Role of the Akt/FoxO3a Pathway in TGF-1–Mediated Mesangial Cell Dysfunction: A Novel Mechanism Related to Diabetic Kidney Disease
Mitsuo Kato*,
Hang Yuan*,
Zhong-Gao Xu*,,
Linda Lanting*,
Shu-Lian Li*,
Mei Wang*,
Mickey C.-T. Hu,
Marpadga A. Reddy* and
Rama Natarajan*
* Department of Diabetes, Beckman Research Institute of the City of Hope, Duarte, California; Department of Nephrology, 2nd Hospital of Jilin University, Changchun, China; and Departments of Molecular and Cellular Oncology, University of Texas, M.D. Anderson Cancer Center, Houston, Texas
Address correspondence to: Dr. Rama Natarajan, Department of Diabetes, Beckman Research Institute of the City of Hope, 1500 East Duarte Road, Duarte, CA 91010. Phone: 626-256-4673; Fax: 626-301-8136; E-mail: rnatarajan{at}coh.org
Received for publication July 18, 2006.
Accepted for publication September 11, 2006.
Diabetic nephropathy (DN) is characterized by mesangial cell(MC) expansion and accumulation of extracellular matrix proteins.TGF- is increased in MC under diabetic conditions and in DNand activates key signaling pathways, including the phosphoinositide-3-kinase/Akt(PI3K/Akt) pathway. FoxO transcription factors play roles incell survival and oxidative stress and are negatively regulatedby Akt-mediated phosphorylation. We tested whether phosphorylation-mediatedinactivation of FoxO3a by TGF- can mediate MC survival and oxidativestress. TGF- treatment significantly increased levels of p-Akt(activation) and p-FoxO3a (inactivation) in cultured MC. ThisFoxO3a inactivation was accompanied by significant decreasesin the expression of two key FoxO3a target genes, the proapoptoticBim and antioxidant manganese superoxide dismutase in MC. TGF-treatment triggered the nuclear exclusion of FoxO3a, significantlyinhibited FoxO3a transcriptional activity, and markedly protectedMC from apoptosis. A PI3K inhibitor blocked these TGF- effects.It is interesting that p-Akt and p-FoxO3A levels also were increasedin renal cortical tissues from rats and mice at 2 wk after theinduction of diabetes by streptozotocin, thus demonstratingin vivo significance. In summary, TGF- and diabetes can increaseFoxO3a phosphorylation and transcriptional inactivation viaPI3K/Akt. These new results suggest that Akt/FoxO pathway regulationmay be a novel mechanism by which TGF- can induce unopposedMC survival and oxidant stress in early DN, thereby acceleratingrenal disease.
Diabetes is a major factor that leads to ESRD and accounts foralmost half of all patients who begin dialysis. Numerous factorscontribute to the pathogenesis and progression of diabetic nephropathy(DN). Histologically, DN is characterized by glomerular basementmembrane thickening and mesangial expansion. This matrix accumulationis due to coordinate alterations in extracellular matrix (ECM)proteins such as types I and IV collagen, laminin, and fibronectin(1–3); ECM regulatory enzymes such as matrix metalloproteinasesand tissue inhibitors of matrix metalloproteinases (4,5); andgrowth factors such as PDGF, TGF-1, and angiotensin II (6–9).
Factors that are relevant to the pathogenesis of DN can increaseTGF- expression in MC in vitro (7,10–12) and in vivo (7,13,14).Therefore, TGF- has been studied as a major target for DN treatment.TGF- is a profibrotic agent with several effects in renal cells,including the production of ECM proteins, type I and II collagens,laminin, heparin sulfate proteoglycan, fibronectin, and alsoplasminogen activator inhibitor-1 (7,13–17). Improvementin glomerular filtration rates was induced by an anti–TGF-antibody in experimental DN (18). However, the subtle upstreamsignal transduction mechanisms by which TGF- regulates MC dysfunctionare not fully clear. Importantly, whereas most of the pathologiceffects of TGF- in the kidney and DN have been attributed toits profibrotic effects, other potential mechanisms have beenless well explored.
Interaction of TGF- with its receptors induces the phosphorylationand nuclear translocation of the receptor-regulated Smad2/3transcription factors (19–21). MC express Smad 2,3,4,and Smad 6,7 (inhibitory Smads), which have been shown to regulateTGF-–induced gene expression (16,17,22,23). Apart fromthe Smad pathway, the matrix-inducing actions of TGF- also maybe mediated via activation of mitogen-activated protein kinases(MAPK) such as p38 and extracellular signal–regulatedkinases (12,24,25).
Phosphoinositide-3-kinase (PI3K) plays a crucial role in cellgrowth and cell survival (26). PI3K enzyme acts on membranePI to generate the second messenger lipid PI-3,4,5-triphosphate.PI-3,4,5-triphosphate recruits phosphatidylinositol-dependentkinase 1 and Akt kinase to the membrane, then phosphatidylinositol-dependentkinase 1 phosphorylates and activates Akt. Activated Akt phosphorylatesseveral downstream proteins, including GSK3-, Forkhead (FoxO)transcription factors, and tuberous sclerosis 1 and 2 to controlcell growth, cell survival, and protein synthesis (26).
TGF- activates the PI3K/Akt pathway in various cells (27,28).However, the mechanism of TGF-–mediated PI3K activationand downstream targets in MC are not completely clear. In MC,TGF-–induced activation of PI3K/Akt and phosphorylationof Smad3 were linked with upregulation of collagen type I a2gene, suggesting that TGF-–induced ECM accumulation inMC may be regulated through the PI3K/Akt pathway (27). PI3K/Aktpathway activation also was reported in TGF-–mediatedepithelial to mesenchymal transition and migration (28). Physicalinteraction between TGF- type I or II receptors and PI3K wasdetected in human airway smooth muscle cells and COS7 cellsthat expressed TGF- receptors and p85 subunit of PI3K (29,30).Therefore, TGF- seems to activate the PI3K/Akt pathway in severalcell types via association of TGF- receptors and PI3K.
