Recruitment of Podocytes from Glomerular Parietal Epithelial Cells
Daniel Appel*,
David B. Kershaw,
Bart Smeets*,,
Gang Yuan*,
Astrid Fuss*,
Björn Frye*,
Marlies Elger,
Wilhelm Kriz,
Jürgen Floege* and
Marcus J. Moeller*
* Division of Nephrology and Immunology, Rheinisch Westfälische Technische Hochschule (RWTH) University of Aachen, Aachen, Germany; Division of Nephrology, Department of Pediatrics, University of Michigan, Ann Arbor, Michigan; Department of Pathology, Radboud University Nijmegen Medical Center, Nijmegen, Netherlands; and Institute for Anatomy and Cell Biology, University of Heidelberg/Mannheim, Mannheim, Germany
Correspondence: Dr. Marcus J. Moeller, Department of Nephrology and Clinical Immunology, RWTH University Hospital Aachen, Pauwelsstrasse 30, 52074 Aachen, Germany. Phone: ++49-241-8089530; Fax: ++49-241-8082446; E-mail: mmoeller{at}ukaachen.de
Received for publication July 29, 2008.
Accepted for publication October 5, 2008.
Loss of a critical number of podocytes from the glomerular tuftleads to glomerulosclerosis. Even in health, some podocytesare lost into the urine. Because podocytes themselves cannotregenerate, we postulated that glomerular parietal epithelialcells (PECs), which proliferate throughout life and adjoin podocytes,may migrate to the glomerular tuft and differentiate into podocytes.Here, we describe transitional cells at the glomerular vascularstalk that exhibit features of both PECs and podocytes. Metaboliclabeling in juvenile rats suggested that PECs migrate to becomepodocytes. To prove this, we generated triple-transgenic micethat allowed specific and irreversible labeling of PECs uponadministration of doxycycline. PECs were followed in juvenilemice beginning from either postnatal day 5 or after nephrogenesishad ceased at postnatal day 10. In both cases, the number ofgenetically labeled cells increased over time. All geneticallylabeled cells coexpressed podocyte marker proteins. In conclusion,we demonstrate for the first time recruitment of podocytes fromPECs in juvenile mice. Unraveling the mechanisms of PEC recruitmentonto the glomerular tuft may lead to novel therapeutic approachesto renal injury.
Chronic kidney disease, resulting in renal failure and the needfor lifelong renal replacement therapy, has become a significantproblem worldwide. In the United States, approximately 7% ofthe total Medicare budget is spent on the treatment of ESRD,and projections suggest that the amount spent will increaseby another 50% by 2020.1
Most renal pathologies that ultimately lead to ESRD originatewithin the glomerulus. It has now been established that a depletionof podocytes, the visceral epithelium of the capillary convolute(Figure 1), is central in this process. As soon as damage tothe glomerular podocytes exceeds a certain threshold (approximately30%), glomerulosclerosis ensues.2 Indeed, in patients with asurgical reduction of 75% of renal mass, a relative lack ofpodocytes (podocytopenia) and subsequent FSGS in the originallyhealthy remnant kidney can lead to renal failure.3 Glomerulosclerosisis also the common final pathway of all glomerular diseasesleading to ESRD.4 In glomerular diseases such as diabetic nephropathy,glomerulonephritides, or preeclampsia, significant numbers ofpodocytes are lost as a result of apoptosis, necrosis or excretionof living cells into the urine. Even in normal individuals,low numbers of living podocytes are continuously shed into theurine.5–7 These numbers are too high to be compatiblewith renal survival for 80 yr, suggesting the existence of aregenerative mechanism. Also, the reversal of early glomerulardamage in animal models and humans8–10 argues for theexistence of such a mechanism; however, podocytes are postmitoticcells that cannot undergo complete cell divisions and are thereforeunable to regenerate themselves.8–10 A potential mechanismfor podocyte replacement from bone marrow–derived stemcells has been described in the Alport mouse model as well asin kidney transplants.11–13 Nevertheless, most studiesconcluded that regeneration occurs predominantly from an as-yet-unknownsource of resident renal cells.12,14–16
Figure 1. Renal glomerulus. The glomerular epithelium consists of PECs (red) and podocytes (Pod; blue), which reside on the capillary convolute. Both epithelia adjoin directly at the vascular pole (VP; arrow). At the tubular pole (TP), the parietal epithelium is connected to the epithelium of the proximal tubule. In male mice, this transition from PECs to proximal tubular cells often occurs within the glomerulus. The glomerular basement membrane (black) forms a continuous barrier between the glomerular epithelium and the endocapillary compartment that contains mesangial cells (shaded) and endothelial cells of the glomerular capillaries (*). Primary urine is filtered across the three-layered filtration barrier (endothelial cells, glomerular basement membrane, and Pod) into Bowman's space (BS).
In this study, we tested the hypothesis that glomerular parietalepithelial cells (PECs) lining the inner aspect of Bowman'scapsule migrate onto the glomerular tuft and differentiate intopodocytes. Several arguments support this hypothesis. PECs arepresent in all species whose kidneys contain glomeruli. Theyare located within the same compartment and are in direct continuitywith podocytes at the glomerular vascular stalk, so PECs donot have to cross an anatomic barrier such as the glomerularbasement membrane, as was suggested for bone marrow–derivedstem cells.11–13 PECs proliferate lifelong at a relativelylow frequency,17 express several stem cell marker proteins,and could be transdifferentiated in vitro into other cell typessuch as adipocytes or neuronal cells, suggesting that thesecells retain multipotency.9,18,19 In rodents, PECs do not expressany known specific marker protein, which has so far precludeda detailed analysis of the function of these cells.
In this work, we provide the first evidence that PECs possessthe capability to migrate onto the glomerular tuft via the vascularstalk, where they differentiate into podocytes. This establishesthat PECs represent an intrinsic cell population from whichpodocytes can be recruited.
