Chloride/Bicarbonate Exchanger SLC26A7 Is Localized in Endosomes in Medullary Collecting Duct Cells and Is Targeted to the Basolateral Membrane in Hypertonicity and Potassium Depletion
Jie Xu*,
Roger T. Worrell,
Hong C. Li*,
Sharon L. Barone*,
Snezana Petrovic*,
Hassane Amlal* and
Manoocher Soleimani*,
Departments of* Medicine and Surgery, University of Cincinnati, and Veterans Affairs Medical Center at Cincinnati, Cincinnati, Ohio
Address correspondence to: Dr. Manoocher Soleimani, Division of Nephrology and Hypertension, Department of Medicine, University of Cincinnati, 231 Albert Sabin Way, MSB 259G, Cincinnati, OH 45267-0585. Phone: 513-558-5471; Fax: 513-558-4309; E-mail: manoocher.soleimani{at}uc.edu
Received for publication November 9, 2005.
Accepted for publication January 26, 2006.
SLC26A7 is a Cl–/HCO3– exchanger that is expressedon the basolateral membrane and in the cytoplasm of two distinctacid-secreting epithelial cells: The A-intercalated cells inthe kidney outer medullary collecting duct and the gastric parietalcells. The intracellular localization of SLC26A7 suggests thepossibility of trafficking between cell membrane and intracellularcompartments. For testing this hypothesis, full-length humanSLC26A7 cDNA was fused with green fluorescence protein and transientlyexpressed in MDCK epithelial cells. In monolayer cells in isotonicmedium, SLC26A7 showed punctate distribution throughout thecytoplasm. However, in medium that was made hypertonic for 16h, SLC26A7 was detected predominantly in the plasma membrane.The presence of mitogen-activated protein kinase inhibitorsblocked the trafficking of SLC26A7 to the plasma membrane. Double-labelingstudies demonstrated the localization of SLC26A7 to the transferrinreceptor–positive endosomes. A chimera that was composedof the amino terminal fragment of SLC26A7 and the carboxyl terminalfragment of SLC26A1, and a C-terminal–truncated SLC26A7were retained in the cytoplasm in hypertonicity. In separatestudies, SLC26A7 showed predominant localization in plasma membranein potassium-depleted isotonic medium (0.5 or 2 mEq/L KCl) versuscytoplasmic distribution in normal potassium isotonic medium(4 mEq/L). It is concluded that SLC26A7 is present in endosomes,and its targeting to the basolateral membrane is increased inhypertonicity and potassium depletion. The trafficking to thecell surface suggests novel functional upregulation of SLC26A7in states that are associated with hypokalemia or increasedmedullary tonicity. Additional studies are needed to ascertainthe role of SLC26A7 in enhanced bicarbonate absorption in outermedullary collecting duct in hypokalemia and in acid-base regulationin conditions that are associated with increased medullary tonicity.
The solute carrier families 4 and 26 (SLC4 and SLC26, respectively)encode two distinct groups of anion exchangers. Several membersof the SLC4 family, designated as A1 (SLC4A1AE1), A2 (SLC4A2AE2),A3 (SLC4A3AE3), and A4 (SLC4A9AE4) are shown to mediate Cl–/HCO3–exchange (1, 2). SLC26 is a new family of anion exchangers thatis composed of 10 distinct genes (3). Members of the SLC26 familydisplay very specific and limited tissue distribution. Functionalstudies demonstrate that a number of exchangers from this family,including SLC26A3 (DRA), SLC26A4 (pendrin), SLC26A6 (PAT1 orCFEX), SLC26A7, and SLC26A9 (4–9) mediate Cl–/HCO3–exchange. SLC26A4, A6, and A7 are expressed in the kidney, whereasSLC26A3 and A9 are not. In the kidney, SLC26A4 (pendrin) isexpressed on the apical membranes of B-intercalated and non-Anon-B–intercalated cells, whereas SLC26A6 (PAT1 or CFEX)is expressed on the brush border membranes of the proximal tubule.In the kidney, pendrin mediates bicarbonate secretion and chloridereabsorption in the connecting segment and cortical collectingduct (5, 10–12), whereas PAT1 is involved in transcellularchloride reabsorption in the proximal tubule (6, 13–16).
SLC26A7 is a recently cloned member of the SLC26 family (17,18).Functional and molecular studies from our laboratory demonstratedthat SLC26A7 is a chloride/bicarbonate exchanger (7). In thestomach, SLC26A7 is expressed on the basolateral membrane ofthe acid-secreting gastric parietal cells (7), whereas in thekidney, it localizes on the basolateral membrane of acid-secretingA-intercalated (A-IC) cells of the outer medullary collectingduct (OMCD) (8, 19). OMCD has the highest rate of acid secretionamong the collecting duct segments (20). Proton (acid) secretionacross the apical membrane of A-IC cells in OMCD via vacuolarH+-ATPase (and to some extent via H+/K+ ATPase) results in thegeneration of intracellular bicarbonate, which will be transportedacross the basolateral membrane into the peritubular space viabasolateral Cl–/HCO3– exchanger (20, 21). SLC26A7co-localizes with AE1 (SLC4A1) on the basolateral membrane ofA-IC cells of OMCD, indicating possible distinct roles for thesetwo Cl–/HCO3– exchangers in acid secretion and bicarbonateabsorption (8, 19). A recent study indicated that SLC26A7 canfunction as a Cl– channel that is regulated by intracellularpH in the heterologous expression system (22). The reason forthe discrepancy between those results and our observations thatconsistently demonstrate mediation of Cl–/HCO3–exchange by SLC26A7 is currently unclear. The discrepancy maybe due in part to the utilization of different expression systemsas well as differences in the interpretation of the results.In support of this latter possibility, removal of perfusatechloride resulted in cell alkalinization in SLC26A7-expressingHEK 293 cells (22), an observation that is consistent with SLC26A7’sbeing a Cl–/HCO3– exchanger. Expression of humanSLC26A7 in Xenopus oocytes increased chloride-dependent cellalkalinization in the presence of CO2/HCO3–, supportingthe role of SLC26A7 as a Cl–/HCO3– exchanger (S.L.Alper, Harvard Medical School, personal communication, February2005).
Our immunofluorescent labeling studies in kidney and stomachdemonstrated that in addition to membrane localization, SLC26A7shows abundant cytoplasmic, submembrane localization, raisingthe possibility that alteration in trafficking between cellmembrane and intracellular compartments may be a major mechanismof functional regulation of this anion exchanger. Toward thisend, epitope-tagged SLC26A7 cDNA was expressed in MDCK epithelialcells that were exposed to hypertonicity or potassium depletionand visualized by confocal microscopy. Our results demonstratethat SLC26A7 is present in recycling endosomes in the cytoplasmin isotonic normal medium but is moved to the membrane in hypertonicor potassium-depleted medium. The significance of the resultsis discussed.
Construction of Epitope-Tagged SLC26A7, C-Terminal–Truncated SLC26A7, Full-Length SLC26A1, and A7/A1 Chimera
The full-length and C-terminal–truncated SLC26A7 weregenerated by PCR, using the human full-length SLC26A7 DNA (5280bp and 656 amino acid [aa] residues; Genebank NM_052832). TheSLC26A1 (2773 bp and 704 aa residues; Genebank AF349043) andSLC26A7/A1 chimera were generated using mouse cDNA as templates.The resulting wild-type SLC26A7, C-terminal–truncatedSLC26A7, SLC26A1, and A7/A1 mutants were amplified and fusedtranslationally in-frame to green fluorescence protein (GFP)by cloning into pcDNA3.1/NT-GFP-TOPO vector (Invitrogen, Carlsbad,CA).