FoxO3a is a member of FoxO subfamily of Forkhead transcriptionfactors, which are orthologs of Caenorhabditis elegans Daf-16that are known to regulate longevity (31). Akt can phosphorylateand inactivate three FoxO proteins, FoxO1/FKHR, FoxO3a/FKHRL1,and FoxO4/AFX (32). In the presence of survival factors, Aktphosphorylates FoxO3a, leading to association with 14-3-3 proteins,nuclear exclusion, and retention of FoxO3a in the cytoplasm.Conversely, withdrawal of survival factors leads to FoxO3a dephosphorylation,nuclear translocation, and activation of FoxO target genes (32).FoxO3a regulates cell death by inducing the proapoptotic gene,Bim, in cancer cells, neurons, and endothelial progenitor cells(33–36). FoxO3a also protects cells from oxidant stressby upregulating the antioxidant gene manganese superoxide dismutase(MnSOD) (37). Cross-talk between TGF- and FoxO3a signaling hasbeen shown in the control of neuroepithelial and glioblastomacell proliferation (38). PDGF can induce FoxO3a phosphorylationin MC via PI3K/Akt (39), leading to inhibition of Fas ligandexpression.
Although TGF- activates the PI3K/Akt pathway also in MC andinhibition of PI3K or a dominant negative Akt construct couldinhibit TGF-–induced fibronectin expression (40), it isnot known whether TGF- regulates FoxO transcription factorsand their downstream targets in renal cells. In this study,we observed for the first time that TGF- induces phosphorylation-inducedtranscriptional inactivation of FoxO3a in MC via the PI3K pathwayand that this leads to decreased expression of its downstreamtargets, MnSOD and Bim. Furthermore, we noted increases in FoxO3aphosphorylation in renal cortical tissues of diabetic animals.Our results suggest that TGF-–induced inactivation ofFoxO3a may be a key additional novel mechanism in the pathogenesisof DN.
Cell Culture
Rat and mouse MC were obtained and cultured as described previously(12) in RPMI-1640 supplemented with 10% FBS. Recombinant humanTGF-1 was from R&D System (Minneapolis, MN). PI3K inhibitorLY294002 (LY) was from Calbiochem (La Jolla, CA).
Animals
All animal studies were conducted under a protocol approvedby the Institutional Research Animal Care Committee. Male Sprague-Dawleyrats received a single injection of 65 mg/kg streptozotocin(STZ) intraperitoneally. C57BL/6 mice (Jackson Laboratories,Bar Harbor, ME) received an injection of 50 mg/kg STZ intraperitoneallyon 5 consecutive days as described previously (41). Blood glucosewas measured to confirm the development of diabetes (fastingglucose >300 mg/dl). Rats and mice that received an injectionof diluent buffer alone served as control. All animals werekilled 2 or 16 wk after the onset of diabetes. Sieved glomerulifrom rat kidneys and cortical tissues from mouse kidneys wereremoved as described (41) and stored at –70°C forfurther study.
Western Blot Analysis
Cells and kidney tissues were lysed in SDS sample buffer (2%SDS, 10 mM Tris-HCl [pH 6.8], and 10% glycerol). Proteins wereseparated by SDS-PAGE, transferred to membranes, and detectedwith appropriate antibodies as described previously (42). Antibodiesagainst total FoxO3a, phospho253Ser-FoxO3a, Akt, GSK-3b, andactin were from Cell Signaling (Beverly, MA). Antibody againstphospho644Ser-FoxO3a was described previously (43). Blots werescanned using GS-800 densitometer, and bands were quantifiedwith Quantity One software (Bio-Rad Laboratory, Hercules, CA).
Reverse Transcriptase–PCR
Total RNA was extracted using STAT-60 according to the manufacturer’sinstructions (TEL-TEST Friendswood, TX). A total of 0.5 or 1µg of total RNA was subjected to reverse transcriptionusing GeneAmp RNA PCR Kit (Applied Biosystems, Foster City,CA). cDNA were PCR-amplified using appropriate primers. Primersequences used were as follows: Bim, forward GCCAAGCAACCTTCTGATGTAand reverse CAGTGCCTTCTCCAGACCAG; and MnSOD, forward GACCTGCCTTACGACTATGGand reverse GACCTTGCTCCTTATTGAAGC. 18S RNA was used as an internalcontrol in these relative reverse transcriptase–PCR. 18Sprimers were from Ambion (Austin, TX). PCR products were separatedon agarose gels and stained with ethidium bromide. Bands werequantified with Quantity One software and normalized to 18S.
Real-Time PCR
Real-time PCR was performed using SYBR Green PCR Master Mixand 7300 Realtime PCR System (Applied Biosystems), accordingto the manufacturer’s protocols.
Immunohistochemistry
Paraffin sections of rat and mouse kidneys were mounted ontopositive charged slides, deparaffinized, washed with water,blocked with Dako protein block (Dako, Carpinteria, CA), andincubated with x100 dilution of phospho253Ser-FoxO3a antibodyovernight. Slides were washed with Dako wash, treated with hydrogenperoxide for 5 min, washed with PBS, incubated with anti-rabbitand mouse secondary antibody conjugated with a peroxidase polymer(Dako), washed, and incubated with 3,3'-diaminobenzidine for8 min. Slides were counterstained in 50% Mayer’s hematoxylinfor 1 min.
Nuclear Translocation of FoxO3a-Green Fluorescence Protein
Rat MC were plated in 12-well dishes (100,000/well) and transfectedwith pFoxO3a–green fluorescence protein (GFP) fusion construct(43) using FuGENE 6 transfection reagent (Roche, Indianapolis,IN). Cells were serum-depleted and treated with TGF- or 10%FBS. Treated cells were fixed in 3% paraformaldehyde, and cellularlocalization of fusion protein was observed by fluorescencemicrocopy (Olympus, Tokyo, Japan). For detection of the nuclei,cells were stained with 0.2% Hoechst 33342 (Molecular Probes,Eugene, OR). Nuclear condensation also was detected by Hoechststaining.
Luciferase Assays
Rat or mouse MC were transfected with pFRE-luc (43) using FuGENE6 Transfection Reagent and treated with TGF- with or withoutPI3K inhibitor LY. After 24 h, luciferase activities were measuredusing Luciferase Assay System (Promega, Madison, WI) and TD-20/20luminometer (Turner Designs, Sunnyvale, CA), according to themanufacturer’s instructions. pCI-neo-HA-FoxO3a (wild-typeFoxO3a expression vector) and pECE-FoxO3a-(A)3 (Akt site mutant;T32A, S253A, and S315A) also used for reporter experiments weredescribed previously (43).
DNA Ladder Formation
Genomic DNA was extracted from cultured cells by standard methods(44). For the detection of genomic DNA fragmentation, 1 µgof purified DNA was run on 2% agarose gels, stained with 0.5µg/ml ethidium bromide, and visualized under ultravioletlight.
