Oxidative Stress Causes Renal Dopamine D1 Receptor Dysfunction and Hypertension via Mechanisms That Involve Nuclear Factor-B and Protein Kinase C
Anees Ahmad Banday,
Fatima Rizwan Fazili and
Mustafa F. Lokhandwala
Heart and Kidney Institute, College of Pharmacy, University of Houston, Houston, Texas
Address correspondence to: Dr. Mustafa F. Lokhandwala, Department of Pharmacology, University of Houston, 4800 Calhoun Road, S & R-2 Building, Houston, TX 77204. Phone: 713-743-3777; Fax: 713-743-1230; E-mail: mlokhandwala{at}uh.edu
Received for publication December 19, 2006.
Accepted for publication March 1, 2007.
Renal dopamine, via activation of D1 receptors, plays a rolein maintaining sodium homeostasis and BP. There exists a defectin renal D1 receptor function in hypertension, diabetes, andaging, conditions that are associated with oxidative stress.However, the exact underlying mechanism of the oxidative stress–mediatedimpaired D1 receptor signaling and hypertension is not known.The effect of oxidative stress on renal D1 receptor functionwas investigated in healthy animals. Male Sprague-Dawley ratsreceived tap water (vehicle) and 30 mM L-buthionine sulfoximine(BSO), an oxidant, with and without 1 mM tempol for 2 wk. Comparedwith vehicle, BSO treatment caused oxidative stress and increasein BP, which was accompanied by defective D1 receptor G-proteincoupling and loss of natriuretic response to SKF38393. BSO treatmentalso increased NF-B nuclear translocation, protein kinase C(PKC) activity and expression, G-protein–coupled receptorkinase-2 (GRK-2) membranous translocation, and D1 receptor serinephosphorylation. In BSO-treated rats’ supplementationof tempol decreased oxidative stress, normalized BP, and restoredD1 receptor G-protein coupling and natriuretic response to SKF38393.Tempol also normalized NF-B translocation, PKC activity andexpression, GRK-2 sequestration, and D1 receptor serine phosphorylation.In conclusion, these results show that oxidative stress activatesNF-B, causing an increase in PKC activity, which leads to GRK-2translocation and subsequent D1 receptor hyper–serinephosphorylation and uncoupling. The functional consequence ofthis phenomenon was the inability of SKF38393 to inhibit Na/K-ATPaseactivity and promote sodium excretion, which may have contributedto increase in BP. Tempol reduced oxidative stress and therebyrestored D1 receptor function and normalized BP.
Dopamine is recognized as an important regulator of sodium homeostasisand BP (1). The effects of dopamine are exerted by cell surfacereceptors that belong to the rhodopsin-like family and are classifiedas D1- and D2-like receptors (2). Dopamine, via D1 receptoractivation, can inhibit Na/K-ATPase and Na/H-exchanger 3 (NHE3)on the basolateral and apical side of the renal proximal tubule,respectively, and increase sodium excretion (3). Abnormalitiesin renal dopamine D1 receptor function have been described inboth human and animal models of hypertension (4–6). Ingenetic hypertension, there is a failure of inhibition by D1-likereceptor agonists of Na/K ATPase and NHE3 activities in therenal proximal tubule (4–6). In spontaneously hypertensiverats, Dahl salt-sensitive rats, obese Zucker rats, and youngpatients with essential hypertension, the defect is due to anabnormal regulation of Dl-like receptor signal transduction(6–10). The failure of dopamine to inhibit sodium transportersis not caused by abnormalities in D1 receptor protein abundance,G proteins, or effector proteins. Rather, the D1 receptor isuncoupled from its G protein/effector complex, resulting ina decreased production of cytoplasmic second messengers thatnormally inhibit sodium transporters (6–10).
There is emerging evidence that in hypertensive conditions,the impaired renal D1 receptor signaling coexists with oxidativestress (7,11–14). In our studies, we found that conditionssuch as aging, diabetes, and hypertension are associated withincreased oxidative stress (7,15,16). For example, we foundincreased oxidative stress in mildly hypertensive obese Zuckerrats compare with lean rats (7). Also, the ability of dopamineto inhibit sodium transporters and promote sodium excretionwas markedly diminished in obese compared with lean rats (7).
The most rapid means by which G-protein–coupled receptor(GPCR) are uncoupled from G-proteins and desensitized is viaphosphorylation by intracellular kinases (17). It is reportedthat both second messenger–dependent protein kinases suchas protein kinase C (PKC) and GPCR kinases (GRK) phosphorylateintracellular serine and threonine residues of GPCR (17–19).Previously, we showed that in obese Zucker rats, increased oxidativestress caused increased PKC activity and GRK-2 translocation,leading to D1 receptor desensitization (7). Recently, in a moredirect study, we showed that exposure of primary cultures toH2O2 led to D1 receptor phosphorylation, which was caused byPKC activation and GRK-2 translocation (20). Also, overwhelmingevidence suggests that the dimeric NF-B transcription factorsare key regulators in response to oxidative stress or inflammation(21,22). Upon stimulation, including oxidative stress, NF-Btranslocates into nucleus, where it further stimulates expressionof target genes that are involved in important cellular events,including PKC (23,24).
Although there is evidence to suggest that reactive oxygen species(ROS) contribute to decreased D1 receptor function (7,13,20),it is not known whether oxidative stress by itself causes defectiverenal D1 receptor function and hypertension, or the onset ofhypertension leads to oxidative stress and subsequent D1 receptordysfunction. To ascertain the role of oxidative stress in D1receptor defect and hypertension, we treated normotensive Sprague-Dawleyrats with L-buthionine sulfoximine (BSO), an oxidant, with andwithout the antioxidant tempol. At the end of the 2-wk treatmentregimen, the rats were studied for oxidative stress; intracellularsignaling molecules such as NF-B, PKC, and GRK-2; and D1 receptorsignaling and function and BP.
Animals
Male Sprague-Dawley rats (Harlan, Indianapolis, IN) were feda normal rat diet and divided into following groups: Vehicle,animals that were maintained on tap water; BSO, animals thatwere provided with 30 mM BSO (Sigma, St. Louis, MO); tempol,animals that were provided with 1 mM tempol (Sigma); and BSO+ tempol, animals that were provided with BSO supplemented withtempol. BSO, a -glutamylcysteine synthetase inhibitor, and tempol,a superoxide dismutase (SOD) mimetic compound, were providedin drinking water for 2 wk. All experiments were performed accordingto University of Houston guidelines and protocols for care anduse of laboratory animals.