Full-length human SLC26A7 was amplified using the followingprimers: Primer-237, 5'-GAA ATG ACA GGA GCA AAG AG (sense),and primer-2328, 5'-GTT ATT GTA GCA GAG GTC ATC (antisense).The PCR product was cloned into the GFP fusion TOPO vector (pcDNA3.1/NT-GFP-TOPOvector). This resulted in the expression of GFP-SLC26A7 fusionprotein with the GFP fusing to the N-terminus of SLC26A7. Usinga similar approach, primer-237, GAA ATG ACA GGA GCA AAG AG (sense),primer-2162, TCA GAT ATG ACT TAT TGC AG (antisense), and primer-1919,TCA TTC TTC ATT GCA GTT G (antisense), were used to generatethe SLC26A7-CD16 cDNA, which lacked the last 16 aa residueson the carboxyl terminal end. Full-length mouse SLC26A1 wasamplified using the following primers: Primer-22, 5'-GAC AGGATG GAT GCT TCT C (sense), and primer-2204, 5'-ATT CAC ACC ACTCCT ACA G (antisense) from mouse kidney. The PCR product wascloned into the GFP fusion TOPO vector (pcDNA3.1/NT-GFP-TOPOvector). This resulted in the expression of GFP-SLC26A1 fusionprotein with the GFP fusing to the N-terminus of SLC26A1 (GFP-SLC26A1).For generation of A7/A1 chimeras, the amino-terminal end ofmouse A7 was fused to the carboxy-terminal end of mouse A1 togenerate A7n/A1c chimera, with n and c designating the N-terminaland C-terminal ends, respectively. Toward this end, the DNAfragment encoding aa residues 1 to 473 of mouse SLC26A7 wasgenerated using primers A7–107, AAA ATG ACG GGA GCA AAGAG (sense), and A7–1528, GAA TTC TGG GAA ACG TCC TAA CAC(antisense), and fused in frame to the DNA fragment encodingthe aa residues 499 to 705 of mouse SLC26A1 using primers A1,GAATTCTTCTTCTCCCTGCTTAGCCTG (sense), and A1, ATTCACACCACTCCTACAG(antisense). This resulted in the expression of the GFP-SLC26A7/A1mutant fusion protein, which is composed of the amino-terminalfragment of A7 and the carboxyl terminal fragment of A1.
Transient Expression of Epitope-Tagged SLC26A7, Truncated SLC26A7, SLC26A1, and A7/A1 Mutant in MDCK Cells
MDCK cells were grown on glass coverslips and transiently transfectedwith the epitope-tagged SLC26 isoforms or variants (above) andstudied 48 h later according to established methods (23, 24).Briefly, cells were plated in 24-well plates and transfectedwith various cDNA fragments at 80% confluence using 0.8 µgof DNA and 4 µl of Lipofectamine 2000 (Invitrogen). Allcells were co-labeled with Alexa Fluor 568 phalloidin (MolecularProbes, Eugene, OR) as a marker of apical membrane labeling.All cells were fixed 48 h after transfection, irrespective ofthe duration of exposure to hypertonic or low-potassium medium,such that the total length of exposure to isotonic plus hypertonicor normal-potassium plus low-potassium medium was 48 h.
In separate studies, MDCK cells were grown on permeable polycarbonatemembrane Transwell filters (cat. no. 3401; Corning Inc., Corning,NY) at a density of approximately 105 cells/cm2. Cells achievedconfluence within 4 to 5 d and then were transiently transfectedfrom the apical surface with the GFP-SLC26A7 construct and studied48 h later.
Confocal Microscopy and Immunofluorescence Labeling
MDCK cells were washed three times with PBS, fixed for 20 minwith 3% formaldehyde in PBS, and washed three more times withPBS. Afterward, cells were permeabilized with 0.1% TX-100 inPBS for 3 min, washed three times with PBS, and co-stained withAlexa Fluor 568 phalloidin. Cells then were washed and mountedon glass slides in Fluoromount-G (Southern Biotechnology Associates,Inc., Birmingham, AL). Images were taken on a Zeiss LSM510 confocalmicroscope. Both Z-line and Z-stack images were obtained usingthe LSM 5 Image software to analyze the membrane targeting ofGFP-fusion proteins (23, 24).
Water Loading in Rats
Sprague-Dawley rats that weighed 150 to 200 g were subjectedto water loading for 5 d according to established protocols.Briefly, the control group (n = 4) was allowed tap water adlibitum, whereas the water-loaded rats (n = 4) were inducedto drink water abundantly by adding glucose (50 g/1000 ml) totheir drinking water.
Antibodies
A rabbit polyclonal antibody raised against a mouse SLC26A7peptide with the aa residues CGAKRKKRSVLWGKMHTP (using the mouseEST with Genbank accession no. BB666404) and an antibody raisedagainst human SLC26A7 were used for immunofluorescence labeling(8, 19).
Immunofluorescence Labeling Studies in Mouse Kidney and Stomach
Immunofluorescence labeling was performed as described previously(7, 8, 19). Alexa Fluor 488 (green) or Alexa Fluor 568 (red)goat anti-rabbit antibody was used as a secondary antibody.Sections were examined on the epifluorescent microscope Eclipse600 (Nikon Bioscience, Melville, NY) equipped with SPOT digitalcamera (Diagnostic Instruments, Inc., Sterling Heights, MI).Digital images were acquired using the Spot Advanced softwareprovided with the camera.
Western Blot Analysis
Microsomal membrane and cytoplasmic fractions were isolatedfrom rat outer medulla according to established methods (25).Immunoblotting experiments were carried out as described previously(8, 13). Briefly, the solubilized proteins were size-fractionatedon 8% SDS polyacrylamide minigels (Novex, San Diego, CA) underdenaturing conditions, electrophoretically transferred to nitrocellulosemembranes, blocked with 5% milk proteins, and then probed withthe affinity-purified anti-SLC26A7 immune serum at a dilutionof 1:400. The secondary antibody was donkey anti-rabbit IgGconjugated to horseradish peroxidase (Pierce, Rockford, IL).The sites of antigen-antibody complex formation on the nitrocellulosemembranes were visualized using chemiluminescence method (SuperSignalSubstrate; Pierce) and captured on light-sensitive imaging film(Kodak, Rochester, NY).
Materials
All chemicals were purchased from Sigma Chemical Co. (St. Louis,MO). RadPrime DNA labeling kit was purchased from Invitrogen(Carlsbad, CA). mMACHINE kit was purchased from Ambion (Austin,TX). Alexa Fluor–conjugated secondary antibodies and Hoechst33342 were purchased from Molecular Probes Inc. The CT-GFP fusionexpression kit, which contains the pcDNA3.1/CT-GFP TOPO vector,was purchased from Invitrogen. Glyceraldehyde-3-phosphate dehydrogenasepolyclonal antibodies were from Abcam (Cambridge, MA).
Statistical Analyses
The experiments were performed in duplicate (two slides pereach condition) and repeated at least three separate times foreach maneuver. Quantification of SLC26A7 abundance in membraneor cytoplasm was performed using MetaMorph imaging system software(Universal Imaging Corp., West Chester, PA) by measuring thefluorescence intensity of SLC26A7-GFP in multiple square areascorresponding to regions in membrane or cytoplasm. More than16 separate fields were analyzed per each transfected cell,with the total of 160 fields for 10 transfected cells per eachslide. A total of 20 or 30 transfected cells from three separateexperiments were analyzed for each maneuver. Values are expressedas arithmetic mean ± SE. Comparisons were done by usingunpaired t test, and P < 0.05 was considered statisticallysignificant. Microsoft Excel, ProStat (Philscience, South Korea),and PSI-Plot (Philscience) were commercial software packagesused for statistical analysis.
Our immunofluorescence labeling with purified antibodies demonstratedthe localization of SLC26A7 on the basolateral membrane andin the cytoplasm of parietal cells in the stomach and A-IC cellsin kidney OMCD (7, 8, 19). These results have been confirmedin our new immunofluorescence labeling studies in Figure 1,A and B. Figure 1A shows the subcellular distribution of SLC26A7in gastric parietal cells when images with gastric H-K-ATPaseare merged. Figure 1B shows the subcellular distribution ofSLC26A7 in kidney OMCD cells. The low- and high-magnificationimages in Figure 1B (left and right, respectively) along withthe image in Figure 1A clearly demonstrate the localizationof SLC26A7 on the basolateral membrane and in the cytoplasmof acid-secreting gastric parietal cells and OMCD cells.
Figure 1. SLC26A7 expression in mouse kidney outer medullary collecting duct (OMCD) and stomach parietal cells. (A) Immunofluorescence labeling of SLC26A7 and gastric H-K-ATPase in gastric parietal cells. Merged image of SLC26A7 and gastric H-K-ATPase labeling is shown. As indicated, SLC26A7 shows significant intracellular as well as basolateral membrane localization in gastric parietal cells. (B) Immunofluorescence labeling of SLC26A7 in kidney outer medulla. SLC26A7 shows labeling on the basolateral membrane as well as in the cytoplasm in a subpopulation of OMCD cells (left, low magnification; right, high magnification). (C) Immunoblotting of SLC26A7 in membrane and cytoplasmic fractions in kidney outer medulla. Microsomal membranes and cytoplasmic fractions from outer medulla of two rat kidneys were loaded at 100 µg/lane onto lanes. Immunoblotting with the purified immune serum shows a band with a molecular weight of approximately 90 kD in both the membrane and cytoplasmic fractions (left). The labeling of the 90-kD band was abolished with preadsorbed immune serum in both fractions (right).
To verify the cytoplasmic expression of SLC26A7 quantitatively,we performed Western blotting on membrane and cytoplasmic proteinsthat were isolated from rat outer medulla, the site of SLC26A7expression. As indicated, Western blotting detected SLC26A7as an approximately 90-kD band, with abundant expression inboth the membrane and the cytoplasmic fractions from two separaterats (Figure 1C, left), confirming the subcellular distributionof the exchanger in the kidney cells. Preadsorption of the antibodywith the antigen (synthetic peptide) completely prevented thelabeling of SLC26A7 in the kidney outer medulla fractions (Figure 1C,right), indicating the specificity of the antibody.
Expression and Subcellular Distribution of SLC26A7 in MDCK Cells
The cytoplasmic localization of the exchanger in Figure 1 raisesthe possibility of alteration in SLC26A7 abundance at the cellsurface by affecting the trafficking between cell membrane andintracellular compartments. To analyze this possibility, weexamined the expression of full-length GFP with or without SLC26A7cDNA insert in MDCK cells. The cell membrane was labeled withthe actin-binding dye phalloidin. Figure 2A is a Z-line mergedimage of phalloidin and GFP labeling and shows that transfectionwith GFP vector alone (no SLC26A7 insert) results in the accumulationof GFP in the cytoplasm with no localization on the membrane.It is interesting that when transfection with GFP-SLC26A7 full-lengthcDNA was performed, the acquired images demonstrated punctatedistribution through the cytoplasm, with no labeling on theplasma membrane (Figure 2B).
Figure 2. Expression and subcellular distribution of green fluorescence protein (GFP)-SLC26A7 in MDCK cells. (A) Transfection with GFP vector alone (no SLC26A7 insert) results in GFP accumulation in the cytoplasm (Z-line images). (B) GFP-SLC26A7 is expressed in punctate cytoplasmic structures, with no labeling on the membrane. Red, phalloidin; green, GFP.
Effect of Hypertonicity on Distribution of SLC26A7 in MDCK Cells
The expression of SLC26A7 in the kidney is limited predominantlyto the medullary collecting duct, a segment that is exposedto a hypertonic environment in vivo. The purpose of the nextseries of experiments was to examine the effect of hypertonicityon subcellular distribution of SLC26A7. Toward this end, cellswere transiently transfected with GFP-SLC26A7 cDNA; and 32 hlater, the medium was made hypertonic by the addition of 50mM NaCl. The pH was maintained at 7.4. The cells were fixedfor 16 h after switching to the hypertonic medium and analyzedmicroscopically. As shown in Figure 3A, SLC26A7 was detectedpredominantly in the plasma membrane, with little residual labelingin the cytoplasm. Analysis of 30 transfected cells in hypertonicmedium and 30 cells in isotonic medium by MetaMorph imagingsystem software (see Materials and Methods) showed that 86 ±5% of SLC26A7 labeling was detected in the membrane in hypertonicmedium, whereas only 13 ± 2% of the labeling was detectedin the membrane in isotonic medium (P < 0.0001). Subcellulardistribution studies in hypertonic medium (Z-stack images) indicatethe targeting of SLC26A7 to the basolateral membrane (Figure 3B),consistent with published reports (7, 8, 19). Transfection withthe control construct (empty GFP with no SLC26A7 insert) showedthat the GFP was retained in the cytoplasm in hypertonic mediumat 2 and 16 h (data not shown) in a manner that was indistinguishablefrom the isotonic medium (Figure 2A).
Figure 3. Effect of hypertonicity on the expression and subcellular distribution of SLC26A7 in MDCK cells. (A) Expression of SLC26A7 in hypertonic medium (top) versus isotonic medium (bottom). As shown, SLC26A7 was detected almost exclusively in the plasma membrane in hypertonic medium (top) versus predominantly in intracellular compartments in isotonic medium (bottom). Red, phalloidin; green, SLC26A7-GFP. (B) Subcellular distribution studies in hypertonic medium. Merged Z-stack image of GFP-SLC26A7 and phalloidin indicates the targeting of SLC26A7 to the basolateral membrane. (C) Effect of 2 h of exposure to hypertonic medium on SLC26A7 distribution in MDCK cells. As shown, SLC26A7 was detected predominantly in the cytoplasm after 2 h of incubation in hypertonic medium. Red, phalloidin; green, SLC26A7-GFP. (D) Effect of mannitol on SLC26A7 distribution in MDCK cells. As shown, SLC26A7 was detected predominantly in the membrane after 16 h of incubation in hypertonic medium. Red, phalloidin; green, SLC26A7-GFP. (E) SLC26A7 expression in cells that were grown on permeable support. As shown, cells that were grown on permeable support were detected predominantly in the cytoplasm in isotonic medium. However, in cells that were exposed to hypertonic medium from the basolateral and apical surfaces or from the basolateral surface alone, SLC26A7 was detected predominantly on the plasma membrane. When hypertonicity was applied to the apical surface alone, SLC26A7 showed mild abundance in the membrane with significant retention in the cytoplasm.
The purpose of the next series of experiments was to determinethe rapidity with which the shift in SLC26A7 distribution fromcytoplasm to the membrane occurs in hypertonic medium. Accordingly,cells were transfected with SLC26A7, switched to the hypertonicmedium 46 h later, and fixed for 2 h after switching to thehypertonic medium. As shown in Figure 3C, exposure to the hypertonicmedium for 2 h did not significantly increase the abundanceof SLC26A7 in the membrane.
The hypertonicity in the above experiments was generated bythe addition of 50 mM NaCl. In the next series of experiments,hypertonicity was generated by the addition of sodium-free solute.Toward this end, mannitol (100 Mm) was added to the medium,and cells were fixed and studied 16 h later. As shown in Figure 3D,SLC26A7 was detected predominantly in the membrane in hypertonicmedium. Analysis of 30 transfected cells from three separateexperiments showed that 79 ± 5% of SLC26A7 labeling wasdetected in the membrane after 16 h of incubation with mannitol(P < 0.0001, versus isotonic medium in Figure 3A).
The above experiments were performed on cells that were grownon nonpermeable support. The next series of experiments wereperformed in cells that were grown on permeable support (seeMaterials and Methods). Toward this end, MDCK cells were platedon Transwell filters and transfected with the SLC26A7-GFP constructfrom the apical surface after becoming confluent. Thirty-twohours after transfection, the medium that faced the basolateralsurface, the apical surface, or both surfaces was made hypertonicby the addition of 50 mM NaCl. The cells were fixed for 16 hafter switching to the hypertonic medium and analyzed microscopically.As shown in Figure 3E, SLC26A7 was detected predominantly inthe cytoplasm in isotonic medium (left) but in the plasma membranein hypertonic medium added to both the apical and basolateralsides (second panel from left). In cells that were exposed tohypertonic medium from the basolateral side alone (right), theabundance of SLC26A7 in the membrane was similar to that incells that were exposed to hypertonic medium from both sides(second panel from left). In cells that were exposed to hypertonicmedium from the apical surface alone, SLC26A7 was detected predominantlyin the cytoplasm with some labeling in the membrane (secondpanel from right).
In an attempt to identify the signal(s) that mediates the targetingof SLC26A7 to the membrane in hypertonicity, we investigatedthe role of mitogen-activates protein kinase (MAPK). This assumptionwas based on published literature demonstrating the activationof MAPK by high osmolarity (26–28). Toward this end, theexperiments in hypertonic medium were repeated in the presenceor absence of SB203580/S-8307 (Sigma-Aldrich, St. Louis, MO),a specific inhibitor of p38 MAPK (27, 28). Accordingly, MDCKcells were transfected with the GFP-SLC26A7 cDNA and then incubatedwith 10 µM SB203580 upon switching to the hypertonic medium.As shown in Figure 4, the presence of the MAPK inhibitor SB203580completely blocked the trafficking of SLC26A7 to the membrane(bottom) when compared with its absence (top). Analysis of theepitope-tagged insert in 10 transfected cells with the p38 MAPKinhibitor and 10 cells without the inhibitor in hypertonic mediumshowed that only 9 ± 2% of SLC26A7 labeling was in themembrane in the presence of the inhibitor versus 83 ±7% in its absence (P < 0.0001, three separate experiments).Similarly, addition of PD 98059 (Sigma-Aldrich), an inhibitorof the upstream regulatory protein kinase MAP/extracellularsignal–regulated kinase kinase (27, 28), also blockedthe trafficking of SLC26A7 to the membrane in hypertonic mediumin a manner similar to that shown in Figure 4 (data not shown).
Figure 4. Effect of mitogen activated protein kinase (MAPK) inhibition on subcellular distribution of SLC26A7 in hypertonicity. (Top) Hypertonic medium without MAPK inhibitor. As indicated, SLC26A7 is targeted predominantly to the plasma membrane in a hypertonic environment. (Bottom) Hypertonic medium with MAPK inhibitor. MAPK inhibitor completely blocked the trafficking of SLC26A7 to the membrane. Red, phalloidin; green, SLC26A7-GFP.
SLC26A7 Resides in Endosomes in MDCK Cells
The disappearance of SLC26A7 from the cytoplasm and its appearancein the plasma membrane in hypertonic medium (Figures 2 and 3)raises the possibility that SLC26A7 may reside in the endosomes.To investigate this possibility, we performed double labelingwith SLC26A7-GFP and the transferrin receptor marker (transferrinconjugated with Alexa Fluor 568; Molecular Probes) in both isotonicand hypertonic media. As indicated in Figure 5A, the intracellularlocalization of GFP-SLC26A7 (right) and transferrin receptor(left) significantly overlapped in isotonic medium. Furthermore,the majority of transferrin receptor (left) and GFP-SLC26A7(right) labeling was detected in the plasma membrane in hypertonicmedium (Figure 5B, merged). Analysis of the epitope-tagged insertin 10 transfected cells in isotonic medium and 10 cells in hypertonicmedium from three separate experiments showed significant co-localizationof SLC26A7 with the transferrin receptor in hypertonic medium.
Figure 5. SLC26A7 resides in recycling endosomes in MDCK cells. (A) Isotonic medium. As shown, SLC26A7 (right) and transferrin receptor (left) co-localize to the same intracellular compartments (middle: merged). (B) Hypertonic medium. SLC26A7 and transferrin receptor co-localize to the plasma membrane in hypertonic medium.
Expression of SLC26A1 and SLC26A7/A1 Chimera in MDCK Cells
In the next series of experiments, we examined whether the localizationof SLC26A7 in the endosomes is unique to this member of theSLC26 family or is a property that is shared by other membersof the SLC26 family. Toward this end, SLC26A1 (also know asSAT1, for sulfate anion transporters 1) (3, 16, 29) was fusedin frame with GFP (see Materials and Methods) and expressedin MDCK cells in isotonic media at pH 7.4. As indicated in Figure 6A,SLC26A1 is expressed predominantly in the plasma membrane, withlittle expression in the cytoplasm (Z-line image). Subcellulardistribution studies in isotonic media (Z-stack image) indicatethat SLC26A1 is localized to the basolateral membrane (Figure 6B).The membrane abundance of SLC26A1 did not change in hypertonicmedium (data not shown). These studies support the conclusionthat the pattern of distribution of SLC26A7 is unique to thisisoform and does not extend to other members of the SLC26 family.
Figure 6. Expression of SLC26A1, SLC26A7/A1 chimera, and truncated SLC26A7 in MDCK cells. (A) Expression of SLC26A1 in MDCK cells (Z-line image). SLC26A1 is expressed predominantly in plasma membrane, with no expression in the cytoplasm. (B) Subcellular distribution of SLC26A1 in isotonic medium (Z-stack images) indicates that SLC26A1 is localized to the basolateral membrane. Red, phalloidin; green, SLC26A1-GFP. (C) Expression of SLC26A7/A1 chimera in MDCK cells in isotonic and hypertonic media (Z-line image). SLC26A7/A1 chimera is expressed predominantly in the cytoplasm with some labeling in the plasma membrane (left, isotonic medium), and its distribution pattern does not change with increased osmolarity (right). (D) Truncated SLC26A7. As shown, the C-terminal–truncated SLC26A7 shows cytoplasmic distribution in isotonic medium (left). The truncated SLC26A7 remained predominantly in the cytoplasm with faint expression in the membrane in hypertonic medium (right).
Next, we examined the expression of the SLC26A7/A1 mutant, whichencoded the N-terminal portion of A7 and the C-terminal fragmentof A1 in isotonic and hypertonic media (see Materials and Methods).The results demonstrate that A7/A1 chimera is localized predominantlyto the cytoplasm in isotonic medium (Figure 6C, left) and showslittle expression in the membrane in hypertonic medium (Figure 6C,right). Analysis of 20 transfected cells in hypertonic or isotonicmedium (see Materials and Methods) showed that 79 ± 7%of SLC26A7 labeling in isotonic medium and 69 ± 6% inhypertonic medium was detected in the cytoplasm (P > 0.05).These results suggest that the signal that directs the targetingof SLC26A7 to the membrane in hypertonic medium likely residesin the C-terminal end of SLC26A7. It is worth mentioning thatmouse SLC26A7, which was used for domain-swapping experimentsin Figure 6, shows a subcellular distribution pattern similarto the human SLC26A7 (data not shown), indicating that speciesdifference does not play any role in membrane targeting of SLC26A7.
Expression of C-Terminal–Truncated SLC26A7 in MDCK Cells
In the next series of experiments, the expression of the truncatedSLC26A7 (see Materials and Methods) was examined in isotonicmedium and hypertonic medium. As indicated in Figure 6D (left),deletion of the last 16 aa residues from the C-terminal endresulted in a more diffuse intracellular distribution with littleexpression in the membrane (Z-line image). The truncated SLC26A7was retained predominantly in the cytoplasm with faint labelingin the plasma membrane in hypertonic medium (Figure 6D, right).Analysis of 20 transfected cells in hypertonic or isotonic mediumshowed that 81 ± 6% of SLC26A7 labeling in isotonic mediumand 74 ± 7% in hypertonic medium was detected in thecytoplasm (P > 0.05). Taken together, these data indicatethat a domain within the last 16 aa of the C-terminal fragmentis responsible for the targeting of SLC26A7 to the membranein hypertonic medium.
Effect of Potassium Depletion on Expression GFP-SLC26A7 in MDCK Cells
Rats that are fed a potassium-free diet for 3 to 7 d demonstrateincreased bicarbonate reabsorption in their OMCD (30), suggestingthe upregulation of apical and basolateral bicarbonate-absorbingtransporters in A-IC cells (31). On the basis of the studiesshowing the localization of SLC26A7 to the basolateral membraneof A-IC cells in OMCD (8, 19), we entertained the possibilitythat potassium depletion might regulate the trafficking of SLC26A7to the membrane. Toward this end, cells were transiently transfectedwith GFP-SLC26A7 cDNA and thereafter were exposed to eithervery low potassium (0.5 mM/L) or low potassium (2 mM/L) andcompared with normal potassium (4 mEq/L) for 16 or 2 h. Themedium was kept isotonic with all potassium concentrations.Figure 7 compares the effect of varying potassium concentrationon subcellular distribution of GFP-SLC26A7. As indicated, SLC26A7was detected predominantly in the plasma membrane in very-low-potassiummedium (0.5 mM) for 16 h (right) versus in punctate cytoplasmicstructures in normal-potassium medium (left). At 2 mM potassiumfor 16 h, SLC26A7 shows significant abundance in the membraneversus the isotonic medium, with moderate cytoplasmic localization(second panel from right) when compared with 0.5 mEq/L potassium(right). The abundance of SLC26A7 in the membrane was estimatedat approximately 23 ± 4% in normal potassium, 58 ±5% in 2 mEq/L potassium (P < 0.001 versus normal-potassiummedium), and 81 ± 5% in 0.5 mEq/L potassium for 16 h(P < 0.0001 versus normal-potassium medium), with a totalof 30 cells analyzed for each potassium concentration. A shorterexposure of MDCK cells (2 h) to low-potassium medium (2 mEq/L)did not increase the membrane abundance of SLC26A7 (Figure 7,second panel from left). Transfection with the control construct(empty GFP with no SLC26A7 insert) showed that the GFP was retainedin the cytoplasm in low-potassium medium at 2 and 16 h (datanot shown) in a manner that was indistinguishable from the normalmedium (Figure 2A).
Figure 7. Effect of potassium depletion on the subcellular distribution of GFP-SLC26A7 in MDCK cells. (Left) Normal potassium (4 mEq/L). (Middle two) Low potassium (2 mEq/L) for 2 and 16 h. (Right) Very low potassium (0.5 mEq/L) for 16 h. As demonstrated, SLC26A7 is expressed predominantly in punctate intracellular structures in normal potassium media (left) but is detected predominantly in the plasma in low-potassium medium for 16 h (right two). Second from left shows significant cytoplasmic localization with little membrane expression after short (2 h) incubation in low-potassium medium. Red, phalloidin; green, SLC26A7-GFP.
SLC26A7 Expression in Water-Loaded Rats
The results of the experiments in Figures 2, 3, and 4 as wellas a recently published report (32) demonstrate that increasedinterstitial tonicity increases, whereas decreased interstitialtonicity decreases the membrane abundance of SLC26A7 in OMCDcells. To examine the effect of reduced interstitial osmolarityon SLC26A7 in a more detailed manner, we subjected rats to waterloading for 5 d (see Materials and Methods) and then examinedthem by immunofluorescence labeling. Water-loaded rats displayedsignificant polyuria (increased urine output) and reduced urineosmolarity versus control rats, consistent with published reports.As demonstrated in low- and high-magnification images of thekidney outer medulla (Figure 8, top and bottom, respectively),the number of OMCD cells that displayed SLC26A7 expression ontheir basolateral membrane decreased significantly in water-loadedrats (Figure 8, right) versus normal control rats (Figure 8,left). The reduction in membrane expression was associated witha reciprocal increase in SLC26A7 abundance in the cytoplasmin OMCD cells (Figure 8).
Figure 8. Effect of water loading on SLC26A7 expression in rat kidney OMCD. (Top) Low magnification. (Bottom) High magnification. Immunofluorescence labeling demonstrates significant reduction in SLC26A7 expression on the basolateral membrane of OMCD in water-loaded rats (right) when compared with normal rats (left). The reduction in membrane expression was associated with reciprocal increase in SLC26A7 abundance in the cytoplasmic compartment.
Immunocytochemical staining (7, 8, 19) as well as immunoblotanalysis (Figure 1) demonstrated that in addition to basolateralmembrane, significant intracellular localization of SLC26A7is observed in kidney medullary collecting or gastric parietalcells, raising the possibility that alteration in SLC26A7 abundanceat the cell surface may occur by changes in traffic betweencell membrane and intracellular compartments. Epitope-taggedfull-length human SLC26A7 was detected predominantlyas punctatedistribution in the cytoplasm (Figure 2). However, in hypertonicmedium (50 mM NaCl or 100 mM mannitol added to the isotonicmedium [pH 7.4]), SLC26A7 appeared predominantly on the plasmamembrane (Figure 3). The presence of MAPK inhibitors completelyblocked the trafficking of SLC26A7 to the plasma membrane (Figure 4).Double labeling with the transferrin receptor markers demonstratedthat SLC26A7 shows significant expression in recycling endosomes(Figure 5). The signal directing the trafficking of SLC26A7between endosomes and the plasma membrane resides in its C-terminalend (Figure 6). Last, we observe that SLC26A7 was detected predominantlyin plasma membrane in potassium-depleted medium versus cytoplasmiclocalization in normal-potassium media (Figure 7). The traffickingto the membrane in hypertonic or potassium-depleted medium wastime dependent. Water loading, which decreases the medullaryinterstitial osmolality, decreased the membrane abundance ofSLC26A7 (Figure 8).
The detection of SLC26A7 in the plasma membrane of cells thatwere exposed to hypertonic medium in vitro suggests that alterationsin kidney medullary interstitial osmolarity in vivo can affectthe abundance of SLC26A7 in the basolateral membrane of A-ICcells in OMCD. In support of this possibility, studies in Brattlebororats, which lack endogenous vasopressin and, as a result, havereduced medullary interstitial osmolarity (33, 34), showed verylittle SLC26A7 expression on the basolateral membrane of medullarycollecting duct cells (32). It is interesting that treatmentwith vasopressin, which normalizes the medullary interstitialosmolarity (33, 34), resulted in significant upregulation ofSLC26A7 on the basolateral membrane of OMCD cells without affectingits mRNA expression levels (32). These results are consistentwith posttranscriptional regulation of SLC26A7 by vasopressinin Brattleboro rats and are in agreement with enhanced traffickingof SLC26A7 to the membrane by hypertonicity in vitro (Figures 3,4, and 5). In contrast to SLC26A7, AE1 is abundantly expressedin the basolateral membrane of A-IC in OMCD in Brattleboro rats,and its expression actually decreases, albeit very mildly, inresponse to vasopressin (32). The robust SLC26A7 appearancein basolateral membranes and its distinct response versus AE1to vasopressin suggest differential regulation of AE1 and SLC26A7in pathophysiologic states.
A recent report showed that in rats that were subjected to waterdeprivation for 3 d, the mRNA and protein expression of SLC26A7in OMCD were enhanced (19). The transcriptional regulation ofSLC26A7 in water deprivation does not conflict with its posttranscriptionalregulation by hypertonicity in cultured medullary collectingduct cells in vitro (Figures 3, 4, and 5) or by vasopressinin Brattleboro rats (32). It is plausible that increased interstitialtonicity of medulla can increase the expression of SLC26A7 atboth transcriptional and posttranscriptional levels, with transcriptionalregulation becoming the dominant regulatory mode at longer durationor more severe degree of hypertonicity such as 3 d of waterdeprivation. Alternatively, it is possible that the transcriptionalregulation of SLC26A7 in water deprivation is due to factorsother than increased medullary osmolarity such as volume depletion,activation of renin angiotensin and sympathetic systems, ordecreased kidney perfusion, (35, 36).
The trafficking of ion transporters, in particular acid-basetransporters such as H+-ATPase, between intracellular structuresand the plasma membrane has been well described (37–39).However, unlike these ion transporters, the trafficking of SLC26A7to the membrane is slow and time dependent (Figures 3 and 4).As a Cl–/HCO3– exchanger that is adapted to hypertonicity,SLC26A7 activation results in the entry of chloride, which subsequentlyregulates cell volume. In this regard, SLC26A7 function maybe similar to betaine transporter, which is involved in cellvolume regulation and shows a time-dependent trafficking inhypertonicity that is very similar to SLC26A7 (40). The bicarbonateexit that is coupled to chloride entry suggests that SLC26A7,which exchanges chloride for bicarbonate across the basolateralmembrane of acid-secreting OMCD cells, will also regulate cellpH and/or bicarbonate exit in hypertonicity in a time-dependentmanner. The lack of acute regulation of SLC26A7 in hypertonicitysuggests either that AE1, which co-localizes with SLC26A7, isnot acutely inhibited by hypertonicity or that other acid-basetransporters may be activated immediately after the generationof hypertonicity.
The localization of SLC26A7 in the endosomes is unique amongSLC26 members. SLC26A1 (SAT1) was expressed predominantly onthe basolateral membrane of MDCK cells in isotonic medium (Figure 6,B and C) and remained in the membrane in hypertonic medium (datanot shown). Furthermore, our preliminary studies demonstratethat epitope-tagged AE1, which co-localizes with SLC26A7 onthe basolateral membrane of cells in OMCD (8, 19), is expressedpredominantly in plasma membrane in MDCK cells in isotonic medium(data not shown), confirming published reports (41). Taken together,these results suggest that SLC26A7 trafficking is distinct fromSLC4A1 and other SLC26 anion exchangers.
The targeting of SLC26A7 to the membrane was completely preventedin the presence of MAPK inhibitors (Figure 4), indicating thatMAPK is activated and plays an important role in enhanced cellsurface expression of SLC26A7 in a hypertonic environment. Thesefindings are consistent with published reports indicating thathypertonicity increases the membrane targeting and/or activityof several ion transporters, including Na-K-ATPase, Glut 4,and AE2 (42–44). Whether the activation of MAPK is inresponse to the hypertonicity or the consequent cell shrinkageremains speculative (27, 28). Authors could not find any publishedstudies in mammalian cells demonstrating a critical role forMAPK in the alteration in endosomal/surface membrane traffickingof acid-base transporters in a high osmotic environment. Assuch, these results may be the first report on such finding.Furthermore, whereas the trafficking of the recycling endosomesto the membrane has been demonstrated in acute hypertonicity,little information is available regarding their targeting tothe membrane in long-term (16 h) hypertonicity. In additionto blocking membrane targeting, p38 MAPK inhibitor seemed toreduce the overall signal intensity of SLC26A7, suggesting apossible effect on its abundance (Figure 4). Whether MAPK inhibitorsdirectly reduce the synthesis of new SLC26A7 protein remainsspeculative. A more plausible explanation is that the SLC26A7protein that is destined for the plasma membrane undergoes enhanceddegradation in the lysosomes after being retained in the cytoplasm.
The truncated SLC26A7, lacking the last 16 aa, showed a distributionpattern that was very distinct from the full-length proteinin isotonic and hypertonic media (Figure 6, A and B). Similarto the truncated SLC26A7, the A7/A1 chimera was expressed diffuselyin the cytoplasm in isotonic medium and showed little membraneexpression in hypertonic medium (Figure 6D). These latter experimentsconfirm the results of the studies with the C-terminal–truncatedmutant and suggest that the determinant site that directs thetrafficking of SLC26A7 from the recycling endosomes to the membraneresides in its C-terminal end. Future studies should focus onthe identification of the aa residues that are responsible forthe targeting of SLC26A7 to the endosomes and its traffickingto the membrane in pathophysiologic states.
Potassium depletion causes metabolic alkalosis in mammals (45,46), in large part as a result of increased absorption of bicarbonatein the kidney proximal tubule and the collecting duct (30, 31,47, 48). Rats that were fed a potassium-free diet developedsignificant hypokalemia or intracellular potassium depletionas early as 24 h after ingestion of the diet (49). In vitromicroperfusion studies in the collecting duct demonstrated increasedabsorption of bicarbonate in OMCD in rats that were fed a potassium-freediet for 7 d (30). Molecular studies demonstrated increasedabundance of apical H+-ATPase and colonic H+-K+-ATPase in OMCDof potassium-depleted rats and mice (50, 51). However, the identityof the basolateral Cl–/HCO3– exchanger in the OMCDcells that is upregulated in potassium depletion, whether SLC26A7or AE1, remained and still remains speculative. These resultsdemonstrate that SLC26A7 abundance in the membrane was increasedsignificantly in potassium-depleted medium (Figure 7). On thebasis of our in vitro experiments, we propose that potassiumdepletion increases the abundance of SLC26A7 in basolateralmembrane of rat OMCD in vivo, thereby increasing net bicarbonateabsorption in hypokalemia.
SLC26A7 displays unique subcellular distribution in kidney cells,with predominant abundance in endosomes in normal-potassiumisotonic medium and almost exclusive detection in the membranein either hypertonic or potassium-depleted medium. The traffickingto the cell surface suggests novel functional upregulation ofSLC26A7 in states that are associated with increased medullarytonicity or hypokalemia. Additional studies in pathophysiologicconditions in rats and more specifically in genetically engineeredmice that lack SLC26A7 should clarify the role of SLC26A7 inenhanced bicarbonate absorption in OMCD in hypokalemia and inacid-base regulation in conditions that are associated withincreased medullary tonicity.
Acknowledgments
These studies were supported by National Institutes of Healthgrant DK 62809, a Merit Review Grant, a Cystic Fibrosis Foundationgrant, and grants from Dialysis Clinic Incorporated (to M.S.).
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
Alper SL, Darman RB, Chernova MN, Dahl NK: The AE gene family of Cl/HCO3– exchangers.
J Nephrol 15[Suppl 5]
: S41
–S53, 2002
Soleimani M, Burnham CE: Na+:HCO(3–) cotransporters (NBC): Cloning and characterization.
J Membr Biol 183
: 71
–84, 2001[CrossRef][Medline]
Mount DB, Romero MF: The SLC26 gene family of multifunctional anion exchangers.
Pflugers Arch 447
: 710
–721, 2004[CrossRef][Medline]
Melvin JE, Park K, Richardson L, Schultheis PJ, Shull GE: Mouse down-regulated in adenoma (DRA) is an intestinal Cl(–)/HCO(3)(–) exchanger and is up-regulated in colon of mice lacking the NHE3 Na(+)/H(+) exchanger.
J Biol Chem 274
: 22855
–22861, 1999[Abstract/Free Full Text]
Soleimani M, Greeley T, Petrovic S, Wang Z, Amlal H, Kopp P, Burnham CE: Pendrin: An apical Cl–/OH–/HCO3– exchanger in the kidney cortex.
Am J Physiol Renal Physiol 280
: F356
–F364, 2001[Abstract/Free Full Text]
Wang Z, Petrovic S, Mann E, Soleimani M: Identification of an apical Cl(–)/HCO3(–) exchanger in the small intestine.
Am J Physiol Gastrointest Liver Physiol 282
: G573
–G579, 2002[Abstract/Free Full Text]
Petrovic S, Ju X, Barone S, Seidler U, Alper SL, Lohi H, Kere J, Soleimani M: Identification of a basolateral Cl–/HCO3– exchanger specific to gastric parietal cells.
Am J Physiol Gastrointest Liver Physiol 284
: G1093
–G1103, 2003[Abstract/Free Full Text]
Petrovic S, Barone S, Xu J, Conforti L, Ma L, Kujala M, Kere J, Soleimani M: SLC26A7: A basolateral Cl–/HCO3– exchanger specific to intercalated cells of the outer medullary collecting duct.
Am J Physiol Renal Physiol 286
: F161
–F169, 2004[Abstract/Free Full Text]
Xu J, Henriksnas J, Barone S, Witte D, Shull GE, Forte JG, Holm L, Soleimani M: SLC26A9 is expressed in gastric surface epithelial cells, mediates Cl–/HCO3– exchange, and is inhibited by NH4+.
Am J Physiol Cell Physiol 289
: C493
–C505, 2005[Abstract/Free Full Text]
Royaux IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA, Green ED: Pendrin, encoded by the Pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion.
Proc Natl Acad Sci U S A 98
: 4221
–4226, 2001[Abstract/Free Full Text]
Wall SM, Hassell KA, Royaux IE, Green ED, Chang JY, Shipley GL, Verlander JW: Localization of pendrin in mouse kidney.
Am J Physiol Renal Physiol 284
: F229
–F241, 2003[Abstract/Free Full Text]
Wagner CA, Finberg KE, Stehberger PA, Lifton RP, Giebisch GH, Aronson PS, Geibel JP: Regulation of the expression of the Cl–/anion exchanger pendrin in mouse kidney by acid-base status.
Kidney Int 62
: 2109
–2117, 2002[CrossRef][Medline]
Wang Z, Wang T, Petrovic S, Tuo B, Riederer B, Barone S, Lorenz JN, Seidler U, Aronson PS, Soleimani M: Renal and intestinal transport defects in Slc26a6-null mice.
Am J Physiol Cell Physiol 288
: C957
–C965, 2005[Abstract/Free Full Text]
Knauf F, Yang CL, Thomson RB, Mentone SA, Giebisch G, Aronson PS: Identification of a chloride-formate exchanger expressed on the brush border membrane of renal proximal tubule cells.
Proc Natl Acad Sci U S A 98
: 9425
–9430, 2001[Abstract/Free Full Text]
Petrovic S, Ma L, Wang Z, Soleimani M: Identification of an apical Cl–/HCO3– exchanger in rat kidney proximal tubule.
Am J Physiol Cell Physiol 285
: C608
–C617, 2003[Abstract/Free Full Text]
Xie Q, Welch R, Mercado A, Romero MF, Mount DB: Molecular characterization of the murine Slc26a6 anion exchanger: Functional comparison with Slc26a1.
Am J Physiol Renal Physiol 283
: F826
–F838, 2002[Abstract/Free Full Text]
Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U, Markovich D, Kere J: Functional characterization of three novel tissue-specific anion exchangers SLC26A7, -A8, and -A9.
J Biol Chem 277
: 14246
–14254, 2002[Abstract/Free Full Text]
Vincourt JB, Jullien D, Kossida S, Amalric F, Girard JP: Molecular cloning of SLC26A7, a novel member of the SLC26 sulfate/anion transporter family, from high endothelial venules and kidney.
Genomics 79
: 249
–256, 2002[CrossRef][Medline]
Barone S, Amlal H, Xu J, Kujala M, Kere J, Petrovic S, Soleimani M: Differential regulation of basolateral Cl–/HCO3– exchangers SLC26A7 and AE1 in kidney outer medullary collecting duct.
J Am Soc Nephrol 15
: 2002
–2011, 2004[Abstract/Free Full Text]
Schuster VL: Function and regulation of collecting duct intercalated cells.
Annu Rev Physiol 55
: 267
–288, 1993[CrossRef][Medline]
Weiner ID, Wingo CS, Hamm LL: Regulation of intracellular pH in two cell populations of inner stripe of rabbit outer medullary collecting duct.
Am J Physiol 265
: F406
–F415, 1993
Kim KH, Shcheynikov N, Wang Y, Muallem S: SLC26A7 is a Cl– channel regulated by intracellular pH.
J Biol Chem 280
: 6463
–6470, 2005[Abstract/Free Full Text]
Li HC, Worrell RT, Matthews JB, Husseinzadeh H, Neumeier L, Petrovic S, Conforti L, Soleimani M: Identification of a carboxyl-terminal motif essential for the targeting of Na+-HCO3– cotransporter NBC1 to the basolateral membrane.
J Biol Chem 279
: 43190
–43197, 2004[Abstract/Free Full Text]
Li HC, Szigligeti P, Worrell RT, Matthews JB, Conforti L, Soleimani M: Missense mutations in Na+:HCO3– cotransporter NBC1 show abnormal trafficking in polarized kidney cells: A basis of proximal renal tubular acidosis.
Am J Physiol Renal Physiol 289
: F61
–F71, 2005[Abstract/Free Full Text]
Kim SW, Kim JW, Choi KC, Ma SK, Oh Y, Jung JY, Kim J, Lee J: Indomethacin enhances shuttling of aquaporin-2 despite decreased abundance in rat kidney.
J Am Soc Nephrol 15
: 2998
–3005, 2004[Abstract/Free Full Text]
Wojtaszek PA, Heasley LE, Berl T: In vivo regulation of MAP kinases in
Ratus norvegicus renal papilla by water loading and restriction.J Clin Invest 102
: 1874
–1881, 1998[Medline]
Roger F, Martin PY, Rousselot M, Favre H, Feraille E: Cell shrinkage triggers the activation of mitogen-activated protein kinases by hypertonicity in the rat kidney medullary thick ascending limb of the Henle’s loop. Requirement of p38 kinase for the regulatory volume increase response.
J Biol Chem 274
: 34103
–34110, 1999[Abstract/Free Full Text]
Sheikh-Hamad D, Di Mari J, Suki WN, Safirstein R, Watts BA 3rd, Rouse D: p38 kinase activity is essential for osmotic induction of mRNAs for HSP70 and transporter for organic solute betaine in Madin-Darby canine kidney cells.
J Biol Chem 273
: 1832
–1837, 1998[Abstract/Free Full Text]
Lee A, Beck L, Markovich D: The mouse sulfate anion transporter gene Sat1 (Slc26a1): Cloning, tissue distribution, gene structure, functional characterization, and transcriptional regulation thyroid hormone.
DNA Cell Biol 22
: 19
–31, 2003[CrossRef][Medline]
Nakamura S, Wang Z, Galla JH, Soleimani M: K+ depletion increases.
Am J Physiol 274
: F687
–F692, 1998
Wingo CS: Active proton secretion and potassium absorption in the rabbit outer medullary collecting duct. Functional evidence for proton-potassium-activated adenosine triphosphatase.
J Clin Invest 84
: 361
–365, 1989[Medline]
Petrovic S, Amlal H, Ma L, Sun X, Karet F, Barone S, Soleiman M: Vasopressin induces the expression of the Cl–/HCO3– exchanger SLC26A7 in the kidney medullary collecting duct of Brattleboro rats.
Am J Physiol Renal Physiol 2006
, in press
Blumenfeld JD, Hebert SC, Heilig CW, Balschi JA, Stromski ME, Gullans SR: Organic osmolytes in inner medulla of Brattleboro rat: Effects of ADH and dehydration.
Am J Physiol 256
: F916
–F922, 1989
DiGiovanni SR, Nielsen S, Christensen EI, Knepper MA: Regulation of collecting duct water channel expression by vasopressin in Brattleboro rat.
Proc Natl Acad Sci U S A 91
: 8984
–8988, 1994[Abstract/Free Full Text]
Bird JE, Blantz RC: Acute renal failure: The glomerular and tubular connection.
Pediatr Nephrol 1
: 348
–358, 1987[CrossRef][Medline]
Ishikawa E: Experimental study of effect of water deprivation-induced dehydration on renal function in rats.
Hinyokika Kiyo 33
: 1342
–1348, 1987[Medline]
Sautin YY, Lu M, Gaugler A, Zhang L, Gluck SL: Phosphatidylinositol 3-kinase-mediated effects of glucose on vacuolar H+-ATPase assembly, translocation, and acidification of intracellular compartments in renal epithelial cells.
Mol Cell Biol 25
: 575
–589, 2005[Abstract/Free Full Text]
Brown D, Breton S: H(+)V-ATPase-dependent luminal acidification in the kidney collecting duct and the epididymis/vas deferens: Vesicle recycling and transcytotic pathways.
J Exp Biol 203
: 137
–145, 2000[Abstract]
Thurmond DC, Ceresa BP, Okada S, Elmendorf JS, Coker K, Pessin JE: Regulation of insulin-stimulated GLUT4 translocation by Munc18c in 3T3L1 adipocytes.
J Biol Chem 273
: 33876
–33883, 1998[Abstract/Free Full Text]
Kempson SA, Parikh V, Xi L, Chu S, Montrose MH: Subcellular redistribution of the renal betaine transporter during hypertonic stress.
Am J Physiol Cell Physiol 285
: C1091
–C1100, 2003[Abstract/Free Full Text]
Beckmann R, Toye AM, Smythe JS, Anstee DJ, Tanner MJ: An N-terminal GFP tag does not alter the functional expression to the plasma membrane of red cell and kidney anion exchanger (AE1) in mammalian cells.
Mol Membr Biol 19
: 187
–200, 2002[Medline]
Chernova MN, Stewart AK, Jiang L, Friedman DJ, Kunes YZ, Alper SL: Structure-function relationships of AE2 regulation by Ca(i)(2+)-sensitive stimulators NH(4+) and hypertonicity.
Am J Physiol Cell Physiol 284
: C1235
–C1246, 2003[Abstract/Free Full Text]
Randhawa VK, Thong FS, Lim DY, Li D, Garg RR, Rudge R, Galli T, Rudich A, Klip A: Insulin and hypertonicity recruit GLUT4 to the plasma membrane of muscle cells by using N-ethylmaleimide-sensitive factor-dependent SNARE mechanisms but different v-SNAREs: Role of TI-VAMP.
Mol Biol Cell 15
: 5565
–5573, 2004[Abstract/Free Full Text]
Pihakaski-Maunsbach K, Tokonabe S, Vorum H, Rivard CJ, Capasso JM, Berl T, Maunsbach AB: The gamma-subunit of Na-K-ATPase is incorporated into plasma membranes of mouse IMCD3 cells in response to hypertonicity.
Am J Physiol Renal Physiol 288
: F650
–F657, 2005[Abstract/Free Full Text]
Hulter HN, Sigala JF, Sebastian A: K+ deprivation potentiates the renal alkalosis-producing effect of mineralocorticoid.
Am J Physiol 235
: F298
–F309, 1978
Alpern RJ, Emmett M, Seldin DW: Metabolic alkalosis. In:
The Kidney: Physiology and Pathophysiology, 2nd Ed., edited by Seldin DW, Giebish G, New York, Raven Press, 1992
, pp 2733
–2756
Kunau RT Jr, Frick A, Rector FC Jr, Seldin DW: Micropuncture study of the proximal tubular factors responsible for the maintenance of alkalosis during potassium deficiency in the rat.
Clin Sci 34
: 223
–231, 1968[Medline]
Soleimani M, Bergman JA, Hosford MA, McKinney TD: Potassium depletion increases luminal Na+/H+ exchange and basolateral Na+:CO3–:HCO3– cotransport in rat renal cortex.
J Clin Invest 86
: 1076
–1083, 1990[Medline]
Amlal H, Krane CM, Chen Q, Soleimani M: Early polyuria and urinary concentrating defect in potassium deprivation.
Am J Physiol Renal Physiol 279
: F655
–F663, 2000[Abstract/Free Full Text]
DuBose TD Jr, Codina J, Burges A, Pressley TA: Regulation of H(+)-K(+)-ATPase expression in kidney.
Am J Physiol 269
: F500
–F507, 1995
Silver RB, Soleimani M: H+-K+-ATPases: Regulation and role in pathophysiological states.
Am J Physiol 276
: F799
–F811, 1999
Related Article
This Month's Highlights
J. Am. Soc. Nephrol. 2006 17: 909-910.
[Full Text][PDF]
This article has been cited by other articles:
J. Xu, P. Song, S. Nakamura, M. Miller, S. Barone, S. L. Alper, B. Riederer, J. Bonhagen, L. J. Arend, H. Amlal, et al. Deletion of the Chloride Transporter Slc26a7 Causes Distal Renal Tubular Acidosis and Impairs Gastric Acid Secretion
J. Biol. Chem.,
October 23, 2009;
284(43):
29470 - 29479.
[Abstract][Full Text][PDF]
M. R. Dorwart, N. Shcheynikov, D. Yang, and S. Muallem The Solute Carrier 26 Family of Proteins in Epithelial Ion Transport
Physiology,
April 1, 2008;
23(2):
104 - 114.
[Abstract][Full Text][PDF]
S. Barone, H. Amlal, M. Kujala, J. Xu, F. Karet, A. Blanchard, J. Kere, and M. Soleimani Regulation of the basolateral chloride/base exchangers AE1 and SLC26A7 in the kidney collecting duct in potassium depletion
Nephrol. Dial. Transplant.,
December 1, 2007;
22(12):
3462 - 3470.
[Abstract][Full Text][PDF]
P. A. Stehberger, B. E. Shmukler, A. K. Stuart-Tilley, L. L. Peters, S. L. Alper, and C. A. Wagner Distal Renal Tubular Acidosis in Mice Lacking the AE1 (Band3) Cl-/HCO3- Exchanger (slc4a1)
J. Am. Soc. Nephrol.,
May 1, 2007;
18(5):
1408 - 1418.
[Abstract][Full Text][PDF]
C. W. Schweinfest, D. D. Spyropoulos, K. W. Henderson, J.-H. Kim, J. M. Chapman, S. Barone, R. T. Worrell, Z. Wang, and M. Soleimani slc26a3 (dra)-deficient Mice Display Chloride-losing Diarrhea, Enhanced Colonic Proliferation, and Distinct Up-regulation of Ion Transporters in the Colon
J. Biol. Chem.,
December 8, 2006;
281(49):
37962 - 37971.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
AE1), A2 (SLC4A2