Phosphorylation of FoxO3a in Rat MC by TGF-
We first examined the effects of TGF- on the phosphorylationof FoxO3a, Akt, and GSK3b by Western blot analyses using phospho-specificantibodies. Figure 1 shows that treatment of rat MC with TGF-(10 ng/ml) increased the phosphorylation of Akt, FoxO3a (atSer 253, Akt phosphorylation site), and GSK3b (a known targetof Akt; Figure 1A). Increases in p-AKT and p-FoxO3a levels wereobserved as early as 5 min after TGF- treatment. Evidence showsthat FoxO3a also can be phosphorylated by IB-kinase (IKK) atSer644 (43). However, we did not observe any increase in FoxO3aphosphorylation of Ser644 (Figure 1A). Thus, TGF- seems to phosphorylateFoxO3a via Akt and not IKK.
Figure 1. TGF- induces Akt and FoxO3a phosphorylation in cultured mesangial cells in a phosphoinositide-3-kinase (PI3K)-dependent manner. (A) Immunoblotting analysis of rat mesangial cells (MC) after treatment with TGF- (10 ng/ml for 5 min to 24 h). TGF- increased phosphorylation of Akt, FoxO3a at Ser 253, and GSK3. No change in phosphorylation at Ser644 of FoxO3a was observed. (B) Pretreatment with a PI3K inhibitor, 20 µM of LY294002 (LY) for 1 h blocks, TGF-–induced FoxO3a phosphorylation. Results shown are representative of three to five experiments.
Akt is a downstream effector of PI3K (26,45). Because Akt isa major kinase that is known to phosphorylate FoxO3a, we testedwhether inhibition of PI3K can reduce FoxO3a phosphorylation.As expected, TGF-–induced FoxO3a phosphorylation was blockedin rat MC that were pretreated for 1 h with the PI3K inhibitorLY (Figure 1B).
FoxO3a Downstream Target Genes Are Inhibited by TGF- Treatment
Because FoxO3a transcriptional activity is lost upon phosphorylation,we next examined whether TGF- can downregulate the expressionof key FoxO target genes, namely Bim (a proapoptotic gene) andMnSOD (an antioxidant gene) by reverse transcriptase–PCRof total RNA that was isolated from TGF-–stimulated MC.Results showed that three isoforms of Bim (BimEL [extra long],BimL [long], and BimS [short]) were detected in the MC, andthe mRNA levels of all three isoforms were decreased by TGF-treatment (Figure 2A). The reduction in BimEL mRNA was significantat 6 and 24 h (Figure 2B). We next noted that these three Bimisoforms also were present in mouse MC (Figure 2C) under normalconditions (no treatment). This was increased by serum depletion,and TGF- treatment (6 and 24 h) clearly decreased the expressionof three isoforms (Figure 2C).
Figure 2. TGF- decreases the expression of a key FoxO target gene, the proapoptotic Bim, in MC. (A) Reverse transcriptase–PCR (RT-PCR) analysis of isoforms of the proapoptotic gene Bim in rat MC. Three splicing isoforms, BimEL (extra long), BimL (long), and BimS (short), were detected. TGF- treatment (6 and 24 h) decreased their expression. 18S was used as an internal control. (B) Relative expression of BimEL. Three independent cultures were studied at each time point. After 6 h of TGF- treatment, a significant decrease in the expression of BimEL was observed (*P < 0.01). (C) RT-PCR analysis of Bim isoforms in mouse MC. TGF- inhibits serum depletion–induced increase in expression of Bim isoforms in mouse MC. NT, no treatment; SD, serum depletion.
Figure 3, A and B show that MnSOD expression was similarly reducedin both rat and mouse MC that were treated with TGF-, and thiswas significant by 24 h. These results indicate that TGF- treatmentcan phosphorylate and inactivate FoxO3a and thereby can leadto the downregulation of FoxO3a target genes (Bim and MnSOD)in MC.
Figure 3. TGF- decreases the expression of manganese superoxide dismutase (MnSOD), another FoxO target and an antioxidant gene. Mouse MnSOD was quantified by real-time quantitative PCR with glyceraldehyde-3-phosphate dehydrogenase as internal control. TGF- treatment reduced MnSOD in rat MC (A) and mouse MC (B). Significant decrease was observed at 24 h (P < 0.01) in rat MC and at 24 h (P < 0.04) in mouse MC.
TGF- Treatment Induces Nuclear Exclusion of FoxO3a
Phosphorylated FoxO3a is excluded from nuclei and loses itstransactivating potential (32). For testing of whether TGF-can alter intracellular localization of FoxO3a, rat MC weretransfected with a plasmid that expresses FoxO3a-GFP fusionprotein (43). Transfected cells were serum-depleted, treatedwith TGF-, and fluorescence monitored to examine the nuclearlocalization of FoxO-GFP protein. Under normal growth conditionsin the presence of serum (control), FoxO3a was localized primarilyin the cytoplasm (Figure 4A). Serum depletion led to the nuclearaccumulation of FoxO3a (Figure 4B), and this was reversed byTGF- treatment, which led to nuclear exclusion (Figure 4C).Nuclei were identified by Hoechst staining (Figure 4, D throughF). These results indicate that, in the presence of serum, FoxO3ais phosphorylated, remains inactive, and is localized in cytoplasm.Serum depletion induces FoxO3a dephosphorylation and leads toits translocation into the nucleus, where it can induce theexpression of targets Bim and MnSOD, as shown previously (Figures 2and 3). TGF- treatment can reverse this effect by inducing FoxO3aphosphorylation and its nuclear exclusion, resulting in inhibitionof Bim and MnSOD expression as a result of FoxO3a inactivation.
Figure 4. TGF- leads to nuclear exclusion of FoxO3a in mesangial cells. Rat MC were transfected with a plasmid that express FoxO3a–green fluorescence protein (GFP) fusion protein, serum-depleted, and treated with TGF-. Under normal conditions (serum+), FoxO3a was localized in cytoplasm (A). Upon serum depletion, FoxO3a accumulated in nuclei (B) and TGF- treatment induced nuclear exclusion (C). Cells also were stained with Hoechst dye to visualize the nuclei (D through E).