Transitional Cells at the PEC/Podocyte Interface
To test our hypothesis that PECs migrate onto the glomerulartuft, we analyzed the vascular stalk of healthy Sprague-Dawleyrats by transmission electron microscopy. At this site, cellswith features of PECs as well as podocytes could be observed(Figure 2). The phenotype of such transitional cells variedfrom cells with a flat and condensed oval nucleus and a flatcytoplasm (Figure 2, A' and D [1]) toward cells with an uprightcell body sitting on the basement membrane without foot processesand a large lobulated nucleus (Figure 2, B and D [2]). The lastfeature was the formation of foot processes. Within a singlecell, cellular processes with and without foot processes—includinga slit diaphragm—could be observed simultaneously (Figure 2C).The transition from a multilayered electron-lucent parietalbasement membrane to a glomerular homogeneous electron-densebasement membrane was abrupt and was always associated withtransitional cells (Figure 2, C and D, arrowhead).
Figure 2. Transitional cells at the rat parietal cell–Pod interface. (A) At the VP, epithelial cells with features of parietal cells and Pod can be regularly observed. (A') Early transitional stage (characteristics: glomerular basement membrane, cytoplasmic vesicles; higher magnification of box in A); e.a., efferent arteriole. (B) Late transitional stage (characteristics: upright cell body, large lobulated nucleus); cap., capillary lumen. (C) Partial formation of foot processes within a "late" transitional cell (*) at the vascular stalk. The intercellular junction between the last parietal cell (PEC) and the transitional cell is marked by a filled arrowhead. The transition from a parietal cell basement membrane to a glomerular basement membrane also occurs at this site. The transitional cell projects extensions onto the base of Bowman's capsule as well as onto a capillary (cap.) without forming foot processes (open arrowheads). A third projection extends onto the vascular stalk and forms typical foot processes with a slit diaphragm (arrow). (D) Grazing section along the vascular stalk. Sequential stages of transitional cells at the parietal/Pod interface (1, early stage; 2, later stage). The intercellular junction toward the last PEC (*) is marked by arrowheads, the transition from a parietal to a glomerular basement membrane is marked by open arrows (A through C, transmission electron micrographs of adult Sprague-Dawley rats).
To verify whether transitional cells bear an intermediate phenotypebetween PECs and podocytes, we determined the expression ofmarker proteins by triple immunofluorescent labeling and confocalmicroscopy (Figure 3). Frozen sections of 10-day-old mice werestained with an antibody specific for claudin-1, a marker forPECs within the renal cortex that localizes to intercellularlight junctions.20 Apart from the Bowman's capsule, claudin-1–positivecells were regularly present along the vascular stalk at thebase of the glomerular tuft, where transitional cells were observed(see previous paragraph; Figure 3, arrows). In a co-stainingexperiment for the podocyte marker proteins nestin, dipeptidylpeptidase IV, and aminopeptidase A,21–24 the cells atthe vascular stalk coexpressed PEC markers as well as the podocytemarker proteins.
Figure 3. Transitional cells coexpress PEC and Pod marker proteins. (A through C) Normal mouse frozen kidney sections from 10-d-old mice were co-stained with an antiserum specific for claudin-1 (PECs, red) and the Pod markers (green) nestin (A), dipeptidyl peptidase 4 (DPPIV; B), and aminopeptidase A (APA; C). At the VP, claudin-1–positive cells could regularly be observed. These cells at the vascular stalk coexpressed Pod marker proteins (arrows, nuclei are stained blue; immunofluorescent labelings of 2-µm sections analyzed by confocal microscopy).
Lineage Tracing of PECs Using Metabolic Labeling
To test our hypothesis that PECs contribute to podocyte turnover,we performed metabolic labeling in adolescent female Sprague-Dawleyrats using bromodeoxyuridine (BrdU) for 14 d. We then analyzedBrdU labeling of glomerular cells by triple-immunofluorescentstaining immediately after the labeling period (t = 0) and 6,12, and 14 wk later (Figure 4). Immediately after the labeling,7.1 ± 1.2% of the PECs were BrdU positive in adolescentrats (versus 1% labeling in adult rats; data not shown), indicatingincreased PEC proliferation in adolescence. BrdU labeling ofPECs was independent of their anatomic location relative tothe vascular stalk. Only 0.53 ± 0.28% of all Wilms’tumor (WT-1)-positive podocytes had incorporated BrdU immediatelyafter BrdU labeling (Figure 4F), confirming that podocytes essentiallydo not proliferate.
Figure 4. Metabolic labeling of rat PECs. After weaning, 75-g female Sprague-Dawley rats were labeled with BrdU over 14 d and followed up to 14 wk. (A through D) Representative triple-immunofluorescent staining for the nuclear Pod marker protein WT-1 (red; A), BrdU (green; B), and DNA (blue; C) 12 wk after BrdU labeling. (D) Merged image (phase contrast image not shown). Arrowhead, BrdU-labeled PEC along the inner aspect of Bowman's capsule; arrow, BrdU-labeled WT-1–positive Pod nucleus on the glomerular tuft. (E) BrdU labeling persisted in glomerular cells (mainly mesangial and endothelial cells) without a significant increase over time (). Shortly after weaning, 7% of all PECs were metabolically labeled with BrdU. Over time, BrdU labeling of PECs increased significantly, most likely as a consequence of ongoing proliferation and self-regeneration of this cell population (*P = 0.02, one-sided ANOVA test). (F) BrdU-positive Pod were detected significantly more often at 12 or 14 wk after metabolic labeling (*P = 0.03, **P < 0.01, one-sided ANOVA test; n = 3 animals per time point, 300 glomeruli per animal). During the observation period, adolescent rats more than quadrupled their body weights (gray line). No significant increase in Pod numbers (WT-1–positive cells) relative to all glomerular cells was observed.
Metabolic labeling persisted in PECs throughout the observationperiod of 14 wk (Figure 4E). After 12 and 14 wk, BrdU-positivepodocytes increased to 1.1 ± 0.33 and 1.3 ± 0.32%,respectively (Figure 4F). These results support the existenceof a regenerative mechanism for podocytes. To resolve this issuefurther we performed, genetic cell tracing experiments.
A Fragment of the PODXL1 Promoter Drives Expression in PECs but not in Podocytes
To resolve whether PECs migrate onto the glomerular tuft anddifferentiate into podocytes, we had to identify a PEC-specificpromoter to allow genetic tagging of PECs. Three kb of the humanpodocalyxin (hPODXL1) 5' flanking region and 0.3 kb of the rabbitPodxl1 5' untranslated region (GenBank accession no. EU360962)were used to drive expression of rabbit podocalyxin in transgenicmice (pPEC-cPodxl1; Figure 5). This transgenic mouse was originallydesigned to reproduce the expression pattern of the endogenouspodocalyxin gene within podocytes. Unexpected, transgene expressionwas detected exclusively within PECs but not in podocytes insix of nine founder lines using a monoclonal anti-serum specificfor transgenic rabbit podocalyxin24 (Figure 5, B and C).
