Leptospiral Outer Membrane Protein Induces Extracellular Matrix Accumulation through a TGF-1/Smad-Dependent Pathway
Ya-Chung Tian*,
Yung-Chang Chen*,
Cheng-Chieh Hung*,
Chiz-Tzung Chang*,
Mai-Szu Wu*,
Aled O. Phillips and
Chih-Wei Yang*
* Kidney Institute, Department of Nephrology, Chang Gung Memorial Hospital, Taipei, and Chang Gung University, Tao Yuan, Taiwan; and Institute of Nephrology, Cardiff University, Wales, United Kingdom
Address correspondence to: Dr. Chih-Wei Yang, Kidney Institute, Department of Nephrology, Chang Gung Memorial Hospital, 199 Tun-Hwa North Road, Taipei 105, Taiwan. Phone: +886-3-3281200 ext. 8181; Fax: +886-3-3282173; E-mail: cwyang{at}adm.cgmh.org.tw
Received for publication February 21, 2006.
Accepted for publication July 10, 2006.
Leptospirosis is an underestimated cause of renal failure inTaiwan and elsewhere. The consequence of leptospira-inducedacute tubulointerstitial nephritis is tubulointerstitial fibrosisif left untreated. The aim of the study was to examine the effectof an outer membrane protein (OMP) of Leptospira santarosaiserovar Shermani on extracellular matrix (ECM) accumulationin proximal tubular cells, HK-2 cells. The addition of Leptospirasantarosai serovar Shermani OMP for 72 h led to an increaseof type I and type IV collagens, measured by real-time PCR andWestern blot analysis in a dose-response manner. After additionof Leptospira santarosai serovar Shermani OMP, active TGF-1secretion was increased by nearly two-fold. The addition ofantiTGF-1neutralizing antibodies attenuated theLeptospira santarosai serovar Shermani OMPinduced typeI and type IV collagen production, implicating TGF-1 in thisprocess. Overexpression of the dominant negative Smad3 preventedthe Leptospira santarosai serovar Shermani OMPinducedincrease of type I or type IV collagen production. In conclusion,this study clearly demonstrated the stimulatory effect of Leptospirasantarosai serovar Shermani OMP on ECM production by enhancingECM synthesis, which was mediated by a TGF-1/Smad-dependentpathway.
Leptospirosis that is caused by leptospiral infection is a fatalinfectious disease of humans and animals and frequently leadsto multiple-organ failure (1). One of the most commonly affectedorgans is the kidney. However, acute renal failure that is causedby leptospirosis usually is ignored, and the outcome may befatal if severe leptospirosis is left untreated. We have demonstratedthat leptospirosis is an underestimated cause of acute renalfailure in Taiwan (2,3). Among pathogenic leptospira, Leptospirasantarosai serovar Shermani is the main serovar encounteredin Taiwan (4) and can colonize in the kidney after hematogenousdissemination. Through the effect of leptospira endotoxin andimmunologic response, these organisms can cause tubulointerstitialnephritis (1,5). The consequence of tubulointerstitial nephritisthat is caused by leptospiral infection is tubular atrophy andinterstitial fibrosis if chronic leptospiral infection is untreated(6). In canine and rat leptospirosis, the disease may undergoa chronic course, leading to tubulointerstitial fibrosis andthus chronic renal failure (6,7). From human biopsy studies,chronic infection of leptospirosis has been shown to be associatedwith chronic interstitial nephritis and fibrosis (8). Recently,it was reported that leptospirosis led to irreversible tubulointerstitialfibrosis in a young male patient, who subsequently requiredchronic hemodialysis (9).
Leptospiral lipoproteins, the membrane component of leptospiralendotoxin that is associated with tubulointerstitial nephriticchanges, have been found to be expressed in infected renal tubulesand vascular lumen of the interstitium (10). We previously foundthat outer membrane protein (OMP) extracts from Leptospira santarosaiserovar Shermani induced early inflammation through a Toll-likereceptor 2 (TLR2) pathway and an increase of inflammatory cytokinesand chemokines including inducible nitric oxide (iNOS), monocytechemoattractant protein-1 (MCP-1), and TNF-. Our previous findingsprovided in vitro evidence of the association between leptospiralinfection and tubulointerstitial nephritis (11,12).
Tubulointerstitial fibrosis is characterized by excessive accumulationof extracellular matrix (ECM) proteins such as type I and IVcollagens (13). During progression of tubulointerstitial fibrosis,the delicate balance between ECM synthesis and degradation isaltered. As ECM synthesis is increased and ECM degradation simultaneouslyis reduced, ECM proteins accumulate in the interstitium. Thedegradation of ECM depends on the function of mainly metalloproteinases(MMP) and their inhibitors, tissue inhibitor of metalloproteinases(TIMP), which ensure adequate removal of damaged matrix components.Lines of evidence indicate that TGF- is a major culprit of renalfibrosis in a variety of in vivo and in vitro models (1416).It has been demonstrated that persistent overproduction of TGF-1may lead to ECM accumulation through an increase of ECM synthesisand a decrease of ECM degradation by inducing TIMP productionand inhibiting MMP activity (17,18).