Inhibition of Transcription from Forkhead Response Element by TGF-
Because we observed a decrease in the expression of FoxO3a targetgenes, as well as nuclear exclusion of FoxO3a by TGF- treatment,we next examined whether TGF- can reduce the transcriptionalactivity of FoxO. Rat and mouse MC were transfected with thereporter plasmid Forkhead response element (FRE)-Luc that containedluciferase reporter gene driven by an FRE (43) and determinedluciferase activity after treatment with or without TGF-. Figure 5shows that TGF- treatment significantly decreased the luciferaseactivity in both rat (Figure 5A) and mouse (Figure 5B) MC. BecausePI3K is the upstream kinase in TGF-–induced FoxO3a phosphorylation,we next examined involvement of PI3K in TGF-–mediatedinactivation of FoxO3a transcriptional activity. Pretreatmentof MC that were transfected with FRE-Luc with the PI3K inhibitorLY could restore the luciferase activity in TGF-–stimulatedcells (TGF+LY) to nearly the levels that were seen in controlcells (no treatment) in both rat and mouse MC (Figure 5, A andB). To test the direct involvement of FoxO3a, pCI-neo-FoxO3a-(A)3that contained mutations in three Akt phosphorylation sites(T32A, S253A, and S315A) was co-transfected with pFRE-luc (Figure 5C).Because this mutant cannot be phosphorylated by Akt, it actsas constitutively active FoxO3a and depicts much greater basalFRE-luc activity (almost seven-fold) than does wild-type FoxO3a(Figure 5C). Furthermore, as expected, unlike with WT-Foxo3a,FRE-luc reporter activity was not decreased by TGF- in cellsthat were transfected with FoxO3a-(A)3 (Figure 5C). These resultsfurther support the role of the PI3K/Akt pathway in mediatingTGF-–induced FoxO3 phosphorylation and transcriptionalinactivation.
Figure 5. TGF- decreases FoxO transcription activity in a PI3K-dependent manner in MC. Rat (A) and mouse (B) MC were transfected with a luciferase reporter plasmid that was driven by Forkhead responsive element (pFRE-luc) and treated with TGF-. Luciferase activity was decreased significantly by TGF- in MC (TGF) compared with no treatment (NT; control; P < 0.01 in rat MC and P < 0.02 in mouse MC). Pretreatment with the PI3K inhibitor restored the transcriptional activity (TGF+LY). LY treatment itself had no effect. (C) Wild-type (WT) and Akt site mutants (FoxO3a-[A]3) were co-transfected with pFRE-luc. FRE-luc reporter activity was greater with mutant than WT FoxO3a (7.5-fold). Significant decrease (P < 0.02) of reporter activity was detected with TGF- in rat MC that were transfected with WT FoxO3a but not FoxO3a-(A)3.
TGF- Supports MC Survival
Because we noted a significant decrease in the expression ofBim, a key proapoptotic gene, we hypothesized that TGF- (ordiabetic conditions) can promote MC survival. We therefore testedwhether TGF- can reverse serum depletion–induced apoptosisin MC. We first evaluated the appearance of condensed nuclei,a key marker of cellular apoptosis. As expected, serum depletionof mouse MC increased the number of condensed nuclei relativeto control (Figure 6), and this was reversed significantly byTGF- (Figure 6, Table 1). We then examined DNA ladder formation,another index of apoptosis. Serum-depleted mouse MC showed clearlyincreased DNA ladder formation, and TGF- treatment could reversethis (Figure 7). These results support our hypothesis that TGF-protects MC from serum depletion–induced apoptosis, andthis could be via FoxO3a inactivation.
Figure 6. TGF- inhibits nuclear condensation in mouse MC. Serum-depleted mouse MC were treated with TGF- and stained with Hoechst. In the absence of serum, a marked increase in the number of condensed nuclei (arrowheads) was observed (B) compared with normal condition (A). TGF- treatment reduced the number of condensed nuclei (C).
Figure 7. TGF- inhibits DNA ladder formation in mouse MC. Mouse MC were serum-depleted and/or treated with TGF- for 24 h and genomic DNA was extracted and separated on 2% agarose gels. In the absence of serum, a significant increase in DNA ladder formation was observed (serum depletion) compared with normal conditions (control). TGF- treatment reduced the DNA ladder formation that was induced by serum starvation. Results are representative of three independent experiments.
Phosphorylation of FoxO3a in Kidneys of Diabetic Rats and Mice
To examine further the potential relationship to DN and in vivorelevance, we next examined whether FoxO3a phosphorylation levelswere altered in glomeruli and cortical tissues from diabeticrats and mice, respectively. Figure 8A shows results of immunoblottingwith antibodies to p-FoxO3a and p-Akt in glomeruli that wereobtained from control and STZ-induced diabetic rats (2 wk afteronset of diabetes). Quantification of data shows that levelsof p-Akt (Figure 8B) and pFoxO3a (Figure 8C) were increasedsignificantly (eight-fold and four-fold, respectively) in glomeruliof diabetic rats relative to those from controls. However, therewas no difference in FoxO1 phosphorylation (Figure 8A). Furthermore,p-Foxo3a immunostaining was markedly increased in STZ-induceddiabetic rat glomeruli, and, interestingly, most of the p-FoxO3astaining and localization were cytoplasmic and not nuclear (Figure 8D).These results suggest that diabetic conditions, which usuallyare associated with increased TGF- levels, may induce PI3K andAkt activation, leading to FoxO3a phosphorylation and its nuclearexclusion and inactivation.
Figure 8. Akt activation and FoxO3a phosphorylation in glomeruli from streptozotocin (STZ)-induced diabetic rats. (A) Immunoblotting analysis. Sieved glomeruli from healthy (control) and STZ-induced (STZ) diabetic rats were studied. Clear increase of Akt activation and FoxO3a phosphorylation (but not FoxO1) was observed in STZ-induced diabetic rats after 2 wk of diabetes. (B and C) Ratio of the p-Akt/total Akt (B) and p-FoxO3a/total FoxO3a (C) showed an eight-fold increase of p-Akt (P < 0.01) and a four-fold increase of p-FoxO3a (P < 0.05) in diabetic rats compared with control rats. (D) Immunohistochemistry of p-FoxO3a. Renal cortical sections from control or STZ-treated rats (STZ) were stained with anti–phospho253Ser-FoxO3a antibody (brown) and counterstained with hematoxylin (blue color). Strong extensive staining in cytoplasm was noted in STZ kidney with only very weak staining in control rat kidney.