Figure 5. Identification of a PEC-specific promoter. (A) Map of the pPEC-cPodxl1 transgene. A 3-kb hybrid of the human and rabbit podocalyxin (hPODXL1) promoter (parietal cell promoter, pPEC) was used to drive expression of rabbit podocalyxin (cPodxl1) in transgenic mice. BGHpA, bovine growth hormone polyadenylation signal. (B through D) Transgene expression within the renal cortex. (B) In adult pPEC-cPodxl1–transgenic mice, rabbit podocalyxin was expressed exclusively in PECs of the renal cortex (arrowheads). (C) Transgene expression was restricted to PECs (arrowheads) and did not extend into the S1 segment of proximal tubular cells, which in male mice extends into Bowman's capsule (arrows). No labeling of Pod was observed (immunohistologic staining using anti-rabbit podocalyxin mouse mAb 4B3). (D and E) In newborn pPEC-cPodxl1 mice, the parietal promoter was active exclusively in mature PECs of the capillary loop stage or mature glomeruli (arrowheads). No transgene expression was observed in earlier developmental stages (e.g., S-shaped bodies [arrow]).
Nephrogenesis persists in newborn mice, so all developmentalstages can be observed within the kidney cortex. Transgene expressionwas detected exclusively in mature PECs beginning at the capillaryloop stage but not in earlier stages of glomerular developmentor anywhere else within the kidney (Figure 5, D and E).
A Novel Transgenic Mouse Line for Inducible Genetic Tagging of PECs
Because of the exceptional specificity of the identified promoterfor PECs, we generated a second transgenic mouse to allow induciblegenetic tagging of PECs at any desired time point. For thispurpose, we placed the enhanced reverse tetracycline transactivator(rtTA-M2)25 under the control of the PEC-specific promoter describedin the previous two paragraphs (pPEC-rtTA). Six founders werebred to homozygous LC1/R26R reporter mice for further analysis.Upon administration of doxycycline for 14 d, the LC1 transgenereversibly expressed Cre recombinase under the control of aninducible promoter (tetracycline-responsive element)26 onlyin PECs. Once Cre excision occurred within the ubiquitouslyactive ROSA26 locus,27 β-galactosidase (β-gal) isconstitutively and irreversibly expressed within the cells andall its progeny ("genetic tagging"; Figure 6A).
Figure 6. Genetic tagging of PECs in a triple-transgenic doxycycline-inducible rtTA mouse line. (A) pPEC-MCS, the rabbit podocalyxin cDNA, was replaced by a multiple cloning site (MCS; available restriction sites indicated). The enhanced tetracycline reverse transactivator (rtTA-M2) was cloned into Nhe1/Xho1 (red). pPEC-rtTA–transgenic mice were generated by pronuclear injection and mated to LC1 mice expressing Cre recombinase and luciferase under the control of tetracycline-responsive elements (TRE), which can be activated by rtTA-M2 in the presence of doxycycline and R26R: This reporter line irreversibly expresses β-gal (LacZ) under the control of the ubiquitous ROSA26 locus only after Cre excision of an interposed floxed neomycin cassette (neo; acting as a stop signal) has occurred. (B) Genetic labeling of PECs using doxycycline in 6-wk-old triple-transgenic pPEC-rtTA mice (pPEC-rtTA/LC1/R26R; 9 wk of age). Sporadic labeling was observed in some tubular cells of the renal cortex (arrows). (C) After induction, Cre recombination occurred in 72% of all PECs (arrowheads, labeled PEC; arrow, unlabeled PEC). (D and D') Cre recombination was induced in triple-transgenic mice 5 d after birth (d5), when nephrogenesis still persists. Two days after doxycycline administration (d7), specific genetic labeling of PECs was verified by immunofluorescent staining (arrowheads). In 1 to 2% of all glomeruli, labeled cells on the glomerular tuft were observed (arrow with tails, confocal triple-immunofluorescent labeling; red, β-gal [genetic marker for PECs]; green, E-cadherin (proximal tubular cell marker); blue, DNA).
Cre recombination was induced in triple-transgenic pPEC-rtTA/LC1/R26Rmice at the age of 6 wk by administration of doxycycline for14 d (Figure 6, B and C). As judged by enzymatic and immunofluorescentβ-gal staining, Cre recombination occurred exclusivelywithin PECs in four transgenic lines. When analyzing the ratioof β-gal–positive to –negative PECs (definedas a cell along Bowman's capsule with a visible nucleus), 72%of all PECs were genetically tagged by Cre recombination. Geneticlabeling then persisted in PECs throughout life (1-yr observationperiod; data not shown), supporting the notion that this cellpopulation regenerates itself. Aberrant Cre recombination inpodocytes or other cells in the glomerular tuft was negligible(less than one cell per 100 glomeruli). Similar to pPEC-cPodxl1–transgenicmice, the triple-transgenic lines exhibited sporadic Cre recombinationin tubular cells, most notably of collecting ducts (Figure 6B),the thin part of the loop of Henle, and epithelial cells ofthe pyramid, but not in the urothelial epithelium (see below).In the absence of doxycycline, Cre recombination did not occureven in triple-transgenic pPEC-rtTA/LC1/R26R mice (n = 10; datanot shown) older than 1 yr. In summary, the pPEC-rtTA/LC1/R26Rmice provide a novel tool to introduce a specific and irreversiblegenetic label into PECs in vivo and thereby allow for the tracingof these cells for any desired period of time.
Genetic Tagging of PECs in Adolescent Mice
For testing whether PECs contribute to the generation of podocytes,newborn triple-transgenic mice were genetically labeled by doxycyclineadministration on postnatal day 5. On postnatal day 7, Cre recombinationwas evident specifically in PECs by their expression of β-gal(Figure 6, D and D'). At this time point, 1.6 labeled cellsper 100 glomeruli were detected within the glomerular tuft.Subsequently, a constant increase in genetically labeled glomerularcells was observed over time. On postnatal day 12, 21 ±10 labeled cells were observed per 100 glomeruli. β-Gal–positivecells increased approximately 10-fold at weeks 6 and 12, respectively(Figure 7). We observed a similar increase of labeled glomerularcells in triple-transgenic mice that received doxycycline 10d after birth, when nephrogenesis has ceased (Figure 7C). Wealso noted an increase in genetically labeled tubular epithelialcells.