TGF-1 exerts its diverse effects by binding to TGF-1 receptorII (TGF-1 RII), which subsequently phosphorylates serine/threonineresidues of TGF-1 receptor I (TGF-1 RI or ALK5) (19,20). Afterphosphorylation, the activated TGF-1 RI can further activatedownstream target proteins, receptor-activated Smad proteins(R-Smad), Smad2/3. Once activated, Smad2/3 complex recruitsSmad4 to form a Smad2/3/4 complex, which finally enters thenucleus to activate target genes such as type I collagen, typeIV collagen, and fibronectin (21,22), indicating a crucial roleof the Smad signaling pathway in the ECM production. The aimof this study was to investigate the effect of Leptospira santarosaiserovar Shermani OMP on ECM protein production using a renalproximal tubular cell culture system and to elucidate the mechanismsby which leptospira caused ECM accumulation.
Preparation of OMP Extract of Leptospira
The method of extraction of Leptospira santarosai serovar ShermaniOMP has been described previously (23). Briefly, a frequentlyencountered pathogenic leptospires serovar Leptospira santarosaiserovar Shermani (ATCC number 43286) and a nonpathogenic Leptospirabiflexa serovar Patoc (ATCC number 23582), were obtained fromATCC (Rockville, MD) and grown in 10% EMJH leptospiral enrichmentmedium (Difco, Detroit, MI). The OMP was extracted with 1% TritonX-114, 10 mM Tris (pH 8), and 1 mM EDTA at 4°C. After centrifugation,the Triton X-114 concentration in the supernatant was increasedto 2%. Phase separation was performed by warming the supernatantto 37°C and subjecting it to centrifugation for 10 min at2000 x g. The detergent and aqueous phases were separated andprecipitated with acetone. The precipitant then was dissolvedin water and quantified before further experiments. More than90% of OMP could be extracted in the Triton X-114 detergentphase.
Cell Culture and Transfection
HK-2 cells, immortalized human renal proximal tubular cells,were cultured in DMEM/Hams F12 supplemented with 5% FCS,2 mM glutamine, 20 mM HEPES buffer, 0.4 µg/ml hydrocortisone,5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/mlsodium selenite. The flag-tagged dominant negative Smad3 wasa gift from Dr. Yu-Sun Chang (Biomedical Department, Chang-GungUniversity, Tao Yuan, Taiwan). To introduce the plasmid cDNAinto cells, we used the Fugen-6 system (Roche Diagnostics, Indianapolis,IN) according to the manufacturers manual.
Real-Time PCR
The method of real-time PCR was described previously (24). Briefly,total RNA was isolated from HK-2 cells and reverse-transcribedto DNA. Real-time PCR was performed on an ABI-Prism 7700 usingSYBR Green I as a double-stranded DNA-specific dye accordingto the manufacturers instructions (PE-Applied Biosystems,Cheshire, UK). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)was used as a standard housekeeping gene. Primers (human typeIV collagen: forward TCAATCACTGTCTTGCCCCA, reverse ACTCTTTTGTGATGCACACCA;GAPDH: forward TTCCAGGAGCGAGATCCCT, reverse CACCCATGACGAACATGGG)were constructed to be compatible with a single reverse transcriptionPCRthermal profile (95°C for 10 min, 40 cycles of 95°Cfor 30 s, and 60°C for 1 min). Accumulation of the PCR productwas monitored in real time (PE-Applied Biosystems). Type IVcollagen gene mRNA expression was expressed relative to GAPDHexpression. Fold changes in gene expression in comparison withcontrol were determined.
Western Blot Analysis
Total cellular protein extraction was performed as describedpreviously (23). Equal amounts of proteins were mixed with theequal volume of reducing SDS sample buffer and boiled for 5min at 95°C. Protein samples were resolved on a 10% SDS-PAGEand then electroblotted on nitrocellulose membranes (Bio-Rad,Hercules, CA). After electroblotting, nonspecific binding wasblocked with 5% nonfat milk solution. The membrane then wasincubated with primary antibodies overnight at 4°C followedby incubation with an horseradish peroxidaseconjugatedsecondary antibodies for 1 h at room temperature. Proteins werevisualized using enhanced chemiluminescence (Amersham, Buckinghamshire,UK) as described previously (25).
Zymography
The conditioned medium was mixed with the nonreducing samplebuffer and left at room temperature for 10 min. Electrophoresiswas performed using 7.5% nonreducing SDS polyacrylamide gelsthat contained gelatin (1 mg/ml). The gels first were placedin 2.5% Triton at room temperature for 1 h and then incubatedin the enzyme buffer that was composed of 50 mM Tris HCl (pH7.6), 10 mM CaCl2, and 0.05% Brij overnight at 37°C. Thepresence of MMP-2 or MMP-9 activity shown as the zones of lysiswas demonstrated by staining gels in 0.5% Coomassie BrilliantBlue.
