Glial Cell Line–Derived Neurotrophic Factor and Its Receptor Ret Is a Novel Ligand-Receptor Complex Critical for Survival Response during Podocyte Injury
Cynthia C. Tsui*,,
Stuart J. Shankland and
Brian A. Pierchala*
* Department of Biological Sciences, University at Buffalo, State University of New York, Buffalo, New York; and Division of Nephrology, Department of Medicine, University of Washington School of Medicine, Seattle, Washington
Address correspondence to: Dr. Cynthia C. Tsui, Department of Biological Sciences, University at Buffalo–The State University of New York, 109 Cooke Hall, North Campus, Buffalo, NY 14260. Phone: 716-365-4643, ext. 143; Fax: 716-365-2975; ctsui2{at}buffalo.edu
Received for publication August 9, 2005.
Accepted for publication March 23, 2006.
Glomerulosclerosis correlates with a reduction in podocyte numberthat occurs through mechanisms that include apoptosis. Whetherglial cell line–derived neurotrophic factor (GDNF), agrowth factor that is critical for neural and renal development,is a survival factor for injured podocytes was investigated.Ret, the GDNF receptor tyrosine kinase, was upregulated in podocytesin the passive Heymann nephritis and puromycin aminonucleoside(PA) nephrosis rat models of podocyte injury. In addition, RetmRNA and protein were upregulated in mouse podocytes in vitroafter injury that was induced by sublytic C5b-9 and PA. GDNF,which also was induced during podocyte injury, inhibited significantlythe apoptosis of podocytes that was induced by ultraviolet Cirradiation. Knockdown of Ret expression by small interferenceRNA in podocytes exacerbated apoptosis that was induced by bothultraviolet C and PA. Ret knockdown, upon injury, decreasedAKT phosphorylation, suggesting that the phosphoinositol-3 kinase/AKTpathway mediated the survival effect of GDNF on podocytes. Consistentwith this hypothesis, the selective phosphoinositol-3 kinaseinhibitor LY294002 blocked the survival-promoting effects ofGDNF. In conclusion, GDNF is a novel podocyte survival factor.Furthermore, Ret is highly upregulated during podocyte injuryin vitro and in vivo, suggesting that Ret activation is a criticaladaptive response for podocyte remodeling and repair.
Diabetic and nondiabetic glomerular diseases that result inproteinuria and glomerulosclerosis are the leading causes ofadult chronic renal disease and ESRD in the United States. Theprevalence and incidence are predicted to increase significantlyduring the next decade (1). Recent studies have identified animportant role for the podocyte in the pathogenesis of adultproteinuric diseases. Podocytes, or glomerular visceral epithelialcells, are terminally differentiated and morphologically complexcells that form the final barrier to protein leakage in theglomerulus (2,3). In response to injury, podocytes secrete cytokines,proteases, oxidants, and matrix proteins (3).
A large body of experimental and clinical literature pointsto the importance of podocyte loss in the development and progressionof glomerulosclerosis (4–6). This link and the relationshipbetween podocytopenia and proteinuria have also been observedin clinical studies of types 1 and 2 diabetes (7–9) andother, nondiabetic renal disease (10). These studies raise importantquestions regarding the mechanisms of podocytopenia, such asapoptosis, detachment, and a lack of proliferation. It is possiblethat progression of glomerulosclerosis can be diverted withprevention of the podocyte loss from apoptosis. During the injuryprocess, there is a critical period of coordinated gene expressionthat determines whether podocytes survive or are lost. We postulatedthat survival factors are expressed in response to podocyteinjury and act to support the recovery of injured podocytes.Given the similarities between the terminally differentiatedpodocyte and the neuron, we investigated whether glial cellline–derived neurotrophic factor (GDNF), a growth factorthat is critical for neuronal development, is a survival factorfor injured podocytes.
GDNF initially was identified from a rat glioma cell line asa survival factor for dopaminergic midbrain neurons (11). Sinceits initial discovery, the functions of GDNF in mammalian developmenthave expanded greatly (12,13). GDNF now is known to be essentialfor parasympathetic, enteric, and motor neuron development;for spermatogenesis; and for kidney morphogenesis (12–14).In kidney development, GDNF acts as an inductive factor thatis secreted from the nephrogenic mesenchyme, which promotesureteric bud formation (15–17). GDNF knockout mice havekidney agenesis and die only hours after birth, making in vivostudies of GDNF function in the kidney limited (15,17). In additionto the kidney agenesis that is seen in the absence of GDNF,mice that lack its signal transducing receptor, the Ret receptortyrosine kinase, or in mice that lack the co-receptor that isnecessary for GDNF binding and Ret activation, GDNF family receptor-(GFR), also have kidney agenesis (18–21).
Because both GDNF and Ret null mice have kidney agenesis, nostudy has characterized whether Ret and GDNF are involved directlyin glomerular or podocyte development or whether Ret or GDNFplays a direct role in kidney disease. We report here for thefirst time that Ret is expressed specifically in podocytes duringdevelopment and in adulthood. GDNF and Ret are induced significantlyin animal models of podocyte injury. Moreover, GDNF, actingthrough Ret, is a potent survival factor for injured podocytesand promotes protection from injury via activation of the phosphoinositol-3kinase (PI3-K)/AKT pathway.
Cell Culture
Two conditionally immortalized mouse podocyte cell lines wereused for the cell culture experiments, referred to as heat-sensitivemouse podocytes (HSMP). The methods that are used to generatethese cell lines have been described previously (22). All experimentswere performed on differentiated cells from passages 14 to 24and were performed on triplicate plates from two to four independentcultures. Podocytes were maintained at 10% FBS in RPMI (InvitrogenCorp., Carlsbad, CA) and replaced with fresh medium 24 h beforeall experiments.
C5b-9 Complement Injury of Podocytes
For determination of whether Ret expression is regulated duringpodocyte injury, sublytic antibody C5b-9 stimulation was usedas an in vitro model. Differentiated HSMP were divided intothree groups as described previously (23,24). For ensuring sublyticcomplement injury, the selection of the antibody and complementconcentrations was based on the maximal amounts of antibodyand complement that could be used without inducing cell lysis(defined as >5% lactate dehydrogenase release), using theLDH Kinetic Assay Kit (Sigma, St. Louis, MO). Ret expressionwas measured by Western blot analysis of whole-cell lysates(WCL) from these cells after 24 h, as described next.
Semiquantitative Reverse Transcription–PCR
After the treatments described in the figures, RNA was purifiedfrom podocytes using the TRIzol reagent (Sigma) and was reversetranscribed by using Superscript II Endo H (Invitrogen). ThiscDNA subsequently was used for PCR. Actin was amplified to controlfor the amount of mRNA present in each sample. Care was takennot to go beyond the linear range of the PCR reactions, andonly the minimum number of cycles that were necessary to amplifya detectable product was used. For GDNF, Ret, and actin amplifications,the number of cycles used were 45, 35, and 25, respectively.PCR products were electrophoresed on agarose gels and quantifiedwith a ChemiDoc XRS imaging system using QuantityOne software(Bio-Rad Laboratories, Inc., Hercules, CA). The primers wereas follows: GDNF forward ATGAAGTTATGGGATGTCGTGGCTG and reverseACCGTTTAGCGGAATGCTTTCTTAG, Ret forward GGATGGAGAGGCCAGACAACTGCAGCand reverse CCATAGAGTTTGTTTTCAATCCATGTGG, and actin forwardTATGGAGAAGATTTGGCACC and reverse GTCCAGACGCAGGATGGCAT.
Real-Time PCR
The expression of neurturin (NRTN), GFR1, and GFR2 was analyzedby using real-time PCR. Probe-based primer sets were generatedusing light upon extension technology (Invitrogen), and quantitativePCR was performed on a MiniOpticon System (Bio-Rad Laboratories,Inc.). NRTN, GFR1, and GFR2 expression was monitored with FAM-labeledprobes and compared directly to glyceraldehyde-3-phosphate dehydrogenaseby multiplex analysis with a JOE-labeled glyceraldehyde-3-phosphatedehydrogenase primer set (Invitrogen). The cycle conditionswere as follows: 95°C for 15 s, 55°C for 30 s, and 72°Cfor 30 s. After 45 cycles, melting profiles were produced toconfirm amplification of the intended targets. The primer sequenceswere as follows (* indicates the location of the fluorophore):GFR1 forward CGGAACAGCGAGACCATCCTTTC*G and reverse CCAATGTATCGGGCAGTACACA,GFR2 forward CGGAGGACAACTGCAAGAAGCTC*G and reverse GCAGCGTTCAGTGGGAGAGA,and NRTN forward CGGTCCTACACGTCGGATGAGAC*G and reverse CCAGGTCGTAGATGCGGATG.
Experimental Design to Determine Whether GDNF Protects Podocytes
Podocytes were exposed to recombinant GDNF (25) at 50 ng/mlor vehicle alone (1 mM HCl) beginning on day 1 of restrictiveconditions. GDNF was replaced every 48 h in the culture mediumfor 14 d. To measure podocyte number, phase contrast photoswere taken 6 and 12 d after exposure to GDNF or vehicle aloneat day 12. Immunocytochemistry using goat anti-actin (1:500;Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was performedon methanol-fixed cells to assess the status of the actin cytoskeletonbetween GDNF- and vehicle-exposed podocytes at day 12. A biotinylatedhorse anti-goat secondary antibody was used at a 1:500 dilution,followed by streptavidin-conjugated Alexa Fluor 594 (1:200,Invitrogen), to visualize actin.
MTT Assay
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide]assays were used as a measurement of cell viability. HSMP cellswere exposed to GDNF or vehicle alone from day 1 to day 9 underrestrictive conditions, at which point the MTT assay was performed(Nonradioactive Cell Proliferation Assay; Promega, Madison,WI).
Cell-Cycle Analysis by Flow Cytometry
HSMP cells were plated at 2500 cells/cm2 in 10-cm plates andtreated with GDNF (50 ng/ml) or vehicle alone from day 1 ofrestrictive conditions. At differentiated days 8 to 10, cellswere trypsinized, harvested, centrifuged, and prepared for cell-cycleanalysis by flow cytometry. Cells were resuspended and fixedin 70% ethanol for 1 h at 4°C. Cells were washed twice inPBS before staining with propidium iodide (PI; 10 µl ofIgepal, 20 µg/ml RNase A, and PI 50 µg/ml [all fromSigma] in 1x PBS) for 10 min at 37°C. DNA content was analyzedby flow cytometry using a BD FACScan analyzer (BD Biosciences,Rockville, MD). The percentage of the cells in G1, G0, and G2/Mphases was determined. Relative cell size was determined byforward-angle light scatter. All experiments were repeated atleast three times. The data were presented as the mean valuewith SD and represent the percentage of DNA content in the indicatedcell-cycle phase(s) from three independent experiments.
Measuring Apoptosis in Cells Exposed to GDNF
Cells were exposed to GDNF (50 ng/ml) or vehicle alone for 60min, and apoptosis then was induced by ultraviolet-C (UV-C)irradiation (25 mJ/m2). For determination of whether the PI3-K/AKTpathway mediated the effect of GDNF on podocyte survival, aselective PI3-K inhibitor (LY294002, 50 µM; Cell SignalingTechnology, Beverly, MA) or vehicle (DMSO) was given 1 h beforeGDNF exposure in the presence and absence of UV-C. Apoptosiswas measured by counting Hoechst 33342–positive (Sigma)nuclei that were pyknotic and by measuring caspase-3 activity.For Hoechst staining, in each sample, 300 to 400 cells wererandomly counted and scored as positive or negative. Apoptosiswas determined 3 h after UV and expressed as the percentageof positive cells. A colorimetric assay was used to measurecaspase-3 activity (BD ApoAlert Caspase-3 colorimetric assaykit; BD Biosciences). Cells were harvested for caspase activitymeasurements 3 h after UV. Samples were read by a Packard SpectraCount(405 nm; Packard Bioscience, Meriden, CT).