Figure 7. Recruitment of PECs onto the glomerular tuft in adolescent pPEC-rtTA/LC1/R26R mice. (A) After genetic tagging of PECs 5 d after birth, β-gal–positive cells (arrows) can be detected on glomerular tufts on day 12. (B) Six weeks after birth, genetically tagged cells are present within most glomeruli (arrows) of the outer cortex as well as close to the medulla. Genetic labeling persists in PECs (arrowheads). (C) Statistical analysis of β-gal–positive cells per 100 glomeruli over time in triple-transgenic PEC-TETon mice induced 5 (d5) or 10 d after birth (d10). A similar increase of β-gal–positive cells over time was observed in both groups (**P < 0.01 ANOVA; n = 5 for each time point). (D through F) Genetic labeling persists in PECs (arrowheads) 12 d (D) and 6 and 12 wk (E and F) after doxycycline administration. β-Gal–positive cells were identified close to the VP (arrow with tails) as well as projecting into the periphery of the glomerulus (arrow). (F) Occasionally, glomeruli with up to 20 β-gal–positive cells were observed at 12 wk of age (arrowheads, labeled PECs; A, B, and D through F, X-gal/eosin staining on 6-µm cryosections).
To test whether genetically labeled cells were fully differentiatedpodocytes, we analyzed the kidneys of the 6- and 12-wk-old miceby double-immunofluorescent staining and confocal microscopy.Genetically labeled β-gal–positive cells always coexpressedthe podocyte marker proteins nephrin, synaptopodin, and WT-1but not the endothelial marker von Willebrand factor (Figure 8).Of note, genetically labeled transitional cells at the PEC/podocyteinterface expressed intermediate levels of the podocyte markernephrin (Figure 8A, arrowheads).
Figure 8. β-Gal–positive cells on the glomerular tuft are fully differentiated Pod. (A) Double-immunofluorescent staining for β-gal (red) and the Pod marker protein nephrin (green) in 6-wk-old triple-transgenic PEC-TETon mice induced with doxycycline at the age of 5 d. PECs expressed constitutively β-gal (open arrowheads). β-Gal–positive cells on the vascular tuft were exclusively Pod as demonstrated by nephrin coexpression (green, arrows). Transitional cells, located close to the vascular stalk, were genetically labeled (β-gal positive) and expressed low to intermediate levels of the Pod marker protein nephrin (filled arrowheads). (B) No co-localization of β-gal–positive cells (red, arrow) with the endothelial cell marker vWF (green, arrowheads) was observed in the mice described. Interstitial capillaries are marked in B (vWF) (open arrowhead). (C) β-Gal–positive Pod derived from PECs coexpress WT-1 (arrow, open arrowheads, β-gal positive/WT-1 negative PEC nuclei). Panel shows an enzymatic β-gal staining (in blue)/immunohistochemical 3-amino-9-ethyl-carbazole (AEC) anti–WT-1 (in red) double stainings.
In conclusion, these data show that β-gal–labeledPECs are recruited onto the glomerular tuft during adolescenceand that these cells fully differentiate into podocytes.
Extrarenal Activity of the PEC-Specific Promoter
The extrarenal activity of the PEC-specific promoter was analyzedby a chemiluminescent assay of total tissue lysates and verifiedby histology (Table 1, Figure 9). β-Gal expression wasnoted within the basal layers of the seminiferous epitheliumof the testis, the pancreatic ducts, spleen, and thymus follicles(likely MHCII-negative follicular dendritic cells; Figure 9,B through E). Cre recombination was never observed after doxycyclineadministration within the bone marrow of triple-transgenic miceeven when analyzed up to 8 mo (Figure 9E).
Figure 9. Activity of the parietal cell promoter. (A) Within the kidney, activity of the PEC promoter was also observed within the thin limb of the loop of Henle (arrows, pPEC-cPodxl1 transgenic mouse; brown, anti-rabbit podocalyxin staining, hematoxylin counter staining). (B) Mesothelial cells lining the peritoneal cavity on the uterus were genetically labeled in a mosaic manner (arrowhead). (C) Cre recombination occurred within the epithelium of the pancreatic ducts (arrowheads) but not within glandular cells or pancreatic islets (arrow). (D and D') Activity of the parietal cell promoter within follicles of the spleen (arrow) was visualized by immunohistology in pPEC-cPodxl1–transgenic mice (D, anti-rabbit podocalyxin in brown; D' control using irrelevant primary antibody). (E) No evidence for Cre recombination was observed within cells of the bone marrow of mice more than 8 mo after induction (B, C, and E, pPEC-rtTA/LC1/R26R mouse, X-gal/eosin staining on cryosections).
In this study, we provide the first evidence that podocytesare recruited from PECs under physiologic conditions. This conceptis based on four major findings.
Our first major finding was that transitional cells with morphologicand immunohistochemical features of both PECs and podocytescould be detected at the glomerular vascular stalk. One featureof transitional cells was the presence of a glomerular basement–typemembrane, which was always associated with them but not withPECs. Further features included heterogeneous vacuoles, an uprightcell body, and the transition to a large lobulated nucleus.Cells with similar features were first described within theglomeruli of sheep and were subsequently detected in many species.28Given their location close to the vascular pole, these cellswere termed "peripolar cells." Because of the multiple vacuoles,which were also observed in this study, it was initially speculatedthat these cells secrete hormones or other mediators29; however,until now, no specific hormone could be detected and the functionof these cells remained elusive. Our data suggest that peripolarcells are PECs in the process of differentiating into podocytes.Our findings are also in agreement with Bariety et al.,30 whoshowed that cells expressing podocyte markers extend along thevascular stalk onto Bowman's capsule at the vascular pole inthe majority of glomeruli of normal human kidneys. In this work,we observed that cells expressing the PEC marker claudin-1 extendalong the vascular stalk onto the glomerular tuft and coexpresspodocyte marker proteins. The region of overlap defines thearea of PEC to podocyte differentiation.
Second, in metabolic pulse-chase experiments in juvenile rats,we observed a two- to three-fold increase in BrdU-labeled podocytesafter BrdU administration. Because direct labeling of podocytescould no longer contribute to the increase, such an increasecould be explained by nuclear divisions of BrdU-labeled podocytes.Although there is no evidence to support the occurrence of significantcellular divisions (cytokinesis) of podocytes in vivo,9 at leastnuclear divisions have been observed in podocytes under veryparticular conditions such as infusion of high dosages of fibroblastgrowth factor 231; however, no bi-nucleated podocytes were observedin our study.
More likely, the two- to three-fold increase represents podocytereplacement by BrdU-labeled hematopoietic cells11–13 orcells of an intrarenal origin, such as PEC. In the latter case,one can calculate that at a labeling efficiency of 11% of allPECs at 14 wk, between 7.0 ± 0.2 and 12.0 ± 0.3%of all podocytes would have been derived from BrdU-positivePECs, concurring with our results obtained from the genetictagging experiments.
Our third major finding was the identification of a novel promoterwith PEC specificity in the glomerulus, which provided the foundationto trace the fate of PECs in vivo. That the novel PEC-specificpromoter identified in this study was derived from a relativelypodocyte-specific gene (podocalyxin) further supports a closerelationship between these two cell populations. So far, itis unknown why the promoter was active exclusively in PECs andnot in podocytes. In development, endogenous podocalyxin isalso expressed by PECs within the kidney, albeit at a low level.32For the purposes of our studies, however, this issue is of littlerelevance, because genetic labeling using Cre recombinationfollows an "all or nothing law," whereby only cells that expresssufficient levels of Cre recombinase undergo recombination.These cells (e.g., PECs) will then express maximum levels ofthe reporter gene β-gal. Consequently, even if there werelow-level expression of the construct in podocytes, this wouldnot be detected with our system because the threshold for Crerecombination is obviously not reached in podocytes or any otherglomerular cell. Because no genetically marked cells were observedwithin the kidney in triple-transgenic mice that had not receiveddoxycycline, the use of the doxycycline-inducible system effectivelyprecluded aberrant Cre recombination during the chasing period.Also, Cre recombination did not occur in bone marrow cells.This finding is important given the observation of bone marrow–derivedcells in podocyte locations in diseased rodent and human kidneys.11–13Such cells, therefore, cannot account for the findings of thisstudy. In summary, the pPEC-rtTA/LC1/R26R mice provide a noveltool to introduce a specific and irreversible genetic labelinto PECs in vivo and thereby allow for the tracing of thesecells for any desired period of time. Any increase in labeledpodocytes after completion of the genetic labeling with doxycyclinecould have originated only from PECs migrating onto the glomerulartuft.
The fourth major finding of this study was that in cell-tracingexperiments, podocytes were recruited from PECs. Recruitmentof podocytes was high during postnatal glomerulogenesis as wellas in juvenile mice, when glomerulogenesis was completed anda rapid, approximately 10-fold increase in size of the kidneyoccurred. Our data thereby provide the experimental proof fora hypothesis that in parallel was proposed on the basis of findingsin human PEC.33 Thus, in the study of Ronconi et al.,33 it wasshown that PECs express stem cell marker proteins and graduallylose the expression of these proteins as they approach the glomerulartuft. Furthermore, PECs that express stem cell markers retainedmultipotency and could engraft and differentiate into podocytesin the glomeruli of developing fetal kidneys. Our observationalso provides an explanation for the findings of Bariety etal.30 and Gibson et al.,30,34 who observed that Bowman's capsulecan be lined by "parietal podocytes" in atubular glomeruli ofdamaged human transplant kidneys. Interestingly, parietal podocytescoexpressed PEC and podocyte marker proteins (e.g., Pax2, WT-1),suggesting that these cells resembled transitional cells atthe vascular stalk. Our findings, therefore, suggest that parietalpodocytes in atubular glomeruli are the result of a prematurePEC differentiation triggered by an as-yet-unknown signal.
Our data do not exclude that other mechanisms of podocyte regenerationexist, such as their replacement by bone marrow30,34derivedcells11–13; however, our data are more suitable to explainthe development of the glomerular tip lesion, which by someauthors is considered to represent an early stage in the evolutionof FSGS.35 Thus, our findings suggest that within the glomerulusa gradient exists, whereby podocytes at the glomerular tip wouldrepresent the "oldest" podocytes, which in turn might be mostsusceptible to damage.
In summary, using various lines of evidence, we demonstratethat podocytes can be recruited from PECs. Our findings explainhow the growing glomerulus is covered with podocytes despitetheir inability to undergo cell division. Finally, the observationof podocyte recruitment from PECs lays the basis for searchingfor pharmacologic strategies aimed at accelerating podocyteand thereby glomerular regeneration. This will represent a completelynovel approach to treating chronic kidney disease.
Plasmid Construction and Generation of Transgenic Mice
The human promoter/enhancer of hPODXL1 (-3 kb until 97 bp 5'of the ATG) was amplified by PCR (Accuprime; Invitrogen, Karlsruhe,Germany) from a BAC clone RP11-180C16 (accession no. AC008264.10,Homo sapiens chromosome 7) using forward primer 5'-AGTAACTAGTCTTCATAGTATTGGCTTCTGT3-'and reverse primer 5'-AGTAAGATCTTGTGGGTGGCTCCGGAGGC-3'. Theresulting promoter fragment was cloned in reverse orientationinto pGlowTOPO (Invitrogen) using Spe1/BglII (clone A). Rabbitpodocalyxin cDNA, including 326 bp of cPodxl1 5'untranslatedregion, was released using EcoRI (fragment size 2 kb) from afull-length hPODXL1 clone,24 filled in with Klenow (Promega,Madison, WI) and cloned into clone A using XbaI blunt endedwith Klenow (pGlowTopo-cPodxl1). The human promoter region phPODXL1was reversed in orientation by digesting clone A with Bgl IIand SpeI, filled with Klenow and ligated into PGlowTopo-cPodxl1,digested with BglII and Spe1, filled with Klenow (pPEC-cPodxl1).The entire promoter region was sequenced (GenBank accessionno. EU360962).
The cPodxl1 cDNA was replaced by a multiple cloning site byPCR mutagenesis using Accuprime and the primers PECMCS.fwd 5'P-ATGGCTAGCCTCGAGATCTGGACAACCTGACCAAGGACG-3'and PECMCS.rev 5'P-GGTGGTCGCGACTAGTCCTCGCTCCGGGGGCCTGGA-3' usingpPEC-cPodxl1 as template. The template was removed by digestionwith DpnI, and the resulting 8-kb product was recircularizedusing T4 ligase (pPEC-MCS; Fermentas, St. Leon-Rot, Germany).PUHrt62–1, containing the improved reverse tetracycline–inducibletransactivator (rtTA-M2),25 was digested with Xba1/BamH1 andcloned into pPEC-MCS digested with Spe1/BglII (pPEC-rtTA-M2).The enhanced transcription factor rtTA-M2 is characterized bylower background activity and a higher sensitivity to doxycycline.The promoter and coding region, including the polyadenylationsignal of this clone, was entirely sequenced. For pronuclearinjection of pPEC-cPodxl1 and pPEC-rtTA-M2, the prokaryoticsequence was removed using SspI and NsiI. Pronuclear injectionwas performed according to standard procedures into a 129/SvEvx C57BL/6J genetic background at the Interfakultaere BiomedizinischeForschungseinrichtung (IBF) of the Heidelberg University (Heidelberg,Germany). All three transgenes were heterozygous within theexperimental animals. For achieving this, the PEC-rtTA linewas mated to homozygous LC1/R26R mice, yielding 50% triple-transgenicoffspring.
All animal studies were approved by the University of MichiganCommittee on Use and Care of Animals and by the LANUV Cologne9.32.2.10.35.07.041 and Stuttgart 35-9185.81/G-32/03. All experimentalgroups contained a similar distribution of males and femalesunless stated otherwise. Animals received regular feeding andwater ad libitum and were kept under specific pathogen–freeconditions in a 12-h light cycle (22°C, 50% humidity).
Genotyping
Nine founder mice were identified by PCR from tail biopsies,which were incubated in 190 µl of Viagen DirectPCR lysisreagent (Viagen cat. no. 102-T; Viagen, Los Angeles, CA) and10 µl of Proteinase K (Sigma cat. no. 6556; Sigma Aldrich,St. Louis, MO) stock concentration of 4 mg/ml at 55°C overnightand heat inactivated at 85°C for 45 min. The following primerswere used: Cre forward GCATAACCAGTGAAACAGCATTGCTG and reverseGGACATGTTCAGGGATCGCCAGGCG; LacZ forward TTCACTGGCCGTCGTTTTACAACGTCGTGAand reverse ATGTGAGCGAGTAACAACCCGTCGGATTCT; LC1 forward TTACAGATGCACATATCGAGGand reverse TAACCCAGTAGATCCAGAGG; TetOn forward AATCGAGATGCTGGACAGGCATCATACCCAand reverse GGCATAGAATCGGTGGTAGGTGTCTCTCTT; and ROSA26 forwardGCGAAGAGTTTGTCCTCAACC, ROSA26_1 reverse GGAGCGGGAGAAATGGATATG,and ROSA26_2 reverse AAAGTCGCTCTGAGTTGTTAT.
Transgene expression was evaluated in pPEC-Podxl1 mice by immunohistologyaccording to standard techniques36 using an antiserum specificfor rabbit podocalyxin (4B3).24 Six of nine founder lines expressedtransgenic rabbit podocalyxin. Nine founder animals transgenicfor pPEC-rtTA were obtained.
Doxycycline Treatment
Double- or triple-transgenic animals received doxycycline hydrochloridevia the drinking water for a total of 14 d (5% sucrose and 0.5mg/ml doxycycline, protected from light), which was exchangedevery 2 d. For induction of 5- or 10-d-old animals, 50 ng/gbody wt doxycycline dissolved in 0.45% NaCl solution was injectedintraperitoneally over a total of 3 d.
Perfusion Fixation and Electron Microscopy
Mice were anesthetized (Avertin, Sigma Aldrich, St. Louis, MO)and ice-cold perfusion solution (3% paraformaldehyde, 0.2% glutaraldehyde,2.5 mM EGTA, and 4 mM MgCl2 in 0.5 x PBS [pH 7.6]) was perfusedinto the left ventricle for 3 min followed by 20% sucrose for1 min. Organs and tissues were immediately recovered and snap-frozenin Tissue-Tek (Miles Inc., Iowa City, IA) or embedded in paraffin.Transmission electron microscopy was performed as describedpreviously.37
β-Gal Assays
β-Gal activity was measured in unfixed snap-frozen tissuesusing a commercial chemiluminescent assay, Galacto-Star (Tropix,Bedford, MA), as described previously.38 For enzymatic X-Galstaining, 6-µm cryosections were cut and incubated overnightat 35°C in a humidified atmosphere in staining solution(1 mg/ml X-Gal, 5 mM potassium ferricyanide, 5 mM potassiumferrocyanide, and 2 mM MgCl2 in PBS [pH 7.8]). On the next day,samples were counterstained with eosin, washed in tap water,and mounted (Immu-Mount; Thermo Scientific, Waltham, MA).
Immunofluorescence
Immunofluorescence was performed as described previously39,40on 2- and 4-µm cryosections blocked with 10% donkey serumin PBS (017-000-121; Jackson Immunoresearch Laboratories, WestGrove, PA) and incubated with the following antibodies: Chickenanti–β-gal polyclonal antibody (1:100, ab9361, lotno. 301516; Abcam, Cambridge, UK), mouse anti-nephrin polyclonalantibody (1:100; a gift of Lawrence B. Holzman, Ann Arbor, MI),mouse anti-synaptopodin polyclonal antibody (1:100, 65294; Progen,Heidelberg, Germany), rabbit anti–claudin-1 (DAKO, Glostrup,Denmark), rabbit anti–von Willebrand factor (A0082; DAKO),chicken anti-nestin (DAKO), rat anti–aminopeptidase A(ASD41), rat anti-DPPIV (ASD36),23 goat anti-rabbit Dylight549 (1:100, 35557; Pierce Biotechnology, Rockford, IL), AlexaFluor 488–conjugated goat anti-rat (1:200, A11006; MolecularProbes, Eugene, OR), Cy3-conjugated donkey anti-chicken IgGand Cy2-conjugated rabbit anti-mouse IgG (1:100, 703-225-155and 715-225-151, respectively; Jackson Immunoresearch Laboratories).Nuclei were stained with TO-PRO-3 (624/661; 1:200, T3605; MolecularProbes). All secondary antibodies, except the anti-mouse antibody,were immunoabsorbed with 4% normal mouse serum. Irrelevant rabbitIgG was used as control. For immunohistochemical stainings,the X-gal–stained cryosections were boiled in citratebuffer, blocked against avidin and biotin, and stained withthe anti–WT-1 antiserum (1:400; Santa Cruz Biotechnology,Santa Cruz, CA). Secondary anti-rabbit (BA-1000; Vector Laboratories,Burlingame, CA) was visualized using 3-amino-9-ethyl-carbazole(AEC). Sections were evaluated with an Olympus BX 41 microscope(Hamburg, Germany) and Zeiss LSM 510 Meta laser inverted confocalmicroscope, (Goettingen, Germany). Images were collected withAnalySIS (Soft Imaging System, Münster, Germany) and preparedfor presentation with Adobe Photoshop and Illustrator software(Adobe Systems, Mountain View, CA).
Metabolic Labeling
Female Sprague-Dawley rats weighing 75 g were purchased fromCharles River (Charles River Laboratories, Inc., Wilmington,MA). BrdU (B-5002; Sigma) labeling was performed as describedpreviously.17 In brief, rats received a subcutaneous injectionof 25 µg of BrdU in 500 µl sterile 0.9% NaCl twicea day for 14 d. Animals were anesthetized with isoflurane andketamine/rompune and perfusion-fixed through the left ventriclewith 3% paraformaldehyde in 0.5% PBS (pH 7.6) for 3 min. Four-micrometercryosections were boiled in citrate buffer three times for 5min; blocked with 10% donkey serum; incubated with anti-BrdUantibody (MAB3424, 1:200; Chemicon, Billerica, MA), anti–WT-1(1:400; Santa Cruz Biotechnology, Santa Cruz, CA), and Hoechst33342 (0.1 mg/ml; Sigma), counterstained; and mounted as describedalready.
Statistical Analysis
Three hundred glomeruli were evaluated for each experimentalanimal on random transverse sections through the middle partof the kidney. Glomeruli that did not have a glomerular tuftor that were sectioned close to the edge were disregarded. Transitionalcells were identified on X-gal–stained cryosections aslarge upright epithelial cells located along the vascular stalk.PECs were counted only when their cellular body, including thenucleus, was seen. Data were analyzed using Prism 4.0 for Macintosh(GraphPad, San Diego, CA) using the one-sided ANOVA test.
This work was supported by the German Research Foundation (MO1082/1-1,1-2, 3-1); the Else-Kröner-Fresenius-Stiftung; the STARTProgram of the Faculty of Medicine, RWTH-Aachen (to M.J.M.);and by the NIH (R01-DK058270 to D.B.K.). M.M. is a member ofthe DFG research group "Mechanisms of Chronic Renal Failure"and of the Transregio/SFB DFG consortium "Mechanisms of OrganFibrosis."
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
D.A. and D.K. contributed equally to this work.
See related editorial, "Parietal Epithelial Cells RegeneratePodocytes," on pages 231–233.
US Renal Data System:
USRDS 2007 Annual Report, Bethesda, National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases, 2007
Wharram BL, Goyal M, Wiggins JE, Sanden SK, Hussain S, Filipiak WE, Saunders TL, Dysko RC, Kohno K, Holzman LB, Wiggins RC: Podocyte depletion causes glomerulosclerosis: Diphtheria toxin-induced podocyte depletion in rats expressing human diphtheria toxin receptor transgene.
J Am Soc Nephrol 16
: 2941
–2952, 2005[Abstract/Free Full Text]
Novick AC, Gephardt G, Guz B, Steinmuller D, Tubbs RR: Long-term follow-up after partial removal of a solitary kidney.
N Engl J Med 325
: 1058
–1062, 1991[Abstract]
Kriz W, Gretz N, Lemley KV: Progression of glomerular diseases: Is the podocyte the culprit?
Kidney Int 54
: 687
–697, 1998[CrossRef][Medline]
Hara M, Yamamoto T, Yanagihara T, Takada T, Itoh M, Adachi Y, Yoshizumi A, Kawasaki K, Kihara I: Urinary excretion of podocalyxin indicates glomerular epithelial cell injuries in glomerulonephritis.
Nephron 69
: 397
–403, 1995[Medline]
Vogelmann SU, Nelson WJ, Myers BD, Lemley KV: Urinary excretion of viable podocytes in health and renal disease.
Am J Physiol Renal Physiol 285
: F40
–F48, 2003[Abstract/Free Full Text]
Yu D, Petermann A, Kunter U, Rong S, Shankland SJ, Floege J: Urinary podocyte loss is a more specific marker of ongoing glomerular damage than proteinuria.
J Am Soc Nephrol 16
: 1733
–1741, 2005[Abstract/Free Full Text]
Fries JW, Sandstrom DJ, Meyer TW, Rennke HG: Glomerular hypertrophy and epithelial cell injury modulate progressive glomerulosclerosis in the rat.
Lab Invest 60
: 205
–218, 1989[Medline]
Pabst R, Sterzel RB: Cell renewal of glomerular cell types in normal rats: An autoradiographic analysis.
Kidney Int 24
: 626
–631, 1983[Medline]
Marshall CB, Shankland SJ: Cell cycle and glomerular disease: A minireview.
Nephron Exp Nephrol 102
: e39
–e48, 2006[CrossRef][Medline]
Prodromidi EI, Poulsom R, Jeffery R, Roufosse CA, Pollard PJ, Pusey CD, Cook HT: Bone marrow-derived cells contribute to podocyte regeneration and amelioration of renal disease in a mouse model of Alport syndrome.
Stem Cells 24
: 2448
–2455, 2006[CrossRef][Medline]
Sugimoto H, Mundel TM, Sund M, Xie L, Cosgrove D, Kalluri R: Bone-marrow-derived stem cells repair basement membrane collagen defects and reverse genetic kidney disease.
Proc Natl Acad Sci U S A 103
: 7321
–7326, 2006[Abstract/Free Full Text]
Becker JU, Hoerning A, Schmid KW, Hoyer PF: Immigrating progenitor cells contribute to human podocyte turnover.
Kidney Int 72
: 1468
–1473, 2007[CrossRef][Medline]
Ito T, Suzuki A, Imai E, Okabe M, Hori M: Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling.
J Am Soc Nephrol 12
: 2625
–2635, 2001[Abstract/Free Full Text]
Imasawa T: Roles of bone marrow cells in glomerular diseases.
Clin Exp Nephrol 7
: 179
–185, 2003[CrossRef][Medline]
Lin F, Moran A, Igarashi P: Intrarenal cells, not bone marrow-derived cells, are the major source for regeneration in postischemic kidney.
J Clin Invest 115
: 1756
–1764, 2005[CrossRef][Medline]
Vogetseder A, Karadeniz A, Kaissling B, Le Hir M: Tubular cell proliferation in the healthy rat kidney.
Histochem Cell Biol 124
: 97
–104, 2005[CrossRef][Medline]
Sagrinati C, Netti GS, Mazzinghi B, Lazzeri E, Liotta F, Frosali F, Ronconi E, Meini C, Gacci M, Squecco R, Carini M, Gesualdo L, Francini F, Maggi E, Annunziato F, Lasagni L, Serio M, Romagnani S, Romagnani P: Isolation and characterization of multipotent progenitor cells from the Bowman's capsule of adult human kidneys.
J Am Soc Nephrol 17
: 2443
–2456, 2006[Abstract/Free Full Text]
Lazzeri E, Crescioli C, Ronconi E, Mazzinghi B, Sagrinati C, Netti GS, Angelotti ML, Parente E, Ballerini L, Cosmi L, Maggi L, Gesualdo L, Rotondi M, Annunziato F, Maggi E, Lasagni L, Serio M, Romagnani S, Vannelli GB, Romagnani P: Regenerative potential of embryonic renal multipotent progenitors in acute renal failure.
J Am Soc Nephrol 18
: 3128
–3138, 2007[Abstract/Free Full Text]
Ohse T, Pippin JW, Vaughan MR, Brinkkoetter PT, Krofft RD, Shankland SJ: Establishment of conditionally immortalized mouse glomerular parietal epithelial cells in culture.
J Am Soc Nephrol 19
: 1879
–1890, 2008[Abstract/Free Full Text]
Zou J, Yaoita E, Watanabe Y, Yoshida Y, Nameta M, Li H, Qu Z, Yamamoto T: Upregulation of nestin, vimentin, and desmin in rat podocytes in response to injury.
Virchows Arch 448
: 485
–492, 2006[CrossRef][Medline]
Chen J, Boyle S, Zhao M, Su W, Takahashi K, Davis L, Decaestecker M, Takahashi T, Breyer MD, Hao CM: Differential expression of the intermediate filament protein nestin during renal development and its localization in adult podocytes.
J Am Soc Nephrol 17
: 1283
–1291, 2006[Abstract/Free Full Text]
Mentzel S, Dijkman HB, Van Son JP, Koene RA, Assmann KJ: Organ distribution of aminopeptidase A and dipeptidyl peptidase IV in normal mice.
J Histochem Cytochem 44
: 445
–461, 1996[Abstract]
Kershaw DB, Thomas PE, Wharram BL, Goyal M, Wiggins JE, Whiteside CI, Wiggins RC: Molecular cloning, expression, and characterization of podocalyxin-like protein 1 from rabbit as a transmembrane protein of glomerular podocytes and vascular endothelium.
J Biol Chem 270
: 29439
–29446, 1995[Abstract/Free Full Text]
Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W: Exploring the sequence space for tetracycline-dependent transcriptional activators: Novel mutations yield expanded range and sensitivity.
Proc Natl Acad Sci U S A 97
: 7963
–7968, 2000[Abstract/Free Full Text]
Schonig K, Schwenk F, Rajewsky K, Bujard H: Stringent doxycycline dependent control of CRE recombinase in vivo.
Nucleic Acids Res 30
: e134
, 2002[Abstract/Free Full Text]
Soriano P: Generalized lacZ expression with the ROSA26 Cre reporter strain.
Nat Genet 21
: 70
–71, 1999[CrossRef][Medline]
Yamaguchi H, Kaku H, Onodera T, Kurokawa R, Morisada M: Peripolar cells in guinea pigs under experimental hyperplasia of juxtaglomerular cells induced by long-term, low-dose calcium condition.
Exp Toxicol Pathol 46
: 283
–286, 1994[Medline]
Gardiner DS, Downie I, Gibson IW, More IA, Lindop GB: The glomerular peripolar cell: A review.
Histol Histopathol 6
: 567
–573, 1991[Medline]
Bariety J, Mandet C, Hill GS, Bruneval P: Parietal podocytes in normal human glomeruli.
J Am Soc Nephrol 17
: 2770
–2780, 2006[Abstract/Free Full Text]
Kriz W, Hahnel B, Rosener S, Elger M: Long-term treatment of rats with FGF-2 results in focal segmental glomerulosclerosis.
Kidney Int 48
: 1435
–1450, 1995[Medline]
Bariety J, Bruneval P, Hill G, Irinopoulou T, Mandet C, Meyrier A: Posttransplantation relapse of FSGS is characterized by glomerular epithelial cell transdifferentiation.
J Am Soc Nephrol 12
: 261
–274, 2001[Abstract/Free Full Text]
Ronconi E, Sagrinati C, Angelotti ML, Lazzeri E, Mazzinghi B, Ballerini L, Parente E, Gacci M, Carini M, Maggi E, Serio M, Vannelli GB, Lasagni L, Romagnani S, Romagnani P: Regeneration of glomerular podocytes by human renal progenitors.
J Am Soc Nephrol 20
: 322
–332, 2009[Abstract/Free Full Text]
Gibson IW, Downie TT, More IA, Lindop GB: Atubular glomeruli and glomerular cysts: A possible pathway for nephron loss in the human kidney?
J Pathol 179
: 421
–426, 1996[CrossRef][Medline]
D'Agati VD, Fogo AB, Bruijn JA, Jennette JC: Pathