai serovar Shermani OMP. Confluent HK-2 cells were serum-deprived for 2 d followed by incubation in the absence (C) or presence (LS) of 0.1 or 0.2 µg/ml Leptospira santarosai serovar Shermani OMP for an additional 48 h. Subsequently, type IV collagen mRNA expression was quantified by real-time PCR as described in Materials and Methods. Results were expressed as the relative fold increase of type IV collagen mRNA expression over that of the untreated group and represented as mean ± SEM of triplicate measurements from three independent experiments (*P < 0.01 versus the control group).

 

Figure 4
View larger version (18K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Zymography assay showing no alteration of metalloproteinase-9 (MMP-9) by addition of Leptospira santarosai serovar Shermani OMP. HK-2 cells were grown to confluence and then serum-deprived for 2 d. HK-2 cells subsequently were grown in the absence (C) or presence of various concentrations (0.1 or 0.3 µg/ml) of Leptospira santarosai serovar Shermani OMP (as indicated) under serum-free conditions for 3 d. TGF-beta1 (10 ng/ml) was added to HK-2 cells under serum-free conditions for 3 d as positive control. Supernatant samples were collected, and MMP-9 activity was assessed by substrate zymography.

 
Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type I and Type IV Collagens Was Mediated through the Increase of TGF-beta1 Secretion
TGF-beta1 has evolved as the most essential profibrogenic mediator in the accumulation of ECM proteins. To clarify whether TGF-beta1 was involved in the Leptospira santarosai serovar Shermani OMP-induced increase of ECM proteins, we first assessed secretion of the active form of TGF-beta1 after stimulation of Leptospira santarosai serovar Shermani OMP. After addition of 0.2 µg/ml Leptospira santarosai serovar Shermani OMP to HK-2 cells for 3 d, secretion of the active form of TGF-beta1 as measured by ELISA was significantly increased when compared with that of the nonstimulated control (374.8 ± 13.6 versus 239.6 ± 12.1 pg/105 cells; P < 0.001; n = 6) and the Leptospira biflexa serovar Patoc OMP (374.8 ± 13.6 versus 267.0 ± 6.6 pg/105 cells; P < 0.001; n = 6), respectively (Figure 5). In contrast, the increase of TGF-beta1 secretion that was induced by the Leptospira biflexa serovar Patoc OMP was not significantly different from that of the nonstimulated control (267.0 ± 6.6 versus 239.6 ± 12.1 pg/105 cells; P = 0.173; n = 6; Figure 5). To confirm further the importance of TGF-beta1 in the Leptospira santarosai serovar Shermani OMP-induced increase of ECM proteins, we pretreated HK-2 cells with anti–TGF-beta1–neutralizing antibodies to abrogate TGF-beta1 function 30 min before administration of Leptospira santarosai serovar Shermani OMP. Western blot analysis showed that the addition of anti–TGF-beta1–neutralizing antibodies led to the abrogation of the Leptospira santarosai serovar Shermani OMP (0.2 µg/ml)-mediated increase of type I collagen (Figure 6A) and type IV collagen (Figure 6B) in a dose-dependent manner (0.5 and 1 µg/ml). The addition of 1 µg/ml anti–TGF-beta1–neutralizing antibodies resulted in nearly complete blockade of the Leptospira santarosai serovar Shermani OMP-induced increase of type I collagen and type IV collagen. These data indicate that Leptospira santarosai serovar Shermani OMP stimulated secretion of active TGF-beta1, then led to the increased production of type I and type IV collagens.


Figure 5
View larger version (8K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. An increase of TGF-beta1 secretion by addition of Leptospira santarosai serovar Shermani OMP. Confluent HK-2 cells were serum-deprived for 2 d. Growth-arrested HK-2 cells then were incubated in the absence or presence of 0.1 µg/ml LS or LP under serum-free conditions for 3 d. Subsequently, the supernatant was collected for determination of TGF-beta1 by ELISA, and the number of the remaining monolayer of HK-2 cells was counted. Results were expressed as TGF-beta1 pg of 105 cells and represent mean ± SEM of six individual experiments (P value as indicated).