ELISA
Total TGF-1 in the cell culture supernatant was measured byspecific ELISA (R&D Systems, Minneapolis, MN) of conditionedcell culture supernatant samples. This assay has <1% cross-reactivityfor TGF-2 and TGF-3. TGF-1 concentration was normalized to numberof cells, determined by cell counting with a Hemocytometer.Data were expressed as pg TGF-1/ml per 105 cells.
Immunocytochemistry
Cells were fixed with 3% paraformaldehyde for 15 min at roomtemperature and subsequently were permeabilized with 0.2% Tritonin PBS for 5 min at room temperature followed by incubationin 1% albumin in PBS at room temperature for 1 h. Subsequently,cells were incubated with rabbit anti-Smad3 antibodies at 4°Covernight and incubated with FITC-conjugated rabbit anti-mouseantibody at room temperature for 1 h. After washing with PBS,slides were mounted with fluorSave reagent (Calbiochem, Nottingham,UK).
Statistical Analyses
All of the data were presented as means ± SEM. Statisticalanalysis was performed using ANOVA with Tukey post hoc test.P < 0.05 was considered to represent a significant difference.
Leptospira Santarosai Serovar Shermani OMP Induced an Increase of Type I and Type IV Collagen Production
To assess whether pathogenic leptospira, Leptospira santarosaiserovar Shermani, increased extracellular matrix production,we first assessed production of type I and type IV collagensin response to Leptospira santarosai serovar Shermani OMP inHK-2 cells. After addition of 0.01, 0.1, or 0.3 µg/mlof Leptospira santarosai serovar Shermani OMP in HK-2 cellsfor 72 h, Western blot analysis demonstrated a dose-dependentincrease of type I collagen (Figure 1A) and type IV collagen(Figure 1B). A maximal increase of type I collagen and typeIV collagen in response to Leptospira santarosai serovar ShermaniOMP was detected when 0.1 or 0.3 µg/ml Leptospira santarosaiserovar Shermani OMP was added. TGF-1induced increaseof type I and type IV collagens, which was in accordance withour previous study (21), was used as a positive control. Toconfirm the specificity of Leptospira santarosai serovar ShermaniOMP-mediated increase of type IV collagen, we added the OMPfrom a nonpathogenic serovar, Leptospira biflexa serovar Patoc,to HK-2 cells. In contrast to Leptospira santarosai serovarShermani OMP, Leptospira biflexa serovar Patoc OMP did not resultin an increase of type IV collagen (Figure 2A).
Figure 1. The increase of types IV and I collagen production induced by Leptospira santarosai serovar Shermani outer membrane protein (OMP). HK-2 cells were grown to confluence and then serum-deprived for 2 d. HK-2 cells subsequently were grown in the absence (C) or presence of various concentrations (0.01, 0.1, or 0.3 µg/ml) of Leptospira santarosai serovar Shermani OMP (as indicated) under serum-free conditions for 3 d. TGF-1 (10 ng/ml) was added to HK-2 cells under serum-free conditions for 3 d as positive control. Supernatants were collected and subjected to Western blot analysis for type I collagen (A) and type IV collagen (B). One representative experiment of at least three individual replicate experiments is shown.
Figure 2. The increase of type IV collagen production that specifically is induced by Leptospira santarosai serovar Shermani OMP. HK-2 cells were grown to confluence and serum-deprived for 48 h. (A) Leptospira santarosai serovar Shermani (LS; lane 2; 0.1 µg/ml) or nonpathogenic Leptospira biflexa serovar Patoc OMP (LP; lane 3; 0.1 µg/ml) was added to growth-arrested HK-2 cells under serum-free conditions for 3 d. In the control experiments, HK-2 cells were grown in the serum-free condition only for 3 d (C). (B) Leptospira santarosai serovar Shermani OMP (0.1 µg/ml) was inactivated by boiling (100°C) for 30 min or treatment with proteinase K (10 mg/ml) at 37°C for 30 min. Subsequently, growth-arrested HK-2 cells were incubated in the absence (C) or presence of nontreated (LS), heat-treated (heated LS), or proteinase Ktreated Leptospira santarosai serovar Shermani OMP in the serum-free condition for 3 d. Type IV collagen in the supernatant of culture was measured by Western blot analysis. One representative experiment of at least three individual replicate experiments is shown.