Western Analysis of Ret
Protein expression of Ret, phospho-Y905Ret, phospho-serine 473-AKT,total AKT, and p53 was measured by Western analysis as describedpreviously (25). Confluent HSMP were washed and denatured. Equalvolumes of WCL were separated by SDS-PAGE using 4 to 12% gradientTris-glycine minigels (Invitrogen) and transferred to polyvinylidenedifluoride membranes (Millipore, Bedford, MA). Blots were blockedwith 2% BSA (Sigma) in Tris-buffered saline (pH 7.4) that contained0.1% Tween-20 at room temperature for 1 h. The blots were probedovernight at 4°C using rabbit polyclonal antibodies to Ret9and Ret 51 (Santa Cruz Biotechnology, Inc.), to phospho-serine473-AKT, to total AKT, and to p53 (Cell Signaling Technology).The Ret9 antibody was used at 1:500 dilution, and all otherantibodies were used at a 1:1000 dilution. The immunoblots werevisualized using a chemiluminescent substrate (Pierce Biotechnology,Inc., Rockford, IL).
Ret Knockdown Using Small Interference RNA
Ret small interference RNA (siRNA) knockdown was performed byusing transient transfection of pooled functionally validatedRet siRNA (SMARTpool mouse RET siRNA; Dharmacon, Lafayette,CO). HSMP cells that were differentiated for 10 to 12 d weremaintained at 10% FBS/RPMI as described above and transfectedusing the i-Fect siRNA transfection reagent (Neuromics, Northfield,MN). For determination of the transfection efficiency, a TexasRed–labeled siRNA (siGLO RISC-Free siRNA; Dharmacon) wasco-transfected with Ret siRNA and visualized using fluorescencemicroscopy. For control siRNA samples, identical conditionswere used with the substitution of siGLO-RISC-Free siRNA forRet siRNA. For determination of the efficiency of Ret knockdown,Western analysis for Ret was performed on WCL from cells 24to 96 h after the transfection. Several concentrations of RetsiRNA (40, 60, and 100 nM) were tested to determine optimalknockdown conditions. For apoptosis assays, podocytes were exposedto UV-C or PA (40 µg/ml) on days 3 to 4 after transfectionof Ret siRNA or control siRNA (100 nM). Apoptosis was measuredby counting podocytes with Hoechst-positive pyknotic nuclei3 h after UV and 5 h after exposure to PA.
Embryonic Kidneys
For determination of the temporal expression of Ret during podocytedevelopment by immunostaining, embryonic kidneys of gestationalages E18, E21, and P1 were harvested from C57/Blk6 mice (Simonsen,Gilroy, CA). Kidneys were fixed in methyl Carnoy’s solutionand paraffin embedded for immunoperoxidase staining.
Experimental Animal Models of Podocyte Injury
Passive Heymann nephritis (PHN) was induced in male Sprague-Dawleyrats (180 to 200 g; Simonsen) by intraperitoneal injection ofsheep anti-mouse podocyte IgG (26). A control group of ratsreceived normal sheep serum. Control and PHN rats were killedon day 10 (n = 3 per group) after antibody injection. For puromycinaminonucleoside nephrosis (PAN) induction, male Sprague-Dawleyrats (Charles River Laboratories, Wilmington, MA) were givenpuromycin (6 mg/100 g; Sigma) by tail-vein injection. Control(saline injection alone) and PAN rats were killed and theirkidneys were harvested on day 7 after the injections. All animalstudies were conducted according to the animal welfare guidelinesof the University of Washington and the University of Buffalo,SUNY.
Immunostaining Analysis
Kidneys from mice or rats were fixed as described previously(26). Tissues were stained for Ret using the avidin-biotin indirectimmunoperoxidase method. Sections were incubated overnight at4°C with a goat anti-Ret antibody (1:100 to 1:200; R&DSystems, Minneapolis, MN). The specificity of this antibodyfor immunohistochemistry was confirmed previously in tissuesfrom Ret knockout mice (27). This was followed by a secondarybiotinylated rabbit anti-goat IgG (Zymed, San Francisco, CA)and horseradish peroxidase streptavidin (Vector, Burlingame,CA). 3,3'-Diaminobenzidine (Sigma) with nickel chloride (NiCl)was used as the chromogen with the PAN tissues and without NiClwith the PHN tissues. To determine whether Ret immunostainingco-localizes with WT-1, a podocyte-specific marker, we performeddouble staining by immunostaining for WT-1 using a rabbit polyclonalWT-1 antibody (1:20; Santa Cruz Biotechnology) and Ret. Anti-goatAlexa Fluor 488 and anti-rabbit Alexa Fluor 594 (Invitrogen)were used to visualize Ret and WT-1, respectively. All antibodieswere diluted in PBS with 2% BSA. Some sections were counterstainedusing either periodic acid-Schiff or methyl green.
Microscopy
All immunohistological stainings were imaged with an Axiovert200M microscope (Carl Zeiss Inc., Oberkochen, Germany), andphotos were generated by using Axiovision v4.5 software.
GDNF and Ret Are Upregulated after Podocyte Injury In Vitro
To investigate whether GDNF and Ret are involved in podocyteinjury, we measured the mRNA levels of GDNF and Ret by usingreverse transcription–PCR (rt-PCR). Mouse podocytes wereexposed to PA, a toxin that is known to induce PAN in rodents,for various lengths of time. A low abundance of Ret mRNA wasdetected in control cells that were not exposed to PA (Figure 1).In contrast, Ret was upregulated upon podocyte injury with PAby 6 h, and the level of Ret peaked within 24 h (Figure 1A).Amplification of actin confirmed the analysis of equal amountsof cDNA. Quantification of the data revealed that Ret was upregulatedby 3.1-fold. Similar to Ret, GDNF mRNA was expressed at lowabundance in control cells, and GDNF mRNA upregulation was notdetected at either 3 or 6 h after injury with PA (data not shown)but was observed to peak within 12 h and declined thereafter(2.2-fold induction; Figure 1B).
Figure 1. Ret and glial cell line–derived neurotrophic factor (GDNF) are upregulated upon injury in podocytes in vitro as determined by semiquantitative reverse transcription–PCR (RT-PCR). (A) Mouse podocytes in culture were exposed to puromycin aminonucleoside (PA) at 10 µg/ml for 3, 6, 24, or 48 h or with vehicle alone, and total RNA was purified. RNA was subjected to RT-PCR analysis for Ret (top) or actin to control for the cDNA samples (bottom). To control for potential contamination of the RNA with genomic DNA, RNA that had not been reverse transcribed did not amplify PCR products (RT; right-most lane). The approximate sizes of the products amplified were 550 bp for GDNF, 280 bp for Ret, and 300 bp for actin. (B) For determination of whether GDNF was increased after PA exposure, GDNF and Ret mRNA were measured by RT-PCR 12 and 24 h after PA exposure. Densitometric analyses indicate a 3.1- and 2.2-fold induction of Ret and GDNF at 12 h, respectively. Results were obtained from three independent experiments.
To determine whether the level of Ret protein increased in othermodels of podocyte injury, sublytic complement (C5b-9) injurywas used. Podocytes first were exposed to a sheep anti-mouseantibody and then exposed to serum to induce sublytic complementattack. WCL were harvested from these cells after 24 h and wereanalyzed by using Western blotting (Figure 2A). Densitometricanalysis revealed that Ret9 protein was upregulated by at least4.5-fold compared with control, uninjured podocytes. Ret wasdetected as a doublet from both podocytes and primary superiorcervical ganglia neurons, which in culture express Ret in abundance,and were used as a positive control (last lane). Analysis ofGDNF protein expression was not conducted because of the verylow levels of expression that typically has been observed andbecause of the inadequate sensitivity of the antibodies thatare available. Podocytes injured by PA exposure also showedincreased Ret9 expression as early as 12 h and maintained thisupregulation at least 48 h after injury (Figure 2B). It is interestingthat, Ret51 expression was much lower than Ret9 in podocytes,and only a modest upregulation of Ret51 could be detected withPA injury (Figure 2B). Taken together, these data indicate thatRet mRNA and protein and GDNF mRNA are upregulated subsequentto podocyte injury in two independent in vitro models. To investigatewhether Ret is activated in an autocrine manner in podocytes,we used a phospho-Ret antibody that detects Ret selectivelywhen autophosphorylated on the catalytic tyrosine Y905. Phospho-Y905Retimmunoblotting revealed an upregulation of Ret activity uponPA injury, consistent with the autocrine production of GDNFand subsequent activation of Ret. The kinetics of Ret autophosphorylationdiffered significantly from the increase in Ret protein (Figure 2B),indicating that the apparent induction in Ret autophosphorylationcannot be explained simply by an increase in Ret protein alone.
Figure 2. Upregulation of Ret protein after sublytic (C5b-9) complement and PA injuries in vitro. (A) Whole-cell lysates (WCL) were harvested 24 h after sublytic C5b-9 injury or control conditions, and Ret protein expression was determined by using Western blot analysis with a Ret9 antibody. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) immunoblotting served as a loading control and confirmed equal protein loading between samples. Ret protein was in low abundance in the absence of C5b-9 injury (lanes 1 and 2). In contrast, Ret increased after C5b-9 injury (lanes 3 through 6). A modest upregulation of Ret also was observed in cells treated with the sheep anti-mouse podocyte antibody in C6 serum, suggesting that there were some complement proteins in the culture medium (lane 7). WCL from superior cervical ganglia (SCG) neurons, which express very high levels of Ret, were assessed as a positive control to confirm that the molecular weight of Ret observed in podocytes corresponded with the glycosylated, mature forms of Ret (observed at 170 and 180 kD). Densitometric analyses revealed that Ret was upregulated by 4.5-fold upon C5b-9 injury at 24 h. (B) Podocytes were exposed to PA (10 µg/ml) or vehicle alone, and WCL were harvested at 0, 12, 24, and 48 h. Ret9 and Ret51 protein expression was determined by using antibodies against Ret9 and Ret51 (second and third panels). Longer chemiluminescent exposures indicated a low abundance of Ret51 as compared with Ret9 expression in podocytes. Upregulation of both proteins was detected with PA injury. PY905Ret immunoblotting (top) revealed that Ret is activated in an autocrine manner upon PA injury in heat-sensitive mouse podocytes (HSMP), reaching a maximum within 48 h of PA treatment.
Ret Is Expressed by Developing Mouse Podocytes In Vivo
To identify cell types that express Ret in developing glomeruli,embryonic mouse kidneys were harvested from E18 mice and analyzedby immunohistochemistry. Ret was detected in cells on the outeraspect of the glomerular tufts, a location that is typical ofpodocytes, but not in primordial cuboidal and columnar cellsin comma-shaped bodies (Figure 3A). In the cells that expressedRet, Ret staining was localized to the membrane and not thenucleus (Figure 3A). To determine the specific cell type thatexpresses Ret, serial sections were stained with WT-1, a nuclearpodocyte-specific protein of both primordial and developed podocytes.Cells that expressed both WT-1 and Ret were noted both fromthe capillary loop stage and in developed glomeruli (Figure 3,A and B). Periodic acid-Schiff staining, which allows the visualizationof the various cell types and basement membranes, further indicatedthat Ret expression resides in podocytes within the glomeruli(Figure 3C). Similar results were observed in kidneys from E21and P1 mice (data not shown).
Figure 3. Ret expression in developing kidneys in vivo. (A) Mouse embryonic kidneys were immunostained using a pan-Ret antibody as described in Materials and Methods. Ret staining was restricted to the plasma membrane and was excluded from the nucleus (arrowhead). (B) WT-1 immunostaining of serial sections confirmed the co-localization of WT-1 with Ret in maturing podocytes. (C) Periodic acid-Schiff staining of kidney sections revealed that the morphology of glomeruli was intact.
In Vivo Models of Glomerular Injury Cause Ret Upregulation in Podocytes
To determine whether Ret also is regulated during podocyte injuryin vivo, we studied PHN and PAN. A basal level of Ret stainingwas observed in podocytes from the kidneys of uninjured animals(Figure 4A, a and d). With PAN, the intensity of Ret stainingincreased in podocytes and was maximal within 7 d after injury(Figure 4A, b). Therefore, like the in vitro studies, Ret proteinlevels increase upon PAN injury in podocytes in vivo. To determinewhether Ret upregulation also could be observed in other modelsof podocyte injury, we compared Ret expression in the kidneysof control versus PHN rats at day 10, and the results are shownin Figure 4A, d through f. There was a marked increase in Retstaining in podocytes in PHN rats at day 10. Co-staining ofthese sections with Ret and WT-1 indicated that Ret is expressedin the cell bodies and processes of podocytes (Figure 4B). Therefore,like the in vitro studies, podocyte injury that is observedin the PHN model increases the expression of Ret in podocytes.Taken together, these results indicate that Ret expression isupregulated in both immune and nonimmune models of podocyteinjury in vivo.
Figure 4. Ret expression is upregulated in animal models of podocyte injury in vivo. (A) PAN and passive Heymann nephritis (PHN) models: Immunoperoxidase staining of Ret using a pan-Ret antibody was performed on kidney sections from rodents subjected to PAN and PHN. (a and d) Basal level of Ret expression was detected in control animals at day 7, and this localized to podocytes (arrowheads). (b) Ret staining increased 7 d after PA injury compared with vehicle alone (arrowhead). (c) Absence of staining using the secondary antibody alone. (e) Ret expression was increased at day 10 of PHN in a distribution indicative of podocytes (arrowhead). (f) Secondary antibody alone showed some nonspecific capillary loop staining, which was observed to be constant between conditions (d and e). (B) Ret expression co-localizes to podocytes. (a and c) Ret expression (green) isolated to cell bodies and processes (arrowheads, composite; c). These cells also expressed WT-1 (red) in nuclei in b (arrows, composite; c). (d) Nomarski photo of these fluorescence images.
GDNF Promotes Survival of Mouse Podocytes In Vitro
We used a culture system that generates podocytes that are postmitoticand differentiated and that express the appropriate podocyte-specificproteins (22). We tested whether GDNF can act as a survivalfactor for mouse podocytes in vitro. Podocytes under differentiatingconditions were treated with GDNF for various lengths of time.Podocytes maintained in the presence of GDNF for the longestduration, 12 d, had the highest cell number (Figure 5A). Incontrast, HSMP in the absence of GDNF had the least number ofcells (Figure 5A, a). In addition, the staining pattern of actinwas similar between GDNF- and vehicle-exposed podocytes, indicatingthat GDNF did not alter the actin cytoskeletal organizationof podocytes in vitro (Figure 5A, d through f). Likewise, theviability of GDNF-treated podocytes increased in a dose-dependentmanner, as determined by MTT assays (Figure 5B). Both 5 and50 ng/ml GDNF maintained podocyte viability maximally (P <0.05 compared with control), similar to the effective dosesobserved in other cell types. To determine whether exogenousGDNF increased the number of podocytes by stimulating theirproliferation, the cell-cycle stage of GDNF-treated podocyteswas examined by using PI staining coupled with cell-cycle analysisby flow cytometry. There was no change in the number of G0/G1or G2/M cells upon GDNF treatment as compared with control cells(Figure 5C). These results demonstrated that GDNF acted as asurvival factor for podocytes in vitro and increased significantlythe number of differentiated podocytes without altering theircell-cycle stage.
Figure 5. Exogenous GDNF increases podocyte number and enhances survival in vitro. (A) Mouse podocytes were exposed to vehicle alone for 12 d (a) and to GDNF at a concentration of 50 ng/ml for 6 d (b) or 12 d (c). Phase contrast microscopy revealed an increase in podocyte density with increasing lengths of time of exposure to GDNF. (d and e) Actin staining distributed throughout the cell bodies of podocytes exposed to vehicle alone for 12 d. Similar actin staining patterns were noted in GDNF-exposed cells for 12 d (f). These experiments were conducted in triplicate from three independent cultures on two different mouse podocyte cell lines. (B) For assessment of whether response to GDNF was dose dependent, podocyte viability was measured by using an MTT assay as described in Materials and Methods. Cells were treated with decreasing GDNF concentrations for 8 to 9 d, and their viability was measured and plotted. Cell viability was increased by 60 to 70% (P < 0.05) when GDNF was used at concentrations of 5 and 50 ng/ml. These results were done in triplicate in three independent cultures. (C) GDNF exposure did not cause proliferation or dedifferentiation of podocytes as determined by cell-cycle analysis using propidium iodide staining coupled with flow cytometry. There was no statistically significant difference in the percentage of cells in G0/G1 or G2/M stages of the cell cycle in cells treated with GDNF () or vehicle alone ().
GDNF Protects Mouse Podocytes from Apoptosis
To investigate whether GDNF inhibits apoptosis, we pretreateddifferentiated mouse podocytes with exogenous GDNF before UV-Cirradiation and measured apoptosis by monitoring both nuclearcondensation with Hoechst staining and caspase-3 activity. Inthe presence of GDNF, there was a 2.5-fold decrease in podocyteapoptosis as compared with cells without GDNF (3.7 ±0.4 versus 7.5 ± 0.5%; P < 0.01; Figure 6A). Likewise,GDNF significantly inhibited UV-induced caspase-3 activity ina dose-dependent manner, consistent with the notion that GDNFis protective under conditions of cellular stress (P < 0.05;Figure 6B).
Figure 6. Exogenous GDNF protects podocytes from apoptosis. (A) Apoptosis was measured by counting Hoechst-positive, pyknotic nuclei in mouse podocytes exposed to ultraviolet-C (UV-C) irradiation (25 mJ/m2) in the presence of GDNF () or vehicle alone (). GDNF decreased UV-induced apoptosis by two-fold compared with vehicle alone (P < 0.01). (B) Apoptosis was assessed under similar experimental conditions by measuring caspase-3 activity. GDNF (50 ng/ml) decreased caspase-3 activity by 30% (P < 0.05) compared with vehicle alone (expressed as 100%). These experiments were conducted in triplicate from two independent cultures.