Surgical Procedures for Renal Function Studies
Rats were anesthetized with Inactin (100 mg/kg intraperitoneally;Sigma), and a tracheotomy was performed to facilitate breathing(16). For measurement of BP and heart rate, the left carotidartery was catheterized with PE-50 tubing and connected to apressure transducer. Heart rate was monitored from a cardiotachograph,and both BP and heart rate were recorded on Grass polygraph(Grass Instrument, Quincy, MA).
Experimental Protocol for Renal Function Studies
For determination of the effect of SKF38393 (Sigma) on sodiumand water excretion, rats were stabilized for 45 min after surgeryand followed by five consecutive 30-min collection periods:C1, C2, D, R1, and R2. During C1 and C2, saline alone was infused;during D, SKF38393 (1 µg/kg body wt per min in saline)was infused; and during R1 and R2 (recovery), only saline wasinfused (16). Urine samples were collected throughout the 30-minperiods. Sodium was measured by flame photometer (Cole-Parmer,Vernon Hills, IL), plasma and urine creatinine levels were measuredwith a creatinine analyzer (Beckman, Fullerton, CA), and fractionalexcretion of sodium was determined as described previously (16).Blood glucose was measured by glucose analyzer (Roche, Indianapolis,IN), and urinary dopamine was measured by HPLC (Waters, Milford,MA).
Preparation of Renal Proximal Tubular Suspension
Renal proximal tubules were isolated as described by us previously(16). Cell membranes were isolated by differential centrifugation(16), whereas nuclear and cytosolic fractions were isolatedby a commercially available Kit (78833; Pierce, Rockford, IL).Protein was determined by bicinchoninic acid method (Pierce)using BSA as a standard.
Indices of Oxidative Stress
Renal glutathione levels were assayed by colorimetric assaykit (21023; OXIS, Foster City, CA), 8-isoprostane was measuredby RIA kit (516351; Cayman, Ann Arbor, MI), and nitrotyrosinewas determined by immunoblotting kit (Upstate, Charlottesville,VA). Malondialdehyde was determined by the method of Miharaand Uchiyama (25).
[3H]SCH23390 Binding
Fifty micrograms of membrane protein was incubated with 50 nmol/L[3H]SCH23390 (PerkinElmer, Wellesley, MA), a D1 receptor antagonist,in 250 µl (final volume) of binding buffer for 120 minat 25°C (26). Nonspecific binding was determined in thepresence of 1 µmol/L unlabeled SCH23390.
[35S]GTPS Binding to G-Proteins
For determination of basal D1 receptor G-protein coupling, co-immunoprecipitationof [3H]SCH23390-bound receptors with discrete G proteins wasperformed (27). SKF38393-induced [35S]GTPS (PerkinElmer) bindingto specific G-proteins was performed by immunoprecipitationof G-proteins (28). D1 receptor–G-protein coupling wasalso determined by incubation of membranes with [35S]GTPS followedby stimulation with 1 µmol/L SKF38393 (26). Nonspecific[35S]GTPS binding was determined in the presence of 100 µmol/Lunlabeled GTPS. Specific binding was calculated as the differencebetween total and nonspecific binding.
Na/K-ATPase and NHE3 Assay
Na/K-ATPase activity was determined as reported previously (26).Briefly, SKF38393-induced Na/K-ATPase inhibition was determinedin renal proximal tubular suspensions (1 mg protein/ml) incubatedwith or without 1 mmol/L ouabain at 37°C for 15 min. NHE3activity was determined by measurement of 5-(N-methyl-N-isobutyl)-amiloride–sensitive22Na+ uptake (29).
Immunoblotting
Proteins were solubilized in Laemmli buffer, separated by SDS-PAGE,and transferred to nitrocellulose membrane (16). The membraneswere blocked; incubated with antisera directed against GRK-2,PKC-//, NF-B (SC-208/209/213; Santa Cruz Biotechnology, SantaCruz, CA), D1A, Gs/Gi (371770; Calbiochem, San Diego, CA) in0.1% TBS; and incubated with horseradish peroxidase–conjugatedsecondary antibodies (30). For serine phosphorylation, D1A receptorwas immunoprecipitated as described previously (31).
Adenylyl Cyclase Assay
The adenylyl cyclase assay was performed as described previously(32). The reaction was started by the addition of 50 µgof membrane protein to 1 µCi of [-32P]ATP (approximately2.2 x 106 cpm) with or without SKF38393. The reaction was terminatedby 2% SDS buffer, and [32P]cAMP was separated by Dowex and aluminacolumns.
PKC Activity
PKC activity was determined by a commercially available PKCassay kit (V5330; Promega, Madison, WI) as detailed in our previousstudy (30).
Electrophoretic Mobility Shift Assay
The LightShift Chemiluminescent EMSA Kit (20148; Pierce) wasused to detect biotinylated DNA–NF-B interactions. Electrophoreticmobility shift assay (EMSA) was performed with nuclear extractsusing GAGAGGCAAGGGGATTCCCTTAGTTAGGA as sense sequence for NF-B.Nuclear extracts were incubated with NF-B–specific, biotinylated,double-stranded oligonucleotides in the presence or absenceof 100- to 200-fold excess NF-B–specific, unlabeled, double-strandedoligonucleotides. Samples were separated on 6% DNA retardationgels (Invitrogen, Carlsbad, CA) and transferred to nylon membrane,and DNA was cross-linked to membrane at 254 nm of ultraviolet(UV) light. The bands were analyzed by chemiluminescence followedby densitometry with Kodak imaging station (Kodak, Rochester,NY) (24).
Statistical Analyses
Differences between means were evaluated using the unpairedt test or ANOVA with Newman-Keuls multiple test, as appropriate.P < 0.05 was considered statistically significant.
Animals that were supplemented with BSO, tempol, or both indrinking water had similar body weight and dietary consumptionas rats that were drinking tap water (vehicle) alone (Table 1).There were no significant differences in blood glucose, urinarydopamine excretion, and GFR among the four experimental groups.Compared with vehicle-treated rats, rats that were treated withBSO exhibited an increase in BP (Table 1). Tempol supplementationnormalized the BP in BSO-treated rats, whereas rats that wereprovided with tempol alone had no effect on BP (Table 1).
Oxidative Stress in BSO-Treated Rats Table 1 depicts the oxidative stress in various experimentalgroups. Treatment with BSO caused significant decrease in renalglutathione, a pivotal antioxidant. In addition, BSO-treatedrats showed renal lipid peroxidation and protein oxidation asevidenced by significant increase in tissue malondialdehydeand nitrotyrosine (Table 1). Also, a significant increase inplasma and urinary 8-isoprostane was observed in BSO-treatedrats. Tempol supplementation to BSO-treated rats decreased nitrotyrosine,malondialdehyde, and 8-isoprostane levels and increased thetissue glutathione. No significant differences were observedin oxidative or antioxidative markers between vehicle-treatedrats and rats that were treated with tempol alone.