We previously demonstrated that the lipoprotein was the majorcomponent of Leptospira santarosai serovar Shermani OMP correspondingto the increase of MCP-1 and TNF- as Leptospira santarosai serovarShermani OMP that was inactivated by pretreatment with the heator proteinase K was unable to induce correspondence to the increaseof type IV collagen. In our study, Leptospira santarosai serovarShermani OMP (0.1 µg/ml) was inactivated by boiling (100°C)for 30 min or treatment with proteinase K (10 mg/ml) at 37°Cfor 30 min. HK-2 cells then were incubated in the medium thatcontained the heat- or proteinase Ktreated Leptospirasantarosai serovar Shermani OMP for 72 h. Western blot analysisshowed that neither the heat- nor proteinase KtreatedLeptospira santarosai serovar Shermani OMP led to an increaseof type IV collagen (Figure 2B), suggesting that the activecomponent of the Leptospira santarosai serovar Shermani OMPwas heat labile and digestible by proteinase K.
Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type IV Collagen Was Associated with the Induction of Its Gene Expression
To determine whether the increase of type IV collagen that wasstimulated by Leptospira santarosai serovar Shermani OMP involvedan enhancement of gene expression, we used real-time PCR toassess type IV collagen gene expression. Real-time PCR revealedthat addition of Leptospira santarosai serovar Shermani OMP(0.1 µg/ml) for 48 h in HK-2 cells led to an increasedexpression of type IV collagen mRNA (Figure 3). The depositionof matrix proteins is a dynamic process that involves a balanceof synthesis and degradation of these proteins. To address whetherthe Leptospira santarosai serovar Shermani OMP-mediated increaseof type IV collagen production was associated with a decreaseof type IV collagen degradation, we performed zymography toassess alteration of gelatinases. After addition of Leptospirasantarosai serovar Shermani OMP (0.1 or 0.3 µg/ml) for3 d, zymography did not detect a difference in MMP-9 (Figure 4)and MMP-2 (data not shown) expression when compared with thatof the control. Similarly, the addition of Leptospira santarosaiserovar Shermani OMP for 3 d did not cause alteration of TIMP-1and TIMP-2 secretion as measured by Western blot analysis (datanot shown). These results suggested that ECM degradation wasnot implicated in the Leptospira santarosai serovar ShermaniOMP-mediated increase of type IV collagen.
Figure 3. An increase of type IV collagen mRNA expression that is induced by Leptospira santarosai serovar Shermani OMP. Confluent HK-2 cells were serum-deprived for 2 d followed by incubation in the absence (C) or presence (LS) of 0.1 or 0.2 µg/ml Leptospira santarosai serovar Shermani OMP for an additional 48 h. Subsequently, type IV collagen mRNA expression was quantified by real-time PCR as described in Materials and Methods. Results were expressed as the relative fold increase of type IV collagen mRNA expression over that of the untreated group and represented as mean ± SEM of triplicate measurements from three independent experiments (*P < 0.01 versus the control group).
Figure 4. Zymography assay showing no alteration of metalloproteinase-9 (MMP-9) by addition of Leptospira santarosai serovar Shermani OMP. HK-2 cells were grown to confluence and then serum-deprived for 2 d. HK-2 cells subsequently were grown in the absence (C) or presence of various concentrations (0.1 or 0.3 µg/ml) of Leptospira santarosai serovar Shermani OMP (as indicated) under serum-free conditions for 3 d. TGF-1 (10 ng/ml) was added to HK-2 cells under serum-free conditions for 3 d as positive control. Supernatant samples were collected, and MMP-9 activity was assessed by substrate zymography.
Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type I and Type IV Collagens Was Mediated through the Increase of TGF-1 Secretion
TGF-1 has evolved as the most essential profibrogenic mediatorin the accumulation of ECM proteins. To clarify whether TGF-1was involved in the Leptospira santarosai serovar Shermani OMP-inducedincrease of ECM proteins, we first assessed secretion of theactive form of TGF-1 after stimulation of Leptospira santarosaiserovar Shermani OMP. After addition of 0.2 µg/ml Leptospirasantarosai serovar Shermani OMP to HK-2 cells for 3 d, secretionof the active form of TGF-1 as measured by ELISA was significantlyincreased when compared with that of the nonstimulated control(374.8 ± 13.6 versus 239.6 ± 12.1 pg/105 cells;P < 0.001; n = 6) and the Leptospira biflexa serovar PatocOMP (374.8 ± 13.6 versus 267.0 ± 6.6 pg/105 cells;P < 0.001; n = 6), respectively (Figure 5). In contrast,the increase of TGF-1 secretion that was induced by the Leptospirabiflexa serovar Patoc OMP was not significantly different fromthat of the nonstimulated control (267.0 ± 6.6 versus239.6 ± 12.1 pg/105 cells; P = 0.173; n = 6; Figure 5).To confirm further the importance of TGF-1 in the Leptospirasantarosai serovar Shermani OMP-induced increase of ECM proteins,we pretreated HK-2 cells with antiTGF-1neutralizingantibodies to abrogate TGF-1 function 30 min before administrationof Leptospira santarosai serovar Shermani OMP. Western blotanalysis showed that the addition of antiTGF-1neutralizingantibodies led to the abrogation of the Leptospira santarosaiserovar Shermani OMP (0.2 µg/ml)-mediated increase oftype I collagen (Figure 6A) and type IV collagen (Figure 6B)in a dose-dependent manner (0.5 and 1 µg/ml). The additionof 1 µg/ml antiTGF-1neutralizing antibodiesresulted in nearly complete blockade of the Leptospira santarosaiserovar Shermani OMP-induced increase of type I collagen andtype IV collagen. These data indicate that Leptospira santarosaiserovar Shermani OMP stimulated secretion of active TGF-1, thenled to the increased production of type I and type IV collagens.