We also tested cortical tissues from diabetic mice and foundclear increases in p-Akt and p-FoxO3a levels in the 2-wk diabeticmice similar to rats (Figure 9A). These effects on Akt phosphorylation(approximately 10-fold) and FoxO3a phosphorylation (four-fold)were significantly greater in STZ-induced diabetic mouse cortexat 2 wk compared with control healthy mouse cortex (Figure 9,B and C, respectively). Unlike rat glomeruli, we noted a modestincrease of FoxO1 phosphorylation in mouse cortical tissues(Figure 9A). Immunostaining of mouse cortex showed a markedincrease of p-FoxO3a staining, and, similar to diabetic ratglomeruli, it mainly was cytoplasmic in nature.
Figure 9. Akt activation and phosphorylation of FoxO3a in STZ-induced diabetic mice. (A) Immunoblotting analysis. Lysates of cortical tissues from four independent control and STZ-induced diabetic mice were immunoblotted with indicated antibodies. A clear increase of Akt activation and FoxO3a phosphorylation was observed in cortical tissues of STZ-induced diabetic mice 2 wk after the onset of diabetes. (B and C) Ratio of the p-Akt/total Akt (B) and p-FoxO3a/total FoxO3a (C) showed a 10-fold increase of p-Akt (P < 0.01) and a four-fold increase of p-FoxO3a (P < 0.001) in diabetic mice compared with control mice. (D) Immunohistochemistry of p-FoxO3a. Anti–phospho253Ser-FoxO3a antibody was used for staining (brown) of 3,3'-diaminobenzidine. The slides were counterstained in hematoxylin (blue color). Stronger cytoplasmic staining was detected in STZ-diabetic mouse kidney (STZ) than in control.
We next examined whether these changes were sustained at 16wk after the onset of diabetes in mice. It is interesting thatno clear differences in p-Akt or p-FoxO3a levels were observedbetween control and STZ-induced diabetic mouse cortex at 16wk (data not shown). Therefore, Akt activation and FoxO3a phosphorylationmay be key events in early DN but not in the later stages.
Several lines of evidence have demonstrated that TGF- playsa key role in the pathogenesis of DN. This has been attributedto multiple downstream effects of TGF-. In this study, we provideevidence for a novel role of the PI3K/Akt/FoxO3a pathway inthe MC dysfunction that is induced by TGF-. TGF- treatment ofMC induced Akt activation and phosphorylation of FoxO3a at Ser253(Akt) site but not at Ser644 (IKK site; Figure 1). Phosphorylationof FoxO3a by IKK has been related to malignancy or poor prognosisof cancer patients (43). Therefore, the regulation of FoxO3ain MC by TGF- may be different from that in cancer cells. Aktmost likely is the kinase that phosphorylates FoxO3a in ourstudy because we detected both Akt activation and serine 253phosphorylation of FoxO3a in MC that were treated with TGF-.In MC, the PI3K-Akt pathway is activated by TGF- and implicatedin the expression of collagen type 1 a2 gene (27) and also fibronectinexpression (40) and thus also may mediate the profibrotic effectsof TGF-. TGF- activates the PI3K/Akt pathway in several celltypes (27,28,40), including MC. On the contrary, in hematopoieticcells, TGF- family members induce apoptosis through expressionof the phosphatase SHIP, which inhibits Akt activation (46).In this study, we noted that TGF- activates Akt, phosphorylatesand inactivates FoxO3a, decreases the expression of the proapoptoticgene Bim, and supports MC survival. Therefore, the effects ofTGF-via the PI3K pathway may be cell-type specific. It hasbeen suggested that TGF- activates the PI3K/Akt pathway viaa direct interaction of TGF- receptors and PI3K (29,30). Activationof TGF- receptor serine threonine kinase can stimulate the PI3K/Aktpathway in MC (40). Our study supports the involvement of PI3K,because a PI3K inhibitor blocked TGF-–induced Akt activation,FoxO3a phosphorylation, and FoxO transcriptional activity. PDGFalso has been shown to inactivate FoxO family proteins via Aktin MC (39).
Phosphorylation of FoxO3a causes nuclear exclusion and its associationwith 14-3-3. In the absence of survival factors, FoxO3a is dephosphorylated,translocated to nuclear, and activates target genes (32) thatinclude the proapoptotic Bim gene (33–36). FoxO3a alsoprotects cells from oxidant stress by upregulating MnSOD (37).We observed that, along with FoxO3a phosphorylation in MC, TGF-decreased the expression of Bim and MnSOD. It is interestingthat we also observed that phosphorylation of Akt and FoxO3awere increased in glomeruli and cortical tissues of STZ-induceddiabetic rats and mice. Because evidence shows that TGF- levelsare increased in these diabetic tissues (7,13,14), our datasuggest that the results that are seen with TGF-–treatedMC in vitro reflect a similar diabetic renal disease situationin animal models.
It is interesting that we noted increases in FoxO3a phosphorylationin the STZ-injected mice only at 2 wk and not at 16 wk afterthe onset of diabetes. FoxO3a inactivation may be more relatedto the pathogenesis of early and not late stages of DN. Becauseearly stages of diabetes and DN are associated with MC accumulationand proliferation (along with hypertrophy) but not later stages,the downregulation of proapoptotic genes as a result of FoxO3ainactivation may be a key factor that mediates this MC survivalin early DN. An increase in MC number has been noted in bothtype 1 and type 2 diabetic rodent models (47). Agents such asstatins have been suggested to slow the progression of diabeticglomerulopathy by reducing MC proliferation and enhancing apoptosis(48). MC proliferation via cell-cycle changes can occur as aresponse to injury (49). Unopposed MC cell proliferation mayaccount for rapid progression to ESRD. Although ECM deposition,fibrotic effects, and hypertrophy are major effects of agentsthat are involved in the pathogenesis of DN, they also can accelerateprogression by contributing to MC survival. Our data now indicatethat the downregulation of FoxO3a-dependent proapoptotic genesin early DN may be a key mechanism. In addition, the inactivationof FoxO3a was accompanied by a decrease in MnSOD expression.This can render the MC cells more sensitive to oxidant stressand thereby accelerate renal dysfunction that is associatedwith DN and other renal diseases.