SKF38393 Failed to Produce Diuresis and Natriuresis in BSO-Treated Rats
Administration of SKF38393 (1 µg/kg per min) caused significantincreases in fractional excretion of sodium, urinary sodiumexcretion rate, and urine flow in vehicle-treated rats but notin BSO-treated rats (Figure 1). Treatment with tempol restoredSKF38393-induced diuresis and natriuresis in BSO-treated rats.Tempol did not change basal urine output or sodium excretion,and SKF38393 produced diuresis and natriuresis in these rats(Figure 1). No changes in BP or heart rate were observed duringSKF38393 infusion (data not shown).
Figure 1. SKF38393, a D1 receptor agonist, mediated natriuresis and diuresis in rats that were treated with vehicle (V; tap water), 30 mM L-buthionine sulfoximine (BSO), 1 mM tempol (T), and BSO+T. (A through C) Fractional excretion of sodium (FENa; A), urinary sodium excretion (UNaV; B), and urine flow (C) before, during, and after drug (SFK38393, 1 µg/kg body wt per min) infusion. C, basal value before drug administration; D, values during drug administration; R, values after drug infusion was terminated. Values of two control (C1 and C2) and two recovery (R1 and R2) collections were averaged and are shown. Data are means ± SEM from six to eight rats. *P < 0.05 versus respective basal using repeated measure (C versus D versus R, for each group) followed by post hoc Newman-Keuls multiple test.
BSO Reduced D1 Receptor [3H]SCH23390 Binding in Renal Proximal Tubular Membranes
As illustrated in Figure 2A, Proximal tubules from BSO-treatedrats showed a significant decrease in specific membrane bindingof [3H]SCH23390, a D1 receptor antagonist. Similar to vehicle,tempol exerted no effect on [3H]SCH23390 membrane binding, whereasin BSO-treated rats, tempol restored the D1 receptor expression.Conversely, Western blot analysis of D1A (Figure 2, B and C)and D1B receptors (data not shown) revealed no significant differencein protein abundance in cell membrane (Figure 2B) or homogenate(Figure 2C) in vehicle- and BSO-treated rats. Similar discrepancieswere observed in lean and obese rats (7). Renal [3H]SCH23390membrane binding was markedly decreased in obese rats, whereasimmunoblotting experiments revealed similar D1R protein contentin cell homogenate as well as membrane and cytosolic fractionsin lean and obese rats (7).
Figure 2. Dopamine D1 receptor expression and G-protein coupling in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. (A) [3H]SCH23390 binding in renal proximal tubular membranes. (B, top) Representative immunoblot for membrane D1A receptor (D1AR) protein. (B, bottom) Density of D1AR protein in arbitrary units. (C, top) Representative Western blot for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein used as loading control. (C, middle) Representative immunoblot for D1AR protein in cell homogenate. (C, bottom) Density of D1AR in arbitrary units. (D) SKF38393 induced [35S]GTPS binding in renal proximal tubular membranes. Membranes were incubated with SFK38393, a D1 receptor agonist, and [35S]GTPS in the presence or absence of SCH23390, a D1 receptor antagonist, followed by immunoprecipitation with Gs or Gi antibodies. Data are means ± SEM from six to eight rats performed in triplicate. *P < 0.05 versus BSO using one-way ANOVA followed by post hoc Newman-Keuls multiple test.
BSO Reduced Basal as Well as SKF38393-Induced D1 Receptor G-Protein Coupling in Renal Proximal Tubular Membranes
Incubation of proximal tubular membranes with SKF38393 followedby immunoprecipitation with Gs antiserum caused a significantincrease in [35S]GTPS binding in vehicle-treated rats but notin BSO-treated rats. SKF38393-induced D1 receptor Gs couplingwas blocked by D1 antagonist SCH23390, and immunoprecipitationwith Gi failed to show the SKF38393-induced increase in [35S]GTPS in vehicle-treated rats (Figure 2D). To assess the basal couplingof D1 receptors to G-proteins, we analyzed direct [3H]SCH23390binding in immunoprecipitates of Gs proteins that were obtainedfrom solubilized membranes of renal proximal tubules. The Gsantiserum–immunoprecipitated [3H]SCH23390 binding sitesin BSO-treated rats were significantly reduced compared withvehicle (Figure 3A), whereas Gi antiserum failed to co-immunoprecipitatesignificant D1 binding sites in vehicle- or BSO-treated rats(Figure 3A). Immunoprecipitates of Gs antisera were also blottedwith specific D1 receptor and Gs antibodies. The D1 receptorprotein that co-immunoprecipitated with Gs was significantlyreduced in BSO-treated rats compared with vehicle-treated rats(Figure 3B). Gs antisera immunoprecipitated a similar amountof Gs protein in both vehicle- and BSO-treated rats (Figure 3C).
Figure 3. Basal and SKF38393, a D1 receptor agonist, induced D1 receptor G-protein coupling in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. (A) Basal D1 receptor G-protein coupling in renal proximal tubular membranes. Membrane D1 receptors and G-proteins were co-immunoprecipitated with Gs or Gi antibodies followed by incubation with [3H]SCH23390 in the presence or absence of unlabeled SCH23390. (B) Membranes were immunoprecipitated (IP) with Gs antibodies and immunoblotted (IB) for D1A receptor (D1AR) protein. (Top) Representative immunoblots for D1AR. (Bottom) Density of D1AR in arbitrary units. (C) Membranes were immunoprecipitated (IP) with Gs antibodies and immunoblotted (IB) for Gs protein. (Top) Representative immunoblots for Gs protein. (Bottom) Density of Gs protein in arbitrary units. (D) SKF38393 induced [35S]GTPS membrane binding in renal proximal tubules. Membranes were incubated with SKF38393 and [35S]GTPS in the presence and absence of unlabeled GTPS. Data are means ± SEM from six to eight rats performed in triplicate. *P < 0.05 versus BSO using one-way ANOVA followed by post hoc Newman-Keuls multiple test.
In vehicle-treated rats, incubation of membranes with SKF38393caused a significant increase in [35S]GTPS membrane bindingbut failed to produce any effect in BSO-treated rats (Figure 3D).Treatment with tempol restored the basal as well as SKF38393-inducedD1 receptor G-protein coupling in BSO-treated rats (Figure 3,A and D). No difference was observed in D1 receptor couplingbetween tempol and vehicle-treated rats. The basal [35S]GTPSbinding was similar in all four experimental groups (Table 2).