Ret Knockdown with siRNA Exacerbates Podocyte Apoptosis
Because Ret and GDNF null mice have kidney agenesis (15,17,20)and die just after birth, we used an in vitro Ret knockdownsystem to determine whether Ret is necessary for podocyte survival.We consistently achieved close to 100% siRNA transfection efficiencyin podocytes as visualized by co-transfecting a fluorescentlytagged RISC-free siRNA marker with vehicle and 100 nM Ret siRNA(Figure 7A). We did not observe any morphologic changes betweencells with or without Ret siRNA knockdown during the 4 d aftertransfection. Confocal microscopy was used to exclude the possibilitythat the fluorescence observed was membrane associated as aresult of adsorption of the marker on the cell surface (datanot shown). Knockdown of Ret expression was determined to bemaximal between days 3 and 4 after transfection (Figure 7B).
Figure 7. Ret receptor knockdown using small interference RNA (siRNA) in podocytes. (A) Transfection efficiency: mouse podocytes were transfected with 100 nM concentrations of Ret siRNA or vehicle alone. (a) When podocytes were exposed to i-Fect alone, there was no toxicity. (a and b) A transfection efficiency of nearly 100% was achieved with 100 nM concentration of Ret siRNA (b). Co-transfection with a fluorescently tagged control siRNA was used to determine the transfection efficiency, and fluorescence microscopy revealed a perinuclear localization of the tagged RNA (b, arrowhead). (B) Western blot analysis of Ret after transfection: Ret immunoblotting (top) of WCL 2, 3, or 4 d after transfection revealed that Ret was downregulated within 2 d after transfection with 100 nM Ret siRNA. Transfection of control siRNA at day 4 served as a negative control, and the maximal knockdown of Ret was observed 4 d after transfection. GAPDH immunoblotting confirmed equal protein loading (bottom).
For testing whether Ret is involved in the injury process ofpodocytes in vitro, podocytes subjected to Ret knockdown wereinjured with PA. The knockdown of Ret alone did not induce podocyteapoptosis. However, significantly more podocytes underwent apoptosiswhen injured with PA in the presence of Ret knockdown (8.0 ±1.7 versus 2.7 ± 0.6%; P < 0.05) by measuring nuclearcondensation (Figure 8A). Likewise, more podocytes subjectedto UV-C injury underwent apoptosis when Ret expression was knockeddown, as compared with podocytes that expressed a basal levelof Ret (10.9 ± 0.4 versus 2.4 ± 0.9%; P < 0.01;Figure 8B). These studies indicate that, in the absence of Retreceptor activation, injured podocytes are considerably morelikely to undergo apoptosis.
Figure 8. Knockdown of Ret expression exacerbates apoptosis after podocyte injury in vitro. (A) PA exposure induced apoptosis in cultured mouse podocytes transfected with control siRNA after 5 h. Apoptosis was measured by counting Hoechst-stained, condensed nuclei. In cells transfected with Ret siRNA, Ret knockdown was associated with a three-fold increase in apoptosis compared with control siRNA (8.0 ± 1.7 versus 2.7 ± 0.6%; P < 0.05). (B) Cells transfected with Ret siRNA or control siRNA were UV irradiated. After 3 h, Ret siRNA-transfected cells had a five-fold increase in apoptosis as compared with control (10.9 ± 0.4 versus 2.4 ± 0.9%; P < 0.01).
Survival Effect of GDNF and Ret Requires the PI3-K/AKT Pathway
One of the most important survival pathways that are regulatedby growth factors is the PI3-K–mediated activation ofthe kinase AKT. To determine whether GDNF promoted survivalvia the PI3-K/AKT pathway, we used Western blot analysis toinvestigate whether Ret knockdown in injured podocytes alteredthe phosphorylation of AKT at Ser-473, which coincides withAKT kinase activity. Ret knockdown in podocytes dramaticallydecreased the level of p-Ser-473 AKT upon PA exposure (Figure 9A).However, downregulation of Ret did not affect the expressionof p53, a molecule that is known to be upregulated during PA-inducedpodocyte apoptosis within 24 h (Figure 9A).
Figure 9. The survival effect of Ret requires the phosphoinositol-3 kinase (PI3-K)/AKT pathway. (A) PA exposure (24 h) decreased AKT phosphorylation on Ser-473 in cells transfected with Ret siRNA as compared with cells transfected with control siRNA (top). PA did not affect the expression of total AKT (middle) or phospho-AKT in control siRNA-transfected podocytes. Ret knockdown did not alter the upregulation of p53 that occurs during PA-induced apoptosis (bottom). (B) PA injury: A selective PI3-K inhibitor (LY294002, 50 µM; ) did not further increase apoptosis in cells subjected to Ret knockdown. DMSO () was used as the vehicle control for LY294002. (C) UV irradiation: The in vitro survival effect of exogenous GDNF (50 ng/ml) was blocked by LY294002 treatment, as compared with cells exposed to vehicle alone, upon UV injury (16.9 ± 1.1 versus 3.7 ± 0.4%; P < 0.01).
To test whether the PI3-K pathway is required for the protectiveeffects of Ret on podocytes, we used the selective PI3-K inhibitorLY294002. Pretreatment of podocytes with LY294002 inhibitedsignificantly the survival effect of GDNF against UV-C irradiationcompared with vehicle alone (16.9 ± 1.1 versus 3.7 ±0.4%; P < 0.01; Figure 9, B and C). It is interesting thatexposure of podocytes that had undergone Ret knockdown (reducessurvival significantly, P < 0.05) to LY294002 did not causeany further increase in apoptosis, suggesting that the enhancementof apoptosis in injured podocytes upon Ret knockdown is dueto the loss of AKT activation in these cells (Figure 9B). Takentogether, these data indicate that the protective effects ofGDNF and Ret activation are due to the Ret-dependent regulationof the PI3-K/AKT pathway.
Expression of NRTN, GFR1, and GFR2 Is Not Regulated with Injury in Podocytes
To determine whether the co-receptor for GDNF, GFR1, was alsoupregulated upon injury in podocytes, quantitative real-timePCR was conducted. We also examined the expression of NRTN andits co-receptor, GFR2, during podocyte injury, which are knownto be expressed in developing kidney. Although GFR1, GFR2, andNRTN all were expressed in HSMP, their expression was not alteredduring PA injury of podocytes (Figure 10). Statistical analysisof these data indicated that there were no significant differencesin any of the injury conditions examined (all P > 0.1). Therefore,GDNF and Ret but not GFR1, GFR2, or NRTN are selectively upregulatedin podocytes by injury and act in an autocrine, protective manner.
Figure 10. GDNF family receptor-1 (GFR1), GFR2, and neurturin (NRTN) expression is not altered upon podocyte injury. GFR1, GFR2, and NRTN expression were analyzed by using qPCR in podocytes injured with PA. HSMP were treated with vehicle alone for 72 h or with PA (10 µg/ml) for 3, 12, 24, or 72 h. Total RNA was purified from the cells and reverse transcribed, and this product was subjected to real-time PCR analysis as described in Materials and Methods. The amount of cDNA in each sample was controlled for by multiplex analysis of GAPDH during the amplification of GFR1, GFR2, and NRTN. These data were graphed as the ratio of PA-treated cells to cells treated with vehicle alone. This experiment was conducted four to five times from two different independent cultures of HSMP, and error bars represent SEM.
Glomerulosclerosis is correlated with a reduction in podocytenumber (6). Despite the known importance of podocytes in renalphysiology and as a target of glomerular disease, the molecularmechanisms that control the survival of podocytes are incompletelyunderstood. Ret was upregulated at the mRNA and protein levelupon podocyte injury both in vitro and in vivo. Ret9 was thepredominate isoform expressed in podocytes, and its expressionwas most upregulated during injury. GDNF was upregulated duringpodocyte injury as well. Application of exogenous GDNF to podocytesinhibited significantly their apoptosis upon injury with UVirradiation. Likewise, the selective silencing of Ret in podocytesexacerbated the proapoptotic effects of UV-C and PA. The PI3-K/AKTpathway was required for the protective effects of GDNF andRet during podocyte injury, together implicating GDNF-dependentactivation of Ret as a novel growth factor system in podocytedevelopment and disease.
The observation that Ret was expressed in developing podocytesin vivo but was not detected in primordial podocytes suggeststhat Ret is involved in the maturation of podocytes. GDNF functionsin kidney development as an inductive factor that is secretedfrom the nephrogenic mesenchyme and, through Ret activation,promotes ureteric bud formation (14). Mice that are heterozygousfor GDNF have impaired ureteric bud formation, decreased nephronmass, and subsequent development of hypertension (28,29). Theconclusion of these studies is that a reduction in GDNF, whichdiminishes ureteric bud branching during embryonic development,endows these mice with fewer nephrons. Our finding that Retis highly expressed in developing glomeruli, along with thepotent survival effects of GDNF on podocytes, may revise thisview by suggesting that GDNF and Ret are critical for podocytedevelopment and survival in the glomeruli and, therefore, contributedirectly to nephron number independently. An important futuredirection will be to examine the requirement of Ret in podocytedevelopment, which would require a conditional knockout strategyin podocytes because of kidney agenesis that occurs upon Retdeletion (20,21).
Many cell types respond to injury by enacting coordinated geneticprograms. These responses can serve to modify the cell in anadaptive manner toward the noxious stimuli and promote theirrecovery after an injury. Alternatively, cells that are unableto recover from an injury express cell death programs to bringabout their orderly demise. The upregulation of GDNF and Ret,in combination with the significant protective effects of GDNF,indicates that GDNF is part of an adaptive, recovery responseto podocyte injury. This is the first observation that GDNF,acting through Ret, functions in an injury paradigm in the kidney.These data raise the exciting therapeutic possibility of givingexogenous GDNF to patients with glomerular disease that is characterizedby a loss of podocytes, such as diabetes, membranous nephropathy,and focal segmental glomerulosclerosis. Future in vivo studiesof podocyte injury models with GDNF and other GDNF family ligandsare critical to help delineate their potential in kidney disease.
These observations also raise the more general possibility thatmultiple growth factors may guide the development of kidneysas well as their remodeling during adult disease processes.Given that both GDNF and Ret are upregulated in injured podocytes,GDNF likely acts in an autocrine manner to support podocytesurvival. Consistent with this hypothesis, Ret is activatedin podocytes upon injury without the upregulation of NRTN, theother GDNF family member that is known to be expressed in kidney.GDNF may act in a paracrine manner as well, and there is evidencethat mesangial cells can respond to GDNF in vitro (30,31). Becausekidney diseases undoubtedly involve cross-talk mechanisms betweencell types, growth factors such as GDNF are well poised to communicatesuch signals. It will be important in the future to considerother growth factor systems as a means of better understandingthe complex communication and coordinated responses of variouscell types during kidney disease.
Acknowledgments
This work was supported by National Institutes of Health grantsto S.J.S. (DK60525, DK56799, and DK51096) and to B.A.P. (KO1-NS-045221).S.J.S. also is an Established Investigator of the American HeartAssociation.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
US Renal Data System: USRDS 1998 Annual Data Report, Bethesda, National Institute of Diabetes and Digestive and Kidney Diseases, 2000
Mundel P, Shankland SJ: Glomerular podocytes and adhesive interaction with glomerular basement membrane. Exp Nephrol 7
: 160–166, 1999[CrossRef][Medline]
Mundel P, Shankland SJ: Podocyte biology and response to injury. J Am Soc Nephrol 13
: 3005–3015, 2002[Free Full Text]
Kim Y-H, Goyal M, Kurnit D, Wharram B, Wiggins J, Holzman L, Kershaw D, Wiggins R: Podocyte depletion and glomerulosclerosis have a direct relationship in the PAN-treated rat. Kidney Int 60
: 957–968, 2001[CrossRef][Medline]
Kriz W, Elger M, Nagata M, Kretzler M, Uiker S, Koeppen-Hagemann I, Tenschert S, Lemley K: The role of podocytes in the development of glomerular sclerosis. Kidney Int Suppl 45
: S64–S72, 1994[Medline]
Kriz W, Kretzler M, Nagata M, Provoost AP, Shirato I, Uiker S, Sakai T, Lemley KV: A frequent pathway to glomerulosclerosis: Deterioration of tuft architecture-podocyte damage-segmental sclerosis. Kidney Blood Press Res 19
: 245–253, 1996[Medline]
Steffes MW, Schmidt D, Mccrery R, Basgen JM: Glomerular cell number in normal subjects and type I diabetic patients. Kidney Int 59
: 2104–2113, 2001[Medline]
Meyer TW, Bennett PH, Nelson RG: Podocyte number predicts long-term urinary albumin excretion in Pima Indians with type II diabetes and microalbuminuria. Diabetologia 42
: 1341–1344, 1999[CrossRef][Medline]
Pagtalunan ME, Miller PL, Jumping-Eagle S, Nelson RG, Myer BD, Rennke HG, Coplon NS, Sun L, Meyer TW: Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 15
: 342–348, 1997
Lemley KV, Lafayette RA, Safai M, Derby G, Blouch K, Squarer A, Myers BD: Podocytopenia and disease severity in IgA nephropathy. Kidney Int 61
: 1475–1485, 2002[CrossRef][Medline]
Lin LF, Doherty DH, Lile JD, Bektesh S, Collins F: GDNF: A glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260
: 1130–1132, 1993[Abstract/Free Full Text]
Airaksinen MS, Saarma M: The GDNF family: Signalling, biological functions and therapeutic value. Nat Rev 3
: 383–394, 2002
Baloh RH, Enomoto H, Johnson EM Jr, Milbrandt J: The GDNF family ligands and receptors-implications for neural development. Curr Opin Neurobiol 10
: 103–110, 2000[CrossRef][Medline]
Manie S, Santoro M, Fusco A, Billaud M: The RET receptor: Function in development and dysfunction in congenital malformation. Trends Genet 17
: 580–589, 2001[CrossRef][Medline]
Moore MW, Klein RD, Farinas I, Sauer H, Armanini M, Phillips H, Reichardt LF, Ryan AM, Carver-Moore K, Rosenthal A: Renal and neuronal abnormalities in mice lacking GDNF. Nature 382
: 76–79, 1996[CrossRef][Medline]
Pichel JG, Shen L, Sheng HZ, Granholm AC, Drago J, Grinberg A, Lee EJ, Huang SP, Saarma M, Hoffer BJ, Sariola H, Westphal H: Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382
: 73–76, 1996[CrossRef][Medline]
Sanchez MP, Silos-Santiago I, Frisen J, He B, Lira SA, Barbacid M: Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 382
: 70–73, 1996[CrossRef][Medline]
Trupp M, Arenas E, Fainzilber M, Nilsson AS, Sieber BA, Grigoriou M, Kilkenny C, Salazar-Grueso E, Pachnis V, Arumae U: Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381
: 785–789, 1996[CrossRef][Medline]
Cacalano G, Farinas I, Wang LC, Hagler K, Forgie A, Moore M, Armanini M, Phillips H, Ryan AM, Reichardt LF, Hynes M, Davies A, Rosenthal A: GFRalpha1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron 21
: 53–62, 1998[CrossRef][Medline]
Schuchardt A, D’Agati V, Larsson-Blomberg L, Constantini F, Pachnis V: Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 27
: 380–383, 1994
Schuchardt A, D’Agati V, Pachnis V, Costantini F: Renal agenesis and hypodysplasia in ret-k– mutant mice result from defects in ureteric bud development. Development 122
: 1919–1929, 1996[Abstract]
Mundel P, Reiser J, Zuniga Mejia Borja A, Pavenstadt H, Davidson R, Kriz W, Zeller R: Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236
: 248–258, 1997[CrossRef][Medline]
Shankland SJ, Pippin JW, Couser WG: Complement (C5b-9) induces glomerular epithelial cell DNA synthesis but not proliferation in vitro. Kidney Int 56
: 538–548, 1999[CrossRef][Medline]
Pippin JW, Durvasula R, Petermann A, Hiromura K, Couser WG, Shankland SJ: DNA damage is a novel response to sublytic complement C5b-9-induced injury in podocytes. J Clin Invest 111
: 877–885, 2003[CrossRef][Medline]
Tsui-Pierchala BA, Ahrens RC, Crowder RJ, Milbrandt J, Johnson EM Jr: The long and short isoforms of Ret function as independent signaling complexes. J Biol Chem 277
: 34618–34625, 2002[Abstract/Free Full Text]
Shankland SJ, Pippin J, Pichler RH, Gordon KL, Friedman S, Gold LI, Johnson RJ, Couser WG: Differential expression of transforming growth factor-beta isoforms and receptors in experimental membranous nephropathy. Kidney Int 50
: 116–124, 1996[Medline]
Golden JP, Milbrandt J, Johnson EM Jr: Neurturin and persephin promote the survival of embryonic basal forebrain cholinergic neurons in vitro. Exp Neurol 184
: 447–455, 2003[CrossRef][Medline]
Cullen-McEwen LA, Kett MM, Dowling J, Warwik PA, Bertram JF: Nephron number, renal function, and arterial pressure in aged GDNF heterozygous mice. Hypertension 41
: 335–340, 2003[Abstract/Free Full Text]
Orth SR, Ritz E, Suter-Crazzolara C: Glial cell line-derived neurotrophic factor (GDNF) is expressed in the human kidney and is a growth factor for human mesangial cells. Nephrol Dial Transplant 15
: 589–595, 2000[Abstract/Free Full Text]
Kalechman Y, Sredni B, Weinstein IF, Tobar A, Albeck M, Gafter U: Production of the novel mesangial autocrine growth factors GDNF and IL-10 is regulated by the immunomodulator AS101. J Am Soc Nephrol 14
: 620–630, 2003[Abstract/Free Full Text]
This article has been cited by other articles:
C. C. Tsui and B. A. Pierchala CD2AP and Cbl-3/Cbl-c Constitute a Critical Checkpoint in the Regulation of Ret Signal Transduction
J. Neurosci.,
August 27, 2008;
28(35):
8789 - 8800.
[Abstract][Full Text][PDF]
H. Shi, D. Patschan, G. P. H. Dietz, M. Bahr, M. Plotkin, and M. S. Goligorsky Glial cell line-derived neurotrophic growth factor increases motility and survival of cultured mesenchymal stem cells and ameliorates acute kidney injury
Am J Physiol Renal Physiol,
January 1, 2008;
294(1):
F229 - F235.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
(GFR
) or vehicle alone (
).