Figure 5. An increase of TGF-1 secretion by addition of Leptospira santarosai serovar Shermani OMP. Confluent HK-2 cells were serum-deprived for 2 d. Growth-arrested HK-2 cells then were incubated in the absence or presence of 0.1 µg/ml LS or LP under serum-free conditions for 3 d. Subsequently, the supernatant was collected for determination of TGF-1 by ELISA, and the number of the remaining monolayer of HK-2 cells was counted. Results were expressed as TGF-1 pg of 105 cells and represent mean ± SEM of six individual experiments (P value as indicated).
Figure 6. The inhibition of Leptospira santarosai serovar Shermani OMP-mediated increase of type IV collagen production by neutralizing antiTGF-1 antibody. Confluent HK-2 cells were growth-arrested by serum deprivation for 2 d. HK-2 cells then were treated with 0.5 or 1 µg/ml antiTGF-1neutralizing antibodies and followed by administration 0.1 µg/ml Leptospira santarosai serovar Shermani OMP under serum-free conditions for 3 d. Supernatants were collected and subjected to Western blot analysis for production of type I collagen (A) and type IV collagen (B).
Leptospira Santarosai Serovar Shermani OMP-Mediated Increase of Type I and Type IV Collagens Was Associated with Activation of the Smad3 Signal
A TGF- downstream Smad signaling pathway has been implicatedin the TGF-1mediated ECM deposition (21,22). For confirmationof the indispensable role of the Smad signal activation in theLeptospira santarosai serovar Shermani OMP-mediated increaseof type I and type IV collagen production, the dominant negativeSmad3 was transiently overexpressed in the HK-2 cells followedby stimulation with Leptospira santarosai serovar Shermani OMPfor 3 d. Western blot analysis demonstrated that when HK-2 cellswere transfected with the empty vector, the addition of Leptospirasantarosai serovar Shermani OMP still induced an increase oftype I and type IV collagen production (Figure 7, A and B, lanes1 and 2). In contrast, the Leptospira santarosai serovar ShermaniOMP-induced increase of type I and type IV collagen productionwas abrogated by overexpression of the dominant negative Smad3proteins in HK-2 cells (Figure 7, A through C, lanes 3 and 4),indicating that the Leptospira santarosai serovar Shermani OMP-stimulatedincrease of type I and type IV collagens required the Smad signalingpathway.
Figure 7. Abrogation of Leptospira santarosai serovar Shermani OMP-mediated increase of type I collagen and type IV collagen by overexpression of the dominant negative Smad3 proteins. HK-2 cells were grown to approximately 60 to 70% confluence followed by transient transfection with the empty vector (empty) or the flag-tagged dominant negative Smad3 vector (S3C) for 18 h as described in Materials and Methods. Subsequently, the cells were incubated further in the serum-free medium in the absence or presence of 0.1 µg/ml LS for an additional 3 d. Supernatants were collected and subjected to Western blot analysis for production of type I collagen (A) and type IV collagen (B). The overexpression of the dominant negative Smad3 was confirmed by immunoblotting with anti-flag antibody (C).
The renal proximal tubular cells are major targets of leptospires(26). In this study, we have shown that mouse renal proximaltubular cells produced inflammatory cytokines such as iNOS,MCP-1, and TNF- in response to stimulation of Leptospira santarosaiserovar Shermani OMP. In this study, we demonstrated that theadministration of Leptospira santarosai serovar Shermani OMPto human renal proximal tubular cells led to an increase oftype I and type IV collagen production, indicating that renalproximal tubular cells play a crucial role in the leptospira-inducedtubulointerstitial fibrosis. Tubulointerstitial fibrosis isa major consequence of the leptospiral infection. Although severalanimal studies reveal that leptospiral infection results ininterstitial collagen deposition and tubular basement membranethickening (6), there is no in vitro study so far to clarifywhether there is a direct correlation between leptospiral infectionand the induction of collagen production. Our in vitro studyprovides direct evidence that leptospiral infection can elicitan enhanced production of an interstitial protein, type I collagen,as well as a basement membrane protein, type IV collagen, inrenal proximal tubular cells, both of which are characteristicsof renal fibrosis.
The leptospiral OMP are essential to determine the virulenceof pathogenic leptospires. The most abundant proteins in thespirochetal outer membrane are lipoproteins that have been shownto be implicated in the pathogenesis of tubulointerstitial nephritis(27,28). Several studies have identified the complexity of theselipoproteins of the leptospiral outer membrane as importantimmunogens (2931). The OMP extraction method that weused in this study enriched lipoprotein components of leptospiralOMP. We previously demonstrated that heat and proteinase K treatmentof leptospiral OMP extracts significantly reduced their effectson induction of iNOS and CCL2/MCP-1 expressions in renal tubulecells (12), suggesting that lipoproteins are main componentsin the leptospiral OMP extracts, corresponding to the inductionof these inflammatory cytokines. Similarly, our study demonstratedthat the heat- or proteinase Ktreated Leptospira santarosaiserovar Shermani OMP failed to induce the increase of type IVcollagen production. Although we cannot exclude a role for contaminantleptospiral LPS in OMP preparations, our study clearly indicatedthat lipoproteins were major components responsible for theLeptospira santarosai serovar Shermani OMP-mediated increaseof type IV collagen production.
In this study, administration of the OMP from Leptospira santarosaiserovar Shermani induced increased production of type IV collagen,whereas addition of the OMP from a nonpathogenic leptospira,Leptospira biflexa serovar Patoc, did not alter production ofthis collagen, confirming the specificity of the pathogenicrole of Leptospira santarosai serovar Shermani in tubulointerstitialfibrosis. These findings were compatible with our previous reportthat Leptospira santarosai serovar Shermani is pathogenic intubulointerstitial nephritis as Leptospira santarosai serovarShermani but not Leptospira biflexa serovar Patoc and is ableto promote expression of iNOS, MCP-1, and TNF-.
Renal fibrosis that is characterized by ECM accumulation involvesexcessive production of newly synthesized ECM components aswell as inadequate degradation and clearance of ECM components.In this study, expression of type IV collagen mRNA was upregulatedby administration of Leptospira santarosai serovar ShermaniOMP, whereas the levels of MMP-9 and TIMP-1/TIMP-2 (data notshown) were unchanged. These findings suggest that the Leptospirasantarosai serovar Shermani OMP-induced type IV collagen resultedfrom new protein synthesis instead of inhibition of its degradation.
Several growth factors such as TGF-1 and endothelin-1 have beenimplicated in renal fibrosis. Recent evidence has suggesteda fundamental role for TGF-1 as the most critical mediator indevelopment of tubulointerstitial fibrosis. Many studies havedemonstrated that TGF-1 can stimulate ECM production in differenttypes of cells, including renal fibroblasts and tubular cells,and blocking TGF-1 by a variety of strategies such as administrationof antiTGF-1neutralizing antibodies suppressesECM generation. On the basis of our finding that administrationof Leptospira santarosai serovar Shermani OMP led to the increaseof type I and type IV collagen production and that Leptospirasantarosai serovar Shermani OMP stimulated TGF-1 secretion,we postulated that the Leptospira santarosai serovar ShermaniOMP-induced ECM accumulation was caused by the enhancement ofTGF-1 secretion. This hypothesis was confirmed by the evidencethat the Leptospira santarosai serovar Shermani OMP-mediatedincrease of type I and type IV collagens was abrogated by pretreatmentof HK-2 cells with antiTGF-1neutralizing antibodies.
A Smad signaling pathway that transmits TGF- signals is thoughtto be indispensable in many TGF-mediated cell functions(32,33). Several studies using different cell types have indicatedclearly that the activation of Smad signals is required in theTGF-1mediated increment of ECM proteins (34). To delineatethe role of the Smad signaling pathway in the Leptospira santarosaiserovar Shermani OMP-induced synthesis of type I and type IVcollagens, overexpression of the dominant negative Smad3 wasused to block the Smad signaling pathway. In this study, wefound that overexpression of the dominant negative Smad3 inHK-2 cells inhibited the Leptospira santarosai serovar ShermaniOMP-induced increase of type I and type IV collagens, suggestingthat Smad3, a downstream mediator of TGF-1, plays a pivotalrole in this process. Several studies have demonstrated thatinfection with microorganisms, including parasite, virus, andbacterium, leads to an increase of TGF-1 production in differentcell types (3537). However, it is not clear that theseinfections can activate the TGF- downstream Smad signaling.Recently, Jono et al. (36) reported that Haemophilus influenzaeinfection can activate the Smad4 signaling and that the Haemophilusinfluenzaeinduced increase of mucin production is mediatedthrough the cooperation between the TGF-/Smad signaling pathwayand the TLR2-dependent pathway in human respiratory and colonepithelial cells. Similarly, our study discloses that the Leptospirasantarosai serovar Shermani OMP-induced increase of type I andtype IV collagens is mediated through the TGF-1/Smad signalingpathway. Whether this reaction is coordinated with the TLR signalingpathway is under investigation.
This in vitro study is the first to provide direct evidencethat leptospiral infection can promote ECM production. The Leptospirasantarosai serovar Shermani OMP-induced ECM accumulation isregulated by enhancement of ECM synthesis instead of decrementof ECM degradation. This process is mediated by TGF-1 and itsdownstream Smad signaling pathway.
Acknowledgments
This study was supported by grants NMRPG340721 and NMRPG330072to Y.-C.T. from the National Science Council, Taiwan. A.O.P.is the recipient of a Glaxo Wellcome Senior Fellowship.
We thank Dr. Yu-Sun Chang (Biomedical Department, Chang-GungUniversity, Taiwan) for providing the dominant negative Smad3vector.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
Yang CW, Pan MJ, Wu MS, Chen YM, Tsen YT, Lin CL, Wu CH, Huang CC: Leptospirosis: An ignored cause of acute renal failure in Taiwan.
Am J Kidney Dis 30
: 840
845, 1997[Medline]
Yang CW, Wu MS, Pan MJ: Leptospirosis renal disease.
Nephrol Dial Transplant 16
[Suppl 5]: 73
77, 2001[Abstract/Free Full Text]
Yang HY, Hsu PY, Pan MJ, Wu MS, Lee CH, Yu CC, Hung CC, Yang CW: Clinical distinction and evaluation of leptospirosis in Taiwan: A case-control study.
J Nephrol 18
: 45
53, 2005[Medline]
Sitprija V, Pipatanagul V, Mertowidjojo K, Boonpucknavig V, Boonpucknavig S: Pathogenesis of renal disease in leptospirosis: Clinical and experimental studies.
Kidney Int 17
: 827
836, 1980[Medline]
Sterling CR, Thiermann AB: Urban rats as chronic carriers of leptospirosis: An ultrastructural investigation.
Vet Pathol 18
: 628
637, 1981[Abstract]
Taylor PL, Hanson LE, Simon J: Serologic, pathologic, and immunologic features of experimentally induced leptospiral nephritis in dogs.
Am J Vet Res 31
: 1033
1049, 1970[Medline]
Penna D, De Brito T, Pupo AA, Machado MM, Ayroza PA, De Almeida SS: Kidney biopsy in human leptospirosis.
Am J Trop Med Hyg 12
: 896
901, 1963[Abstract/Free Full Text]
Atasoyu EM, Turhan V, Unver S, Evrenkaya TR, Yildirim S: A case of leptospirosis presenting with end-stage renal failure.
Nephrol Dial Transplant 20
: 2290
2292, 2005[Free Full Text]
Alves VA, Gayotto LC, Yasuda PH, Wakamatsu A, Kanamura CT, De Brito T: Leptospiral antigens (L. interrogans serogroup ictero-haemorrhagiae) in the kidney of experimentally infected guinea pigs and their relation to the pathogenesis of the renal injury.
Exp Pathol 42
: 81
93, 1991[Medline]
Yang CW, Hung CC, Wu MS, Tian YC, Chang CT, Pan MJ, Vandewalle A: Toll-like receptor 2 mediates early inflammation by leptospiral outer membrane proteins in proximal tubule cells.
Kidney Int 69
: 815
822, 2006[CrossRef][Medline]
Yang CW, Wu MS, Pan MJ, Hong JJ, Yu CC, Vandewalle A, Huang CC: Leptospira outer membrane protein activates NF-kappaB and downstream genes expressed in medullary thick ascending limb cells.
J Am Soc Nephrol 11
: 2017
2026, 2000[Abstract/Free Full Text]
Downer G, Phan SH, Wiggins RC: Analysis of renal fibrosis in a rabbit model of crescentic nephritis.
J Clin Invest 82
: 998
1006, 1988[Medline]
Border WA, Noble NA, Yamamoto T, Harper JR, Yamaguchi Y, Pierschbacher MD, Ruoslahti E: Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease.
Nature 360
: 361
364, 1992[CrossRef][Medline]
Yamamoto T, Noble NA, Miller DE, Border WA: Sustained expression of TGF-beta 1 underlies development of progressive kidney fibrosis.
Kidney Int 45
: 916
927, 1994[Medline]
Tian YC, Phillips AO: Interaction between the transforming growth factor-beta type II receptor/Smad pathway and beta-catenin during transforming growth factor-beta1-mediated adherens junction disassembly.
Am J Pathol 160
: 1619
1628, 2002[Abstract/Free Full Text]
Baricos WH, Cortez SL, Deboisblanc M, Xin S: Transforming growth factor-beta is a potent inhibitor of extracellular matrix degradation by cultured human mesangial cells.
J Am Soc Nephrol 10
: 790
795, 1999[Abstract/Free Full Text]
Poncelet AC, Schnaper HW: Regulation of human mesangial cell collagen expression by transforming growth factor-beta1.
Am J Physiol 275
: F458
F66, 1998[Medline]
Massague J: TGF-beta signal transduction.
Annu Rev Biochem 67
: 753
791, 1998[CrossRef][Medline]
Tian YC, Fraser D, Attisano L, Phillips AO: TGF-beta1-mediated alterations of renal proximal tubular epithelial cell phenotype.
Am J Physiol Renal Physiol 285
: F130
F142, 2003[Abstract/Free Full Text]
Tsuchida K, Zhu Y, Siva S, Dunn SR, Sharma K: Role of Smad4 on TGF-beta-induced extracellular matrix stimulation in mesangial cells.
Kidney Int 63
: 2000
2009, 2003[CrossRef][Medline]
Yang CW, Wu MS, Pan MJ, Hsieh WJ, Vandewalle A, Huang CC: The Leptospira outer membrane protein LipL32 induces tubulointerstitial nephritis-mediated gene expression in mouse proximal tubule cells.
J Am Soc Nephrol 13
: 2037
2045, 2002[Abstract/Free Full Text]
Hung CC, Chang CT, Chen KH, Tian YC, Wu MS, Pan MJ, Vandewalle A, Yang CW: Upregulation of chemokine CXCL1/KC by leptospiral membrane lipoprotein preparation in renal tubule epithelial cells.
Kidney Int 69
: 1814
1822, 2006[CrossRef][Medline]
Tian YC, Phillips AO: TGF-beta1-mediated inhibition of HK-2 cell migration.
J Am Soc Nephrol 14
: 631
640, 2003[Abstract/Free Full Text]
Morrison WI, Wright NG: Canine leptospirosis: An immunopathological study of interstitial nephritis due to Leptospira canicola.
J Pathol 120
: 83
89, 1976[CrossRef][Medline]
Barnett JK, Barnett D, Bolin CA, Summers TA, Wagar EA, Cheville NF, Hartskeerl RA, Haake DA: Expression and distribution of leptospiral outer membrane components during renal infection of hamsters.
Infect Immun 67
: 853
861, 1999[Abstract/Free Full Text]
Zuerner RL, Knudtson W, Bolin CA, Trueba G: Characterization of outer membrane and secreted proteins of Leptospira interrogans serovar pomona.
Microb Pathog 10
: 311
322, 1991[CrossRef][Medline]
Brown JA, LeFebvre RB, Pan MJ: Protein and antigen profiles of prevalent serovars of Leptospira interrogans.
Infect Immun 59
: 1772
1777, 1991[Abstract/Free Full Text]
Nunes-Edwards PL, Thiermann AB, Bassford PJ Jr, Stamm LV: Identification and characterization of the protein antigens of Leptospira interrogans serovar hardjo.
Infect Immun 48
: 492
497, 1985[Abstract/Free Full Text]
Schiller M, Javelaud D, Mauviel A: TGF-beta-induced SMAD signaling and gene regulation: Consequences for extracellular matrix remodeling and wound healing.
J Dermatol Sci 35
: 83
92, 2004[CrossRef][Medline]
Schnaper HW, Hayashida T, Poncelet AC: Its a Smad world: Regulation of TGF-beta signaling in the kidney.
J Am Soc Nephrol 13
: 1126
1128, 2002[Free Full Text]
Mauviel A: Transforming growth factor-beta: A key mediator of fibrosis.
Methods Mol Med 117
: 69
80, 2005[Medline]
Barral-Netto M, Barral A, Brownell CE, Skeiky YA, Ellings-worth LR, Twardzik DR, Reed SG: Transforming growth factor-beta in leishmanial infection: A parasite escape mechanism.
Science 257
: 545
548, 1992[Abstract/Free Full Text]
Jono H, Xu H, Kai H, Lim DJ, Kim YS, Feng XH, Li JD: Transforming growth factor-beta-Smad signaling pathway negatively regulates nontypeable Haemophilus influenzae-induced MUC5AC mucin transcription via mitogen-activated protein kinase (MAPK) phosphatase-1-dependent inhibition of p38 MAPK.
J Biol Chem 278
: 27811
27819, 2003[Abstract/Free Full Text]
Pal S, Schnapp LM: HIV-infected lymphocytes regulate fibronectin synthesis by TGF beta 1 secretion.
J Immunol 172
: 3189
3195, 2004[Abstract/Free Full Text]
This article has been cited by other articles:
D. D. Luo, C. Fielding, A. Phillips, and D. Fraser Interleukin-1 beta regulates proximal tubular cell transforming growth factor beta-1 signalling
Nephrol. Dial. Transplant.,
September 1, 2009;
24(9):
2655 - 2665.
[Abstract][Full Text][PDF]
C.-T. Chang, C.-C. Hung, Y.-C. Chen, T.-H. Yen, M.-S. Wu, C.-W. Yang, A. Phillips, and Y.-C. Tian Transforming growth factor-{beta}1 decreases epithelial sodium channel functionality in renal collecting duct cells via a Smad4-dependent pathway
Nephrol. Dial. Transplant.,
April 1, 2008;
23(4):
1126 - 1134.
[Abstract][Full Text][PDF]