Table 2. The basal [35S]GTPS binding, Na/K-ATPase, and NHE3 activities and SKF38393-induced cAMP accumulation in renal proximal tubular membranesa
BSO Reduced SKF38393-Mediated Adenylyl Cyclase Activation in Renal Proximal Tubular Membranes
Incubation of membranes with SKF38393 increased cAMP accumulationin vehicle-treated rats, but SKF38393 failed to cause a similarincrease in cAMP levels in BSO-treated rats (Table 2). Directadenylyl cyclase stimulation with forskolin produced similarcAMP accumulation in vehicle- and BSO-treated rats (Table 2).As observed in [35S]GTPS membrane binding, tempol restored SKF38393-inducedadenylyl cyclase stimulation in BSO-treated rats (Table 2).Tempol did not affect the adenylyl cyclase activity as basalcAMP levels were similar in experimental groups (Table 2).
BSO Reduced SKF38393-Induced Na/K-ATPase Inhibition in Renal Proximal Tubules
The incubation of renal proximal tubular cells from vehicle-treatedanimals with SKF38393 resulted in significant inhibition inNa/K-ATPase activity (Figure 4). Incubation of proximal tubuleswith SFK38393 from BSO-treated rats failed to cause inhibitionin Na/K-ATPase activity (Figure 4). In rats that were treatedwith both tempol and BSO, SKF38393-induced inhibition of Na/K-ATPasewas comparable to that in vehicle-treated rats (Figure 4). Thebasal activities of Na/K-ATPase as well as NHE3 were similarin all experimental groups (Table 2).
Figure 4. SKF38393, a D1 receptor agonist, induced inhibition of Na/K-ATPase activity in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. Data are means ± SEM from six to eight rats performed in triplicate. *P < 0.05, SKF-38393 versus respective control using t test.
BSO Increased D1 Receptor Phosphorylation and GRK-2 Translocation in Renal Proximal Tubular Membranes
The basal serine phosphorylation of D1A receptors was nearlytwo-fold higher in proximal tubular membranes from BSO-treatedrats compared with vehicle-treated rats (Figure 5A). Treatmentwith tempol normalized receptor hyperphosphorylation in BSO-treatedrats. Tempol did not affect the immunoreactivity of D1A protein(Figure 5A).
Figure 5. Dopamine D1 receptor serine phosphorylation and G-protein receptor kinase (GRK-2) translocation in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. (A, top) Representative western blot of D1A receptor serine phosphorylation (phos-ser). (A, middle) Western blot for D1A receptor protein (D1AR) in renal proximal tubular membranes. Membrane proteins were immunoprecipitated (IP) with D1A receptor antibodies and immunoblotted (IB) with phosphoserine antibodies (top) or D1A receptor protein antibodies (middle). (A, bottom) D1A receptor serine phosphorylation normalized with D1A receptor protein. (B through D) Membrane (B), cytosol (C), and whole-cell lysate (D) GRK-2 protein content in renal proximal tubules. (E) GRK-2 protein content in renal proximal tubular membranes. For C and D, top panel is a representative immunoblot for GAPDH protein used as loading control, whereas for B and E, top panel and for C and D, middle panel is a representative Western blot for GRK-2 protein and bars (bottom) represent density of GRK-2 protein in arbitrary units. Data are means ± SEM from six to eight rats performed in triplicate. For A and E, *P < 0.05, BSO versus other groups using one-way ANOVA followed by post hoc Newman-Keuls multiple test; B and C, *P < 0.05 BSO versus V using t test.
Proximal tubular membranes from BSO-treated rats showed a 60%increase in GRK-2 protein levels compared with those in vehicle-treatedrats (Figure 5B), whereas the cytosolic fraction from BSO-treatedrats showed a significant decrease in GRK-2 protein content(Figure 5C), indicating a membranous translocation of GRK-2.The whole-cell lysate from vehicle- and BSO-treated rats showedsimilar GRK-2 expression (Figure 5D). Supplementation of tempolto BSO-treated rats abolished the GRK-2 translocation (Figure 5E).Tempol treatment did not change the GRK-2 protein levels (Figure 5E).
BSO Increased the PKC Activity and Expression in Renal Proximal Tubules
As shown in Figure 6A, the basal PKC activity was higher inproximal tubular homogenates from BSO-treated rats comparedwith vehicle-treated rats. Tempol supplementation to BSO-treatedrats normalized the PKC activity (Figure 6A). There was no differencein PKC activity in rats that were treated with vehicle or tempolalone (Figure 6A).
Figure 6. Protein kinase C (PKC) activity and expression in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. (A) PKC activity in proximal tubular homogenate. (B, top) Representative immunoblot for GAPDH protein used as loading control. (B, middle) Representative Western blot for PKC- protein in proximal tubular homogenate. (B, bottom) Density of PKC- protein in arbitrary units. Data are means ± SEM from six to eight rats performed in triplicate. *P < 0.05 BSO versus other groups using one-way ANOVA followed by post hoc Newman-Keuls multiple test.
We also analyzed several PKC isoforms, including , 1, , , and. In BSO-treated rats, immunoblotting analysis of these proteinsrevealed a significant increase in PKC- expression (Figure 6B),whereas other isoforms showed NS increases (PKC-1 and ) or nochange (PKC- and ) in protein levels (data not shown).
BSO Increased the NF-B Nuclear Translocation in Renal Proximal Tubules
Western blot analysis of proximal tubules from BSO-treated ratsshowed nuclear translocation of NF-B (p65 subunit) as evidencedby increased immunoreactivity of p65 in nucleus (Figure 7A)with a comparable decrease in cytosolic fraction (Figure 7B).EMSA analysis also revealed that biotin-labeled oligonucleotideprobes that comprised an NF-B–specific site formed increasedcomplex with nuclear fraction from BSO-treated rats comparedwith vehicle-treated rats (Figure 7, C and D, lanes 1 through4). The protein–DNA complexes were specific because theywere competed away by unlabeled probes (Figure 7, C, lanes 5through 7). Under similar conditions, no protein–-DNAcomplexes were detected with probes that contained mutationsat NF-B sites (data not shown). Tempol supplementation preventedthe NF-B translocation in BSO-treated rats (Figure 7). Tempoldid not affect the protein abundance of NF-B (p65), becauserats that were treated with tempol or vehicle showed similarNF-B (p65) sequestration (Figure 7, A and B).