 

Figure 6
View larger version (28K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. The inhibition of Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen production by neutralizing anti–TGF-beta1 antibody. Confluent HK-2 cells were growth-arrested by serum deprivation for 2 d. HK-2 cells then were treated with 0.5 or 1 µg/ml anti–TGF-beta1–neutralizing antibodies and followed by administration 0.1 µg/ml Leptospira santarosai serovar Shermani OMP under serum-free conditions for 3 d. Supernatants were collected and subjected to Western blot analysis for production of type I collagen (A) and type IV collagen (B).

 
Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type I and Type IV Collagens Was Associated with Activation of the Smad3 Signal
A TGF-beta downstream Smad signaling pathway has been implicated in the TGF-beta1–mediated ECM deposition (21,22). For confirmation of the indispensable role of the Smad signal activation in the Leptospira santarosai serovar Shermani OMP-mediated increase of type I and type IV collagen production, the dominant negative Smad3 was transiently overexpressed in the HK-2 cells followed by stimulation with Leptospira santarosai serovar Shermani OMP for 3 d. Western blot analysis demonstrated that when HK-2 cells were transfected with the empty vector, the addition of Leptospira santarosai serovar Shermani OMP still induced an increase of type I and type IV collagen production (Figure 7, A and B, lanes 1 and 2). In contrast, the Leptospira santarosai serovar Shermani OMP-induced increase of type I and type IV collagen production was abrogated by overexpression of the dominant negative Smad3 proteins in HK-2 cells (Figure 7, A through C, lanes 3 and 4), indicating that the Leptospira santarosai serovar Shermani OMP-stimulated increase of type I and type IV collagens required the Smad signaling pathway.


Figure 7
View larger version (34K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Abrogation of Leptospira santarosai serovar Shermani OMP-mediated increase of type I collagen and type IV collagen by overexpression of the dominant negative Smad3 proteins. HK-2 cells were grown to approximately 60 to 70% confluence followed by transient transfection with the empty vector (empty) or the flag-tagged dominant negative Smad3 vector (S3{Delta}C) for 18 h as described in Materials and Methods. Subsequently, the cells were incubated further in the serum-free medium in the absence or presence of 0.1 µg/ml LS for an additional 3 d. Supernatants were collected and subjected to Western blot analysis for production of type I collagen (A) and type IV collagen (B). The overexpression of the dominant negative Smad3 was confirmed by immunoblotting with anti-flag antibody (C).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
The renal proximal tubular cells are major targets of leptospires (26). In this study, we have shown that mouse renal proximal tubular cells produced inflammatory cytokines such as iNOS, MCP-1, and TNF-{alpha} in response to stimulation of Leptospira santarosai serovar Shermani OMP. In this study, we demonstrated that the administration of Leptospira santarosai serovar Shermani OMP to human renal proximal tubular cells led to an increase of type I and type IV collagen production, indicating that renal proximal tubular cells play a crucial role in the leptospira-induced tubulointerstitial fibrosis. Tubulointerstitial fibrosis is a major consequence of the leptospiral infection. Although several animal studies reveal that leptospiral infection results in interstitial collagen deposition and tubular basement membrane thickening (6), there is no in vitro study so far to clarify whether there is a direct correlation between leptospiral infection and the induction of collagen production. Our in vitro study provides direct evidence that leptospiral infection can elicit an enhanced production of an interstitial protein, type I collagen, as well as a basement membrane protein, type IV collagen, in renal proximal tubular cells, both of which are characteristics of renal fibrosis.