In this study, TGF- treatment also led to nuclear exclusionand cytoplasmic accumulation of FoxO3a in MC. TGF- also decreasedthe transcriptional activity of FoxO. This was reversed by aPI3K inhibitor. This is consistent with the observation of decreasedexpression of the FoxO target genes Bim and MnSOD in TGF-–treatedMC. Cytoplasmic phospho-FoxO3a levels also were increased inSTZ-induced diabetic rodent kidneys. TGF-–induced decreasein Foxo transcriptional activity was abrogated by an Akt phosphorylationmutant of FoxO3a, further confirming that FoxO3a is a majorplayer in TGF-–mediated signaling via PI3K/Akt in MC.
We also noted that TGF- can protect MC from serum depletion–inducedapoptosis and hence act as a survival factor for MC at leastunder some conditions. This is supported by the data showingthat TGF- decreases the expression of the proapoptotic geneBim via the PI3K/Akt pathway. It has been reported that thePI3K/Akt pathway can act as a survival and antiapoptotic signalin MC (50). Taken together, our results suggest that diabeticconditions and stimuli such as TGF- can induce hyperphosphorylationand inactivation of FoxO3a, and this can lead to MC survivaland oxidant stress. Tubulointerstitial disease also is a significantdeterminant of chronic kidney disease in diabetes. Because evidenceshows that TGF-–induced epithelial to mesenchymal transitionis mediated by PI3K/Akt (28), the TGF-/PI3K/Akt/FoxO3a pathwaydescribed in this study also may be relevant to the pathogenesisof tubulointerstitial disease that is associated with DN.
Several mediators, including Smads, p38, extracellular signal–regulatedkinase, and MAPK are known major effectors of TGF- (12,16,17,22–25).Our studies now add FoxO3a to this list as an important neweffector that could be related to the pathogenic role of TGF-in DN. Taken together, TGF- signaling activates at least twopathways via PI3K/Akt (Figure 10). One pathway can enhance Smad3or MAPK-mediated accumulation of ECM proteins, and the otherpathway can decrease Bim and MnSOD expression via FoxO3a phosphorylation.These signaling events were noted not only in vitro in MC butalso in vivo in rat and mouse models of diabetes, especiallyin the early stages. Cooperation between these two TGF-–stimulatedpathways can greatly augment ECM accumulation, cell survival,and oxidant stress. These new results suggest that Akt/FoxOpathway regulation may be a novel mechanism by which TGF- caninduce unopposed MC survival and oxidant stress in early DN,thereby accelerating renal disease.
Figure 10. Mechanism of the pathogenesis of diabetic nephropathy mediated by TGF-. Diabetic conditions can increase TGF- expression in MC. TGF- activates p38 mitogen-activated protein kinase, extracellular signal–regulated kinases, PI3K, Akt, and Smads and leads to an increase in extracellular matrix (ECM) genes such as collagen in MC. Cross-talk between Akt and Smad can augment collagen gene expression. Conversely, Akt activation by TGF- also can induce FoxO3a phosphorylation and inactivation that results in decrease of Bim and MnSOD. This can result in increased cell survival and oxidant stress. Cooperation between these two TGF-–regulated pathways, Smad (ECM accumulation) and FoxO3a (cell survival and oxidant stress), may accelerate kidney dysfunction.
Acknowledgments
This work was supported by Grants from the National Institutesof Health (National Institute of Diabetes and Digestive andKidney Diseases) and the Juvenile Diabetes Research Foundation(to R.N.).
We are grateful to all members of the Natarajan laboratory forhelpful discussions.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
Ayo SH, Radnik RA, Glass WF 2nd, Garoni JA, Rampt ER, Appling DR, Kreisberg JI: Increased extracellular matrix synthesis and mRNA in mesangial cells grown in high-glucose medium.
Am J Physiol 260
: F185
–F191, 1991[Medline]
Pugliese G, Pricci F, Pugliese F, Mene P, Lenti L, Andreani D, Galli G, Casini A, Bianchi S, Rotella CM, et al.: Mechanisms of glucose-enhanced extracellular matrix accumulation in rat glomerular mesangial cells.
Diabetes 43
: 478
–490, 1994[Abstract]
Ihm CG, Lee GS, Nast CC, Artishevsky A, Guillermo R, Levin PS, Glassock RJ, Adler SG: Early increased renal procollagen alpha 1(IV) mRNA levels in streptozotocin induced diabetes.
Kidney Int 41
: 768
–777, 1992[Medline]
Kitamura M, Kitamura A, Mitarai T, Maruyama N, Nagasawa R, Kawamura T, Yoshida H, Takahashi T, Sakai O: Gene expression of metalloproteinase and its inhibitor in mesangial cells exposed to high glucose.
Biochem Biophys Res Commun 185
: 1048
–1054, 1992[CrossRef][Medline]
Nakamura T, Fukui M, Ebihara I, Osada S, Tomino Y, Koide H: Abnormal gene expression of matrix metalloproteinases and their inhibitor in glomeruli from diabetic rats.
Ren Physiol Biochem 17
: 316
–325, 1994[Medline]
Yamamoto T, Nakamura T, Noble NA, Ruoslahti E, Border WA: Expression of transforming growth factor beta is elevated in human and experimental diabetic nephropathy.
Proc Natl Acad Sci U S A 90
: 1814
–1818, 1993[Abstract/Free Full Text]
Sharma K, Ziyadeh FN: Hyperglycemia and diabetic kidney disease. The case for transforming growth factor-beta as a key mediator.
Diabetes 44
: 1139
–1146, 1995[Abstract]
Anderson PW, Zhang XY, Tian J, Correale JD, Xi XP, Yang D, Graf K, Law RE, Hsueh WA: Insulin and angiotensin II are additive in stimulating TGF-beta 1 and matrix mRNAs in mesangial cells.
Kidney Int 50
: 745
–753, 1996[Medline]
Rincon-Choles H, Kasinath BS, Gorin Y, Abboud HE: Angiotensin II and growth factors in the pathogenesis of diabetic nephropathy.
Kidney Int Suppl 82
: 8
–11, 2002[Medline]
Hoffman BB, Sharma K, Zhu Y, Ziyadeh FN: Transcriptional activation of transforming growth factor-beta1 in mesangial cell culture by high glucose concentration.
Kidney Int 54
: 1107
–1116, 1998[CrossRef][Medline]
Chen S, Cohen MP, Lautenslager GT, Shearman CW, Ziyadeh FN: Glycated albumin stimulates TGF-beta 1 production and protein kinase C activity in glomerular endothelial cells.
Kidney Int 59
: 673
–681, 2001[CrossRef][Medline]
Kim YS, Xu ZG, Reddy MA, Li SL, Lanting L, Sharma K, Adler SG, Natarajan R: Novel interactions between TGF-beta1 actions and the 12/15-lipoxygenase pathway in mesangial cells.
J Am Soc Nephrol 16
: 352
–362, 2005[Abstract/Free Full Text]
Reeves WB, Andreoli TE: Transforming growth factor beta contributes to progressive diabetic nephropathy.
Proc Natl Acad Sci U S A 97
: 7667
–7669, 2000[Free Full Text]
Sharma K, Ziyadeh FN, Alzahabi B, McGowan TA, Kapoor S, Kurnik BR, Kurnik PB, Weisberg LS: Increased renal production of transforming growth factor-beta1 in patients with type II diabetes.
Diabetes 46
: 854
–859, 1997[Abstract]
Douthwaite JA, Johnson TS, Haylor JL, Watson P, El Nahas AM: Effects of transforming growth factor-beta1 on renal extracellular matrix components and their regulating proteins.
J Am Soc Nephrol 10
: 2109
–2119, 1999[Abstract/Free Full Text]
Poncelet AC, Schnaper HW: Regulation of human mesangial cell collagen expression by transforming growth factor-beta1.
Am J Physiol 275
: F458
–F466, 1998[Medline]
Tsuchida K, Zhu Y, Siva S, Dunn SR, Sharma K: Role of Smad4 on TGF-beta-induced extracellular matrix stimulation in mesangial cells.
Kidney Int 63
: 2000
–2009, 2003[CrossRef][Medline]
Ziyadeh FN, Hoffman BB, Han DC, Iglesias-De La Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, Sharma K: Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal anti transforming growth factor-beta antibody in db/db diabetic mice.
Proc Natl Acad Sci U S A 97
: 8015
–8020, 2000[Abstract/Free Full Text]
Zhang Y, Feng X, We R, Derynck R: Receptor-associated Mad homologues synergize as effectors of the TGF-beta response.
Nature 383
: 168
–172, 1996[CrossRef][Medline]
Roberts AB, McCune BK, Sporn MB: TGF-beta: Regulation of extracellular matrix.
Kidney Int 41
: 557
–559, 1992[Medline]
Yang YC, Piek E, Zavadil J, Liang D, Xie D, Heyer J, Pavlidis P, Kucherlapati R, Roberts AB, Bottinger EP: Hierarchical model of gene regulation by transforming growth factor beta.
Proc Natl Acad Sci U S A 100
: 10269
–10274, 2003[Abstract/Free Full Text]
Schiffer M, Schiffer LE, Gupta A, Shaw AS, Roberts IS, Mundel P, Bottinger EP: Inhibitory smads and TGF-beta signaling in glomerular cells.
J Am Soc Nephrol 13
: 2657
–2666, 2002[Abstract/Free Full Text]
Poncelet AC, Schnaper HW: Sp1 and Smad proteins cooperate to mediate transforming growth factor-beta 1-induced alpha 2(I) collagen expression in human glomerular mesangial cells.
J Biol Chem 276
: 6983
–6992, 2001[Abstract/Free Full Text]
Chin BY, Mohsenin A, Li SX, Choi AM, Choi ME: Stimulation of pro-alpha(1)(I) collagen by TGF-beta(1) in mesangial cells: role of the p38 MAPK pathway.
Am J Physiol Renal Physiol 280
: F495
–F504, 2001[Abstract/Free Full Text]
Hayashida T, Poncelet AC, Hubchak SC, Schnaper HW: TGF-beta1 activates MAP kinase in human mesangial cells: A possible role in collagen expression.
Kidney Int 56
: 1710
–1720, 1999[CrossRef][Medline]
Garcia Z, Kumar A, Marques M, Cortes I, Carrera AC: Phosphoinositide 3-kinase controls early and late events in mammalian cell division.
EMBO J 25
: 655
–661, 2006[CrossRef][Medline]
Runyan CE, Schnaper HW, Poncelet AC: The phosphatidylinositol 3-kinase/Akt pathway enhances Smad3-stimulated mesangial cell collagen I expression in response to transforming growth factor-beta1.
J Biol Chem 279
: 2632
–2639, 2004[Abstract/Free Full Text]
Bakin AV, Tomlinson AK, Bhowmick NA, Moses HL, Arteaga CL: Phosphatidylinositol 3-kinase function is required for transforming growth factor beta-mediated epithelial to mesenchymal transition and cell migration.
J Biol Chem 275
: 36803
–36810, 2000[Abstract/Free Full Text]
Krymskaya VP, Hoffman R, Eszterhas A, Ciocca V, Panettieri RA Jr: TGF-beta 1 modulates EGF-stimulated phosphatidylinositol 3-kinase activity in human airway smooth muscle cells.
Am J Physiol 273
: L1220
–L1227, 1997[Medline]
Yi JY, Shin I, Arteaga CL: Type I transforming growth factor beta receptor binds to and activates phosphatidylinositol 3-kinase.
J Biol Chem 280
: 10870
–10876, 2005[Abstract/Free Full Text]
Accili D, Arden KC: FoxOs at the crossroads of cellular metabolism, differentiation, and transformation.
Cell 117
: 421
–426, 2004[CrossRef][Medline]
Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME: Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor.
Cell 96
: 857
–868, 1999[CrossRef][Medline]
Sunters A, Fernandez de Mattos S, Stahl M, Brosens JJ, Zoumpoulidou G, Saunders CA, Coffer PJ, Medema RH, Coombes RC, Lam EW: FoxO3a transcriptional regulation of Bim controls apoptosis in paclitaxel-treated breast cancer cell lines.
J Biol Chem 278
: 49795
–49805, 2003[Abstract/Free Full Text]
Essafi A, Fernandez de Mattos S, Hassen YA, Soeiro I, Mufti GJ, Thomas NS, Medema RH, Lam EW: Direct transcriptional regulation of Bim by FoxO3a mediates STI571-induced apoptosis in Bcr-Abl-expressing cells.
Oncogene 24
: 2317
–2329, 2005[CrossRef][Medline]
Gilley J, Coffer PJ, Ham J: FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons.
J Cell Biol 162
: 613
–622, 2003[Abstract/Free Full Text]
Urbich C, Knau A, Fichtlscherer S, Walter DH, Bruhl T, Potente M, Hofmann WK, de Vos S, Zeiher AM, Dimmeler S: FOXO-dependent expression of the proapoptotic protein Bim: Pivotal role for apoptosis signaling in endothelial progenitor cells.
FASEB J 19
: 974
–976, 2005[Abstract/Free Full Text]
Seoane J, Le HV, Shen L, Anderson SA, Massague J: Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation.
Cell 117
: 211
–223, 2004[CrossRef][Medline]
Ghosh Choudhury G, Lenin M, Calhaun C, Zhang JH, Abboud HE: PDGF inactivates forkhead family transcription factor by activation of Akt in glomerular mesangial cells.
Cell Signal 15
: 161
–170, 2003[CrossRef][Medline]
Ghosh Choudhury G, Abboud HE: Tyrosine phosphorylation-dependent PI 3 kinase/Akt signal transduction regulates TGFbeta-induced fibronectin expression in mesangial cells.
Cell Signal 16
: 31
–41, 2004[CrossRef][Medline]
Xu ZG, Li SL, Lanting L, Kim YS, Shanmugam N, Reddy MA, Natarajan R: Relationship between 12/15-lipoxygenase and COX-2 in mesangial cells: Potential role in diabetic nephropathy.
Kidney Int 69
: 512
–519, 2006[CrossRef][Medline]
Reddy MA, Thimmalapura PR, Lanting L, Nadler JL, Fatima S, Natarajan R: The oxidized lipid and lipoxygenase product 12(S)-hydroxyeicosatetraenoic acid induces hypertrophy and fibronectin transcription in vascular smooth muscle cells via p38 MAPK and cAMP response element-binding protein activation. Mediation of angiotensin II effects.
J Biol Chem 277
: 9920
–9928, 2002[Abstract/Free Full Text]
Hu MC, Lee DF, Xia W, Golfman LS, Ou-Yang F, Yang JY, Zou Y, Bao S, Hanada N, Saso H, Kobayashi R, Hung MC: IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a.
Cell 117
: 225
–237, 2004[CrossRef][Medline]
Sambrook J, Fritsch E, Maniatis T:
Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, 1989
Cully M, You H, Levine AJ, Mak TW: Beyond PTEN mutations: The PI3K pathway as an integrator of multiple inputs during tumorigenesis.
Nat Rev Cancer 6
: 184
–192, 2006[CrossRef][Medline]
Valderrama-Carvajal H, Cocolakis E, Lacerte A, Lee EH, Krystal G, Ali S, Lebrun JJ: Activin/TGF-beta induce apoptosis through Smad-dependent expression of the lipid phosphatase SHIP.
Nat Cell Biol 4
: 963
–969, 2002[CrossRef][Medline]
Gross ML, Ritz E, Schoof A, Adamczak M, Koch A, Tulp O, Parkman A, El-Shakmak A, Szabo A, Amann K: Comparison of renal morphology in the Streptozotocin and the SHR/N-cp models of diabetes.
Lab Invest 84
: 452
–464, 2004[CrossRef][Medline]
Okada M, Yanagida H, Kuwajima H, Takemura T: Antiproliferative effect of fluvastatin and thiazolidinedione in mesangial cells of diabetic rats.
Pediatr Nephrol 19
: 26
–32, 2004[CrossRef][Medline]
Marshall CB, Shankland SJ: Cell cycle and glomerular disease: A minireview.
Nephron Exp Nephrol 102
: e39
–e48, 2006[CrossRef][Medline]
Shimamura H, Terada Y, Okado T, Tanaka H, Inoshita S, Sasaki S: The PI3-kinase-Akt pathway promotes mesangial cell survival and inhibits apoptosis in vitro via NF-kappa B and Bad.
J Am Soc Nephrol 14
: 1427
–1434, 2003[Abstract/Free Full Text]
This article has been cited by other articles:
L. Sun, P. Xie, J. Wada, N. Kashihara, F.-y. Liu, Y. Zhao, D. Kumar, S. S. Chugh, F. R. Danesh, and Y. S. Kanwar Rap1b GTPase Ameliorates Glucose-Induced Mitochondrial Dysfunction
J. Am. Soc. Nephrol.,
December 1, 2008;
19(12):
2293 - 2301.
[Abstract][Full Text][PDF]
J. Zdychova, L. Kazdova, T. Pelikanova, J. N. Lindsley, S. Anderson, and R. Komers Renal Activity of Akt Kinase in Obese Zucker Rats
Experimental Biology and Medicine,
October 1, 2008;
233(10):
1231 - 1241.
[Abstract][Full Text][PDF]
H. Yuan, L. Lanting, Z.-G. Xu, S.-L. Li, P. Swiderski, S. Putta, M. Jonnalagadda, M. Kato, and R. Natarajan Effects of cholesterol-tagged small interfering RNAs targeting 12/15-lipoxygenase on parameters of diabetic nephropathy in a mouse model of type 1 diabetes
Am J Physiol Renal Physiol,
August 1, 2008;
295(2):
F605 - F617.
[Abstract][Full Text][PDF]
C. Dufour, X. Holy, and P. J. Marie Transforming growth factor-{beta} prevents osteoblast apoptosis induced by skeletal unloading via PI3K/Akt, Bcl-2, and phospho-Bad signaling
Am J Physiol Endocrinol Metab,
April 1, 2008;
294(4):
E794 - E801.
[Abstract][Full Text][PDF]
M. Kato, J. Zhang, M. Wang, L. Lanting, H. Yuan, J. J. Rossi, and R. Natarajan MicroRNA-192 in diabetic kidney glomeruli and its function in TGF-beta-induced collagen expression via inhibition of E-box repressors
PNAS,
February 27, 2007;
104(9):
3432 - 3437.
[Abstract][Full Text][PDF]
1–Mediated Mesangial Cell Dysfunction: A Novel Mechanism Related to Diabetic Kidney Disease
Top
Abstract
Introduction
is increased in MC under diabetic conditions and in DN and activates key signaling pathways, including the phosphoinositide-3-kinase/Akt (PI3K/Akt) pathway. FoxO transcription factors play roles in cell survival and oxidative stress and are negatively regulated by Akt-mediated phosphorylation. We tested whether phosphorylation-mediated inactivation of FoxO3a by TGF-
B-kinase (IKK) at Ser644 (43). However, we did not observe any increase in FoxO3a phosphorylation of Ser644 (Figure 1A). Thus, TGF-