Figure 7. NF-B translocation in renal proximal tubules from rats that were treated with V, 30 mM BSO, 1 mM T, and BSO+T. (A, top) Nuclear fraction is a representative immunoblot for histone protein used as loading control. (A, middle) Western blot representing nuclear translocation of NF-B p65 subunit. (A, bottom) Density of NF-B p65 subunit in arbitrary units. (B, top) Cytosolic fraction is a representative immunoblot for GAPDH protein used as loading control. (B, middle) Representative immunoblot of NF-B p65 subunit in cytosolic fraction. (B, bottom) Density of NF-B p65 subunit in arbitrary units. (C) Electrophoretic mobility shift assay (EMSA) for NF-B with biotinylated DNA probes. (top) Representative blot for NF-B–DNA complex; lanes 1 through 4, nuclear extract incubated with NF-B–specific, biotinylated, double-stranded oligonucleotides; lane 5 through 8, nuclear extract incubated with NF-B–specific, biotinylated, double-stranded oligonucleotides in the presence of 100-fold excess of NF-B–specific, unlabeled, double-stranded oligonucleotides. Bars represent density arbitrary units of respective bands. (D) Representative blot for EMSA showing DNA retardation. Lane 1, V; lane 2, BSO; lane 3, T; lane 4, BSO+T. Specific NF-B, biotinylated, double-stranded oligonucleotide complex is shown by arrow 1; and unbound, biotinylated, double-stranded oligonucleotides are shown by arrow 2. Data are means ± SEM from six to eight rats performed in triplicate. *P < 0.05, BSO versus other groups using one-way ANOVA followed by post hoc Newman-Keuls multiple test.
The results of our study show that treatment of Sprague-Dawleyrats with BSO increased oxidative stress and produced an increasein BP, which was accompanied by increased D1 receptor phosphorylation,reduced D1 receptor expression, and coupling to G-proteins inrenal proximal tubules. SKF38393, a D1 receptor agonist, failedto stimulate G-proteins and activate adenylyl cyclase in tubularmembranes from BSO-treated rats. Also, SKF38393 was unable toinhibit Na/K-ATPase activity and failed to produce diuresisor natriuresis in these rats. Furthermore, BSO treatment causedNF-B nuclear translocation, increased PKC protein expressionand activity, and GRK-2 membranous translocation (Figure 8).Supplementation with SOD mimetic compound tempol to BSO-treatedrats reduced oxidative stress; normalized BP; and restored renalD1 receptor expression, signaling, and functional response toSKF38393. In addition, tempol abolished NF-B nuclear translocation,decreased PKC activity, and normalized GRK-2 sequestration andD1 receptor serine phosphorylation. These data suggest thatelevated oxidative stress impairs renal D1 receptor functionvia a mechanism that involves nuclear translocation of NF-B,PKC activation, and GRK-2 translocation, which contributes tohigh BP in these rats.
Oxidative stress can be increased in hypertension by increasedproduction of ROS, including the superoxide anion (O2.–),the hydroxyl radical, or hydrogen peroxide (H2O2), or by a decreasein antioxidant enzymes such as SOD (11). In this study, treatmentof Sprague-Dawley rats with BSO reduced glutathione content,a pivotal endogenous antioxidant, and increased oxidative stressas evidenced by nitrotyrosinylation of proteins and lipid peroxidation.The imbalance in redox status was accompanied by an increasein BP. Treatment of these rats with tempol reduced oxidativestress and normalized BP, indicating the role of oxidative stressin the pathogenesis of hypertension. These findings are in agreementwith Vaziri et al. (33), who showed that BSO can cause proteinnitrotyrosinylation and increase BP and that antioxidant supplementationdecreases oxidative stress and normalizes BP in these animals.Recent studies also suggested that patients with essential hypertensionhave decreased antioxidant capability and produce excessiveamounts of ROS (11,34–37). The activity of SOD and vitaminE levels in erythrocytes are decreased in patients with essentialhypertension, and O2.– and H2O2 produced by leukocytesand plasma levels of lipid peroxides are increased in patientswith uncontrolled hypertension (11,37,38).
Studies in animal models of hypertension have shown that anincrease in oxidative stress is accompanied by reduced renalD1 receptor signaling and that treatment of these animals withantioxidants normalized BP and restored D1 receptor function(7,13,14). Therefore, it is possible that the defect in D1 receptormay serve as a link between hypertension and oxidative stress.This is supported by our finding that treatment of normotensiveSprague-Dawley rats with BSO increased oxidative stress andreduced D1 receptor function and that these rats exhibited anincrease in BP. There is substantial evidence for the involvementof D1 receptor dysfunction in the pathogenesis of hypertensionin animal models as well as in some cases of human hypertension(1,2,4–6). In spontaneously hypertensive rats and Dahlsalt-sensitive rats, the natriuretic effect of dopamine andD1 receptor agonists is impaired (4–6,8–10,31).Some studies have shown that the inhibitory effect of fenoldopamon renal sodium transporters in proximal tubules is impairedin patients with hypertension (4–6). We and others havereported that infusion of D1 receptor agonists in obese Zuckerrats, a type 2 diabetic model that exhibits oxidative stressand mild hypertension, fails to increase sodium excretion (7,39,40).Supplementation of these rats with insulin sensitizers or antioxidantsdecreased oxidative stress, restored D1 receptor function, andnormalized BP (7,40). Herein, we also observed that antioxidanttempol decreased oxidative stress, restored D1 receptor function,and normalized BP. Taken together, these findings suggest thatthe D1 receptor defect may serve as a contributing factor tooxidative stress–associated hypertension. Nevertheless,oxidative stress may also contribute to generation and maintenanceof hypertension via the inactivation of endothelium-derivedrelaxing factor such as nitric oxide, the nonenzymatic generationof vasoconstrictive isoprostanes from arachidonic acid, anddirect vasopressor action (12,41–44). Antioxidant administrationimproves nitric oxide metabolism and ameliorates hypertensionin rats with lead-induced hypertension or spontaneous hypertension(12,41).
The inability of renal dopamine to regulate sodium excretionin hypertension may arise from decreased renal dopamine productionor failure of dopamine to inhibit sodium transporters (4–6).In this study, treatment of rats with BSO had no effect on renaldopamine production, because an equal amount of dopamine wasexcreted by both vehicle- and BSO-treated rats. The abnormalsodium transporters are also an unlikely explanation for failureof D1 receptor stimulation to increase sodium excretion. Bothluminal NHE3 and basolateral Na/K-ATPase activities were similarin all experimental groups. Conversely, SKF38393 failed to inhibitNa/K-ATPase activity in proximal tubules from BSO-treated ratscompared with vehicle. Treatment of these rats with tempol restoredthe SKF38393-induced Na/K-ATPase inhibition as well as sodiumexcretion. Therefore, inability of dopamine to inhibit the Na/K-ATPasemay have led to a decrease in sodium excretion and subsequenthypertension in BSO-treated rats. Similar observations weremade in obese rats, in which oxidative stress–mediatedD1 receptor dysfunction was accompanied by increased BP, andrestoration of D1 receptor function with antioxidants reducedoxidative stress and normalized BP (7).
Radioligand binding with D1 receptor antagonist [3H]SCH23390revealed a significant decrease in D1 receptor expression inproximal tubules from BSO-treated rats. The decrease in ligandbinding was accompanied by uncoupling from cognate G-proteinsas activation of D1 receptor failed to stimulate G-proteins.Furthermore, incubation of proximal tubules from BSO-treatedrats with SKF38393 failed to increase cAMP accumulation or inhibitNa/K-ATPase, suggesting a defect in D1 receptor–mediatedG-protein–coupled signal transduction pathway. Treatmentof BSO rats with tempol restored the D1 receptor expressionand coupling to G-proteins/effector complex and supports theview that oxidative stress can impair renal D1 receptor signalingand that antioxidants can protect and preserve D1 receptor function.
One of the mechanisms by which D1 receptors are uncoupled fromG-proteins is through the covalent modifications of the receptoras a consequence of phosphorylation by GRK (17,19). Our previousstudies in animal models of diabetes and aging associated withoxidative stress suggested that GRK-2 upregulation leads toD1 receptor serine hyperphosphorylation, resulting in receptordesensitization (7,15). We found that BSO treatment caused GRK-2membranous translocation and increased D1 receptor phosphorylation,whereas tempol supplementation decreased GRK-2 membrane abundanceand normalized D1 receptor phosphorylation, indicating thatGRK-2–mediated D1 receptor phosphorylation could be responsiblefor D1 receptor G-protein uncoupling. The increased receptorphosphorylation may also explain the basal D1 receptor G-proteinuncoupling that was observed in BSO-treated rats. It is of interestthat GRK activity and GRK-2 protein abundance are increasedin patients with essential hypertension, and GRK-2 has beenshown to desensitize D1 receptors in human renal proximal tubules(45–47).
The observation that in BSO-treated animals the increased PKCactivity was associated with GRK-2 upregulation and tempol whereasreducing PKC activity also normalized GRK-2 translocation indicatesa signal transduction cross-talk. In this regard, there arereports to suggest that GRK-2 can be phosphorylated by PKC,which leads to its membrane translocation and increased activity(48,49). In a previous study, we found that exposure of renalproximal tubular cells to H2O2, an oxidant, caused PKC-dependentGRK-2 membrane translocation and subsequent D1 receptor hyperphosphorylation(20). The D1 receptor hyperphosphorylation and desensitizationwere specific to GRK-2, because GRK-2 antisense oligonucleotidesabolished both receptor phosphorylation and desensitization(20). Taken together, this study suggests that during oxidativestress, the increased PKC activity leads GRK-2 membrane translocationand subsequent D1 receptor phosphorylation, resulting in D1receptor desensitization, including its uncoupling from G-proteins.
Evidence to date indicates that oxidative stress increases PKCactivity (50); however, the exact mechanism remains to be determined.It has been postulated that NF-B regulates the activities ofmany intracellular signaling molecules, thereby playing a criticalrole in determining cellular responses to extracellular stimuli,especially oxidative stress (21–23). One such cross-talkis the activation of PKC activity and expression by NF-B (24).In this study, the treatment of rats with BSO increased nucleartranslocation of NF-B (p65 subunits), which was accompaniedby increased PKC- expression. Also, tempol while abolishingNF-B translocation normalized PKC- expression and activity.Therefore, it is possible that oxidative stress activated NF-B,which caused increased PKC expression, thereby increasing itsactivity. Our findings are supported by reports that in murineembryonic fibroblasts, NF-B positively regulates UV-inducedc-Jun N-terminal kinase activation via induction of PKC- activation(24). In these cells NF-B (Rel A) was shown to bind PKC- promotersite and increase its transcription activity (24). In addition,UV light failed to activate NF-B–c-Jun N-terminal kinasesignaling in PKC- null cells (24). Conversely, it is also possiblethat decreased D1R signaling may have contributed to increasedPKC- expression in BSO-treated rats.
We have shown that oxidative stress reduces renal D1 receptorfunction and increases BP in Sprague-Dawley rats. The failureof D1 receptor activation to stimulate G-proteins results inthe inability of D1 receptor agonist to inhibit Na/K-ATPaseand increase sodium excretion. In addition, our results suggesta novel level of signal cross-talk by showing that oxidativestress–mediated NF-B translocation may increase the PKC-expression and activity. PKC in turn increased GRK-2 translocation,causing D1 receptor phosphorylation and desensitization. Supplementationwith antioxidant tempol reduced oxidative stress and normalizedintracellular signaling and D1 receptor phosphorylation. Collectively,these phenomena restored D1 receptor function and normalizedBP, providing strong support for the role of defective D1 receptorfunction in oxidative stress–mediated hypertension.
Zeng C, Felder RA, Jose PA: A new approach for treatment of hypertension: Modifying D1 dopamine receptor function.
Cardiovasc Hematol Agents Med Chem 4
: 369
–377, 2006[Medline]
Missale C, Nash SR, Robinson SW, Jaber M, Caron MG: Dopamine receptors: From structure to function.
Physiol Rev 78
: 189
–225, 1998[Abstract/Free Full Text]
Aperia AC: Intrarenal dopamine: A key signal in the interactive regulation of sodium metabolism.
Annu Rev Physiol 62
: 621
–647, 2000[CrossRef][Medline]
Zeng C, Eisner GM, Felder RA, Jose PA: Dopamine receptor and hypertension.
Curr Med Chem Cardiovasc Hematol Agents 3
: 69
–77, 2005[CrossRef][Medline]
Bek MJ, Eisner GM, Felder RA, Jose PA: Dopamine receptors in hypertension.
Mt Sinai J Med 68
: 362
–369, 2001[Medline]
Jose PA, Eisner GM, Felder RA: Renal dopamine receptors in health and hypertension.
Pharmacol Ther 80
: 149
–182, 1998[CrossRef][Medline]
Banday AA, Marwaha A, Tallam LS, Lokhandwala MF: Tempol reduces oxidative stress, improves insulin sensitivity, decreases renal dopamine D1 receptor hyperphosphorylation, and restores D1 receptor-G-protein coupling and function in obese Zucker rats.
Diabetes 54
: 2219
–2226, 2005[Abstract/Free Full Text]
Nishi A, Eklof AC, Bertorello AM, Aperia A: Dopamine regulation of renal Na+, K(+)-ATPase activity is lacking in Dahl salt-sensitive rats.
Hypertension 21
: 767
–771, 1993[Abstract/Free Full Text]
Ohbu K, Kaskel FJ, Kinoshita S, Felder RA: Dopamine-1 receptors in the proximal convoluted tubule of Dahl rats: Defective coupling to adenylate cyclase.
Am J Physiol 268
: R231
–R235, 1995[Medline]
Sela S, White BH, Uh M, Kimura K, Patel S, Sidhu A: Dysfunctional D1A receptor-G-protein coupling in proximal tubules of spontaneously hypertensive rats is not due to abnormal G-proteins.
J Hypertens 15
: 259
–267, 1997[CrossRef][Medline]
Manning RD Jr, Meng S, Tian N: Renal and vascular oxidative stress and salt-sensitivity of arterial pressure.
Acta Physiol Scand 179
: 243
–250, 2003[CrossRef][Medline]
Welch WJ, Mendonca M, Blau J, Karber A, Dennehy K, Patel K, Lao YS, Jose PA, Wilcox CS: Antihypertensive response to prolonged tempol in the spontaneously hypertensive rat.
Kidney Int 68
: 179
–187, 2005[CrossRef][Medline]
White BH, Sidhu A: Increased oxidative stress in renal proximal tubules of the spontaneously hypertensive rat: A mechanism for defective dopamine D1A receptor/G-protein coupling.
J Hypertens 16
: 1659
–1665, 1998[CrossRef][Medline]
Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, Wang X, Quinn MT, Sibley DR, Romero GG, Felder RA, Jose PA: D5 dopamine receptor regulation of reactive oxygen species production, NADPH oxidase, and blood pressure.
Am J Physiol Regul Integr Comp Physiol 290
: R96
–R104, 2006[Abstract/Free Full Text]
Fardoun RZ, Asghar M, Lokhandwala M: Role of oxidative stress in defective renal dopamine D1 receptor-G protein coupling and function in old Fischer 344 rats.
Am J Physiol Renal Physiol 291
: F945
–F951, 2006[Abstract/Free Full Text]
Marwaha A, Banday AA, Lokhandwala MF: Reduced renal dopamine D1 receptor function in streptozotocin-induced diabetic rats.
Am J Physiol Renal Physiol 286
: F451
–F457, 2004[Abstract/Free Full Text]
Ferguson SS: Evolving concepts in G protein-coupled receptor endocytosis: The role in receptor desensitization and signaling.
Pharmacol Rev 53
: 1
–24, 2001[Abstract/Free Full Text]
Diviani D, Lattion AL, Cotecchia S: Characterization of the phosphorylation sites involved in G protein-coupled receptor kinase- and protein kinase C-mediated desensitization of the alpha1B-adrenergic receptor.
J Biol Chem 272
: 28712
–28719, 1997[Abstract/Free Full Text]
Reiter E, Lefkowitz RJ: GRKs and beta-arrestins: Roles in receptor silencing, trafficking and signaling.
Trends Endocrinol Metab 17
: 159
–165, 2006[CrossRef][Medline]
Asghar M, Banday AA, Fardoun RZ, Lokhandwala MF: Hydrogen peroxide causes uncoupling of dopamine D1-like receptors from G proteins via a mechanism involving protein kinase C and G-protein-coupled receptor kinase 2.
Free Radic Biol Med 40
: 13
–20, 2006[CrossRef][Medline]
Karin M, Lin A: NF-kappaB at the crossroads of life and death.
Nat Immunol 3
: 221
–227, 2002[CrossRef][Medline]
Baldwin AS Jr: The NF-kappa B and I kappa B proteins: New discoveries and insights.
Annu Rev Immunol 14
: 649
–683, 1996[CrossRef][Medline]
Surh YJ, Kundu JK, Na HK, Lee JS: Redox-sensitive transcription factors as prime targets for chemoprevention with anti-inflammatory and antioxidative phytochemicals.
J Nutr 135
: 2993S
–3001S, 2005[Abstract/Free Full Text]
Liu J, Yang D, Minemoto Y, Leitges M, Rosner MR, Lin A: NF-kappaB is required for UV-induced JNK activation via induction of PKCdelta.
Mol Cell 21
: 467
–480, 2006[CrossRef][Medline]
Mihara M, Uchiyama M: Determination of malonaldehyde precursor in tissues by thiobarbituric acid test.
Anal Biochem 86
: 271
–278, 1978[CrossRef][Medline]
Kansra V, Hussain T, Lokhandwala MF: Alterations in dopamine DA1 receptor and G proteins in renal proximal tubules of old rats.
Am J Physiol 273
: F53
–F59, 1997[Medline]
Wang HY, Undie AS, Friedman E: Evidence for the coupling of Gq protein to D1-like dopamine sites in rat striatum: Possible role in dopamine-mediated inositol phosphate formation.
Mol Pharmacol 48
: 988
–994, 1995[Abstract]
Friedman E, Butkerait P, Wang HY: Analysis of receptor-stimulated and basal guanine nucleotide binding to membrane G proteins by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Anal Biochem 214
: 171
–178, 1993[CrossRef][Medline]
Albrecht FE, Xu J, Moe OW, Hopfer U, Simonds WF, Orlowski J, Jose PA: Regulation of NHE3 activity by G protein subunits in renal brush-border membranes.
Am J Physiol Regul Integr Comp Physiol 278
: R1064
–R1073, 2000[Abstract/Free Full Text]
Asghar M, Hussain T, Lokhandwala MF: Overexpression of PKC-betaI and -delta contributes to higher PKC activity in the proximal tubules of old Fischer 344 rats.
Am J Physiol Renal Physiol 285
: F1100
–F1107, 2003[Abstract/Free Full Text]
Sanada H, Jose PA, Hazen-Martin D, Yu PY, Xu J, Bruns DE, Phipps J, Carey RM, Felder RA: Dopamine-1 receptor coupling defect in renal proximal tubule cells in hypertension.
Hypertension 33
: 1036
–1042, 1999[Abstract/Free Full Text]
Salomon Y, Londos C, Rodbell M: A highly sensitive adenylate cyclase assay.
Anal Biochem 58
: 541
–548, 1974[CrossRef][Medline]
Vaziri ND, Wang XQ, Oveisi F, Rad B: Induction of oxidative stress by glutathione depletion causes severe hypertension in normal rats.
Hypertension 36
: 142
–146, 2000[Abstract/Free Full Text]
Buczynski A, Wachowicz B, Kedziora-Kornatowska K, Tkaczewski W, Kedziora J: Changes in antioxidant enzymes activities, aggregability and malonyldialdehyde concentration in blood platelets from patients with coronary heart disease.
Atherosclerosis 100
: 223
–228, 1993[CrossRef][Medline]
Lacy F, O'Connor DT, Schmid-Schonbein GW: Plasma hydrogen peroxide production in hypertensives and normotensive subjects at genetic risk of hypertension.
J Hypertens 16
: 291
–303, 1998[CrossRef][Medline]
Prabha PS, Das UN, Koratkar R, Sagar PS, Ramesh G: Free radical generation, lipid peroxidation and essential fatty acids in uncontrolled essential hypertension.
Prostaglandins Leukot Essent Fatty Acids 41
: 27
–33, 1990[CrossRef][Medline]
Russo C, Olivieri O, Girelli D, Faccini G, Zenari ML, Lombardi S, Corrocher R: Anti-oxidant status and lipid peroxidation in patients with essential hypertension.
J Hypertens 16
: 1267
–1271, 1998[CrossRef][Medline]
Kumar KV, Das UN: Are free radicals involved in the pathobiology of human essential hypertension?
Free Radic Res Commun 19
: 59
–66, 1993[Medline]
Tsuchida H, Imai G, Shima Y, Satoh T, Owada S: Mechanism of sodium load-induced hypertension in non-insulin dependent diabetes mellitus model rats: Defective dopaminergic system to inhibit Na-K-ATPase activity in renal epithelial cells.
Hypertens Res 24
: 127
–135, 2001[CrossRef][Medline]
Umrani DN, Banday AA, Hussain T, Lokhandwala MF: Rosiglitazone treatment restores renal dopamine receptor function in obese Zucker rats.
Hypertension 40
: 880
–885, 2002[Abstract/Free Full Text]
Vaziri ND, Ding Y, Ni Z, Gonick HC: Altered nitric oxide metabolism and increased oxygen free radical activity in lead-induced hypertension: Effect of lazaroid therapy.
Kidney Int 52
: 1042
–1046, 1997[Medline]
Takahashi K, Nammour TM, Fukunaga M, Ebert J, Morrow JD, Roberts LJ 2nd, Hoover RL, Badr KF: Glomerular actions of a free radical-generated novel prostaglandin, 8-epi-prostaglandin F2 alpha, in the rat. Evidence for interaction with thromboxane A2 receptors.
J Clin Invest 90
: 136
–141, 1992[Medline]
Tesfamariam B, Cohen RA: Role of superoxide anion and endothelium in vasoconstrictor action of prostaglandin endoperoxide.
Am J Physiol 262
: H1915
–H1919, 1992[Medline]
Atzori L, Olafsdottir K, Corriga AM, Bannenberg G, Ryrfeldt A, Moldeus P: Thiol modification in H2O2- and thromboxane-induced vaso- and bronchoconstriction in rat perfused lung.
J Appl Physiol 71
: 1309
–1314, 1991[Abstract/Free Full Text]
Gros R, Benovic JL, Tan CM, Feldman RD: G-protein-coupled receptor kinase activity is increased in hypertension.
J Clin Invest 99
: 2087
–2093, 1997[Medline]
Gros R, Chorazyczewski J, Meek MD, Benovic JL, Ferguson SS, Feldman RD: G-Protein-coupled receptor kinase activity in hypertension: Increased vascular and lymphocyte G-protein receptor kinase-2 protein expression.
Hypertension 35
: 38
–42, 2000[Abstract/Free Full Text]
Watanabe H, Xu J, Bengra C, Jose PA, Felder RA: Desensitization of human renal D1 dopamine receptors by G protein-coupled receptor kinase 4.
Kidney Int 62
: 790
–798, 2002[CrossRef][Medline]
Chuang TT, LeVine H 3rd, De Blasi A: Phosphorylation and activation of beta-adrenergic receptor kinase by protein kinase C.
J Biol Chem 270
: 18660
–18665, 1995[Abstract/Free Full Text]
Winstel R, Freund S, Krasel C, Hoppe E, Lohse MJ: Protein kinase cross-talk: Membrane targeting of the beta-adrenergic receptor kinase by protein kinase C.
Proc Natl Acad Sci U S A 93
: 2105
–2109, 1996[Abstract/Free Full Text]
Konishi H, Yamauchi E, Taniguchi H, Yamamoto T, Matsuzaki H, Takemura Y, Ohmae K, Kikkawa U, Nishizuka Y: Phosphorylation sites of protein kinase C delta in H2O2-treated cells and its activation by tyrosine kinase in vitro.
Proc Natl Acad Sci U S A 98
: 6587
–6592, 2001[Abstract/Free Full Text]
This article has been cited by other articles:
C. S. Wilcox and A. Pearlman Chemistry and Antihypertensive Effects of Tempol and Other Nitroxides
Pharmacol. Rev.,
December 1, 2008;
60(4):
418 - 469.
[Abstract][Full Text][PDF]
A. A. Banday and M. F. Lokhandwala Loss of Biphasic Effect on Na/K-ATPase Activity by Angiotensin II Involves Defective Angiotensin Type 1 Receptor-Nitric Oxide Signaling
Hypertension,
December 1, 2008;
52(6):
1099 - 1105.
[Abstract][Full Text][PDF]
A. A. Banday and M. F. Lokhandwala Oxidative stress-induced renal angiotensin AT1 receptor upregulation causes increased stimulation of sodium transporters and hypertension
Am J Physiol Renal Physiol,
September 1, 2008;
295(3):
F698 - F706.
[Abstract][Full Text][PDF]
B and Protein Kinase C
Top
Abstract
Introduction
B nuclear translocation, protein kinase C (PKC) activity and expression, G-protein–coupled receptor kinase-2 (GRK-2) membranous translocation, and D1 receptor serine phosphorylation. In BSO-treated rats’ supplementation of tempol decreased oxidative stress, normalized BP, and restored D1 receptor G-protein coupling and natriuretic response to SKF38393. Tempol also normalized NF-
-glutamylcysteine synthetase inhibitor, and tempol, a superoxide dismutase (SOD) mimetic compound, were provided in drinking water for 2 wk. All experiments were performed according to University of Houston guidelines and protocols for care and use of laboratory animals. 
proteins was performed (27). SKF38393-induced [35S]GTP
/
, NF-
, and 
. In BSO-treated rats, immunoblotting analysis of these proteins revealed a significant increase in PKC-