The leptospiral OMP are essential to determine the virulence of pathogenic leptospires. The most abundant proteins in the spirochetal outer membrane are lipoproteins that have been shown to be implicated in the pathogenesis of tubulointerstitial nephritis (27,28). Several studies have identified the complexity of these lipoproteins of the leptospiral outer membrane as important immunogens (2931). The OMP extraction method that we used in this study enriched lipoprotein components of leptospiral OMP. We previously demonstrated that heat and proteinase K treatment of leptospiral OMP extracts significantly reduced their effects on induction of iNOS and CCL2/MCP-1 expressions in renal tubule cells (12), suggesting that lipoproteins are main components in the leptospiral OMP extracts, corresponding to the induction of these inflammatory cytokines. Similarly, our study demonstrated that the heat- or proteinase K–treated Leptospira santarosai serovar Shermani OMP failed to induce the increase of type IV collagen production. Although we cannot exclude a role for contaminant leptospiral LPS in OMP preparations, our study clearly indicated that lipoproteins were major components responsible for the Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen production.

In this study, administration of the OMP from Leptospira santarosai serovar Shermani induced increased production of type IV collagen, whereas addition of the OMP from a nonpathogenic leptospira, Leptospira biflexa serovar Patoc, did not alter production of this collagen, confirming the specificity of the pathogenic role of Leptospira santarosai serovar Shermani in tubulointerstitial fibrosis. These findings were compatible with our previous report that Leptospira santarosai serovar Shermani is pathogenic in tubulointerstitial nephritis as Leptospira santarosai serovar Shermani but not Leptospira biflexa serovar Patoc and is able to promote expression of iNOS, MCP-1, and TNF-{alpha}.

Renal fibrosis that is characterized by ECM accumulation involves excessive production of newly synthesized ECM components as well as inadequate degradation and clearance of ECM components. In this study, expression of type IV collagen mRNA was upregulated by administration of Leptospira santarosai serovar Shermani OMP, whereas the levels of MMP-9 and TIMP-1/TIMP-2 (data not shown) were unchanged. These findings suggest that the Leptospira santarosai serovar Shermani OMP-induced type IV collagen resulted from new protein synthesis instead of inhibition of its degradation.

Several growth factors such as TGF-beta1 and endothelin-1 have been implicated in renal fibrosis. Recent evidence has suggested a fundamental role for TGF-beta1 as the most critical mediator in development of tubulointerstitial fibrosis. Many studies have demonstrated that TGF-beta1 can stimulate ECM production in different types of cells, including renal fibroblasts and tubular cells, and blocking TGF-beta1 by a variety of strategies such as administration of anti–TGF-beta1–neutralizing antibodies suppresses ECM generation. On the basis of our finding that administration of Leptospira santarosai serovar Shermani OMP led to the increase of type I and type IV collagen production and that Leptospira santarosai serovar Shermani OMP stimulated TGF-beta1 secretion, we postulated that the Leptospira santarosai serovar Shermani OMP-induced ECM accumulation was caused by the enhancement of TGF-beta1 secretion. This hypothesis was confirmed by the evidence that the Leptospira santarosai serovar Shermani OMP-mediated increase of type I and type IV collagens was abrogated by pretreatment of HK-2 cells with anti–TGF-beta1–neutralizing antibodies.

A Smad signaling pathway that transmits TGF-beta signals is thought to be indispensable in many TGF-beta–mediated cell functions (32,33). Several studies using different cell types have indicated clearly that the activation of Smad signals is required in the TGF-beta1–mediated increment of ECM proteins (34). To delineate the role of the Smad signaling pathway in the Leptospira santarosai serovar Shermani OMP-induced synthesis of type I and type IV collagens, overexpression of the dominant negative Smad3 was used to block the Smad signaling pathway. In this study, we found that overexpression of the dominant negative Smad3 in HK-2 cells inhibited the Leptospira santarosai serovar Shermani OMP-induced increase of type I and type IV collagens, suggesting that Smad3, a downstream mediator of TGF-beta1, plays a pivotal role in this process. Several studies have demonstrated that infection with microorganisms, including parasite, virus, and bacterium, leads to an increase of TGF-beta1 production in different cell types (3537). However, it is not clear that these infections can activate the TGF-beta downstream Smad signaling. Recently, Jono et al. (36) reported that Haemophilus influenzae infection can activate the Smad4 signaling and that the Haemophilus influenzae–induced increase of mucin production is mediated through the cooperation between the TGF-beta/Smad signaling pathway and the TLR2-dependent pathway in human respiratory and colon epithelial cells. Similarly, our study discloses that the Leptospira santarosai serovar Shermani OMP-induced increase of type I and type IV collagens is mediated through the TGF-beta1/Smad signaling pathway. Whether this reaction is coordinated with the TLR signaling pathway is under investigation.


    Conclusion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
This in vitro study is the first to provide direct evidence that leptospiral infection can promote ECM production. The Leptospira santarosai serovar Shermani OMP-induced ECM accumulation is regulated by enhancement of ECM synthesis instead of decrement of ECM degradation. This process is mediated by TGF-beta1 and its downstream Smad signaling pathway.


    Acknowledgments
 
This study was supported by grants NMRPG340721 and NMRPG330072 to Y.-C.T. from the National Science Council, Taiwan. A.O.P. is the recipient of a Glaxo Wellcome Senior Fellowship.

We thank Dr. Yu-Sun Chang (Biomedical Department, Chang-Gung University, Taiwan) for providing the dominant negative Smad3 vector.


    Footnotes
 
Published online ahead of print. Publication date available at www.jasn.org.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 

  1. Farr RW: Leptospirosis. Clin Infect Dis 21 : 1 –6; quiz 7–8, 1995[Medline]
  2. Yang CW, Pan MJ, Wu MS, Chen YM, Tsen YT, Lin CL, Wu CH, Huang CC: Leptospirosis: An ignored cause of acute renal failure in Taiwan. Am J Kidney Dis 30 : 840 –845, 1997[Medline]
  3. Yang CW, Wu MS, Pan MJ: Leptospirosis renal disease. Nephrol Dial Transplant 16 [Suppl 5]: 73 –77, 2001[Abstract/Free Full Text]
  4. Yang HY, Hsu PY, Pan MJ, Wu MS, Lee CH, Yu CC, Hung CC, Yang CW: Clinical distinction and evaluation of leptospirosis in Taiwan: A case-control study. J Nephrol 18 : 45 –53, 2005[Medline]
  5. Sitprija V, Pipatanagul V, Mertowidjojo K, Boonpucknavig V, Boonpucknavig S: Pathogenesis of renal disease in leptospirosis: Clinical and experimental studies. Kidney Int 17 : 827 –836, 1980[Medline]
  6. Sterling CR, Thiermann AB: Urban rats as chronic carriers of leptospirosis: An ultrastructural investigation. Vet Pathol 18 : 628 –637, 1981[Abstract]
  7. Taylor PL, Hanson LE, Simon J: Serologic, pathologic, and immunologic features of experimentally induced leptospiral nephritis in dogs. Am J Vet Res 31 : 1033 –1049, 1970[Medline]
  8. Penna D, De Brito T, Pupo AA, Machado MM, Ayroza PA, De Almeida SS: Kidney biopsy in human leptospirosis. Am J Trop Med Hyg 12 : 896 –901, 1963[Abstract/Free Full Text]
  9. Atasoyu EM, Turhan V, Unver S, Evrenkaya TR, Yildirim S: A case of leptospirosis presenting with end-stage renal failure. Nephrol Dial Transplant 20 : 2290 –2292, 2005[Free Full Text]
  10. Alves VA, Gayotto LC, Yasuda PH, Wakamatsu A, Kanamura CT, De Brito T: Leptospiral antigens (L. interrogans serogroup ictero-haemorrhagiae) in the kidney of experimentally infected guinea pigs and their relation to the pathogenesis of the renal injury. Exp Pathol 42 : 81 –93, 1991[Medline]
  11. Yang CW, Hung CC, Wu MS, Tian YC, Chang CT, Pan MJ, Vandewalle A: Toll-like receptor 2 mediates early inflammation by leptospiral outer membrane proteins in proximal tubule cells. Kidney Int 69 : 815 –822, 2006[CrossRef][Medline]
  12. Yang CW, Wu MS, Pan MJ, Hong JJ, Yu CC, Vandewalle A, Huang CC: Leptospira outer membrane protein activates NF-kappaB and downstream genes expressed in medullary thick ascending limb cells. J Am Soc Nephrol 11 : 2017 –2026, 2000[Abstract/Free Full Text]
  13. Downer G, Phan SH, Wiggins RC: Analysis of renal fibrosis in a rabbit model of crescentic nephritis. J Clin Invest 82 : 998 –1006, 1988[Medline]
  14. Border WA, Noble NA, Yamamoto T, Harper JR, Yamaguchi Y, Pierschbacher MD, Ruoslahti E: Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease. Nature 360 : 361 –364, 1992[CrossRef][Medline]
  15. Yamamoto T, Noble NA, Miller DE, Border WA: Sustained expression of TGF-beta 1 underlies development of progressive kidney fibrosis. Kidney Int 45 : 916 –927, 1994[Medline]
  16. Tian YC, Phillips AO: Interaction between the transforming growth factor-beta type II receptor/Smad pathway and beta-catenin during transforming growth factor-beta1-mediated adherens junction disassembly. Am J Pathol 160 : 1619 –1628, 2002[Abstract/Free Full Text]
  17. Baricos WH, Cortez SL, Deboisblanc M, Xin S: Transforming growth factor-beta is a potent inhibitor of extracellular matrix degradation by cultured human mesangial cells. J Am Soc Nephrol 10 : 790 –795, 1999[Abstract/Free Full Text]
  18. Poncelet AC, Schnaper HW: Regulation of human mesangial cell collagen expression by transforming growth factor-beta1. Am J Physiol 275 : F458 –F66, 1998[Medline]
  19. Massague J: TGF-beta signal transduction. Annu Rev Biochem 67 : 753 –791, 1998[CrossRef][Medline]
  20. Derynck R, Feng XH: TGF-beta receptor signaling. Biochim Biophys Acta 1333 : F105 –F150, 1997[Medline]
  21. Tian YC, Fraser D, Attisano L, Phillips AO: TGF-beta1-mediated alterations of renal proximal tubular epithelial cell phenotype. Am J Physiol Renal Physiol 285 : F130 –F142, 2003[Abstract/Free Full Text]
  22. Tsuchida K, Zhu Y, Siva S, Dunn SR, Sharma K: Role of Smad4 on TGF-beta-induced extracellular matrix stimulation in mesangial cells. Kidney Int 63 : 2000 –2009, 2003[CrossRef][Medline]
  23. Yang CW, Wu MS, Pan MJ, Hsieh WJ, Vandewalle A, Huang CC: The Leptospira outer membrane protein LipL32 induces tubulointerstitial nephritis-mediated gene expression in mouse proximal tubule cells. J Am Soc Nephrol 13 : 2037 –2045, 2002[Abstract/Free Full Text]
  24. Hung CC, Chang CT, Chen KH, Tian YC, Wu MS, Pan MJ, Vandewalle A, Yang CW: Upregulation of chemokine CXCL1/KC by leptospiral membrane lipoprotein preparation in renal tubule epithelial cells. Kidney Int 69 : 1814 –1822, 2006[CrossRef][Medline]
  25. Tian YC, Phillips AO: TGF-beta1-mediated inhibition of HK-2 cell migration. J Am Soc Nephrol 14 : 631 –640, 2003[Abstract/Free Full Text]
  26. Morrison WI, Wright NG: Canine leptospirosis: An immunopathological study of interstitial nephritis due to Leptospira canicola. J Pathol 120 : 83 –89, 1976[CrossRef][Medline]
  27. Barnett JK, Barnett D, Bolin CA, Summers TA, Wagar EA, Cheville NF, Hartskeerl RA, Haake DA: Expression and distribution of leptospiral outer membrane components during renal infection of hamsters. Infect Immun 67 : 853 –861, 1999[Abstract/Free Full Text]
  28. Haake DA, Mazel MK, McCoy AM, Milward F, Chao G, Matsunaga J, Wagar EA: Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection. Infect Immun 67 : 6572 –6582, 1999[Abstract/Free Full Text]
  29. Zuerner RL, Knudtson W, Bolin CA, Trueba G: Characterization of outer membrane and secreted proteins of Leptospira interrogans serovar pomona. Microb Pathog 10 : 311 –322, 1991[CrossRef][Medline]
  30. Brown JA, LeFebvre RB, Pan MJ: Protein and antigen profiles of prevalent serovars of Leptospira interrogans. Infect Immun 59 : 1772 –1777, 1991[Abstract/Free Full Text]
  31. Nunes-Edwards PL, Thiermann AB, Bassford PJ Jr, Stamm LV: Identification and characterization of the protein antigens of Leptospira interrogans serovar hardjo. Infect Immun 48 : 492 –497, 1985[Abstract/Free Full Text]
  32. Schiller M, Javelaud D, Mauviel A: TGF-beta-induced SMAD signaling and gene regulation: Consequences for extracellular matrix remodeling and wound healing. J Dermatol Sci 35 : 83 –92, 2004[CrossRef][Medline]
  33. Schnaper HW, Hayashida T, Poncelet AC: It’s a Smad world: Regulation of TGF-beta signaling in the kidney. J Am Soc Nephrol 13 : 1126 –1128, 2002[Free Full Text]
  34. Mauviel A: Transforming growth factor-beta: A key mediator of fibrosis. Methods Mol Med 117 : 69 –80, 2005[Medline]
  35. Barral-Netto M, Barral A, Brownell CE, Skeiky YA, Ellings-worth LR, Twardzik DR, Reed SG: Transforming growth factor-beta in leishmanial infection: A parasite escape mechanism. Science 257 : 545 –548, 1992[Abstract/Free Full Text]
  36. Jono H, Xu H, Kai H, Lim DJ, Kim YS, Feng XH, Li JD: Transforming growth factor-beta-Smad signaling pathway negatively regulates nontypeable Haemophilus influenzae-induced MUC5AC mucin transcription via mitogen-activated protein kinase (MAPK) phosphatase-1-dependent inhibition of p38 MAPK. J Biol Chem 278 : 27811 –27819, 2003[Abstract/Free Full Text]
  37. Pal S, Schnapp LM: HIV-infected lymphocytes regulate fibronectin synthesis by TGF beta 1 secretion. J Immunol 172 : 3189 –3195, 2004[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
D. D. Luo, C. Fielding, A. Phillips, and D. Fraser
Interleukin-1 beta regulates proximal tubular cell transforming growth factor beta-1 signalling
Nephrol. Dial. Transplant., September 1, 2009; 24(9): 2655 - 2665.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C.-T. Chang, C.-C. Hung, Y.-C. Chen, T.-H. Yen, M.-S. Wu, C.-W. Yang, A. Phillips, and Y.-C. Tian
Transforming growth factor-{beta}1 decreases epithelial sodium channel functionality in renal collecting duct cells via a Smad4-dependent pathway
Nephrol. Dial. Transplant., April 1, 2008; 23(4): 1126 - 1134.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
ASN.2006020159v1
17/10/2792    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, Y.-C.
Right arrow Articles by Yang, C.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, Y.-C.
Right arrow Articles by Yang, C.-W.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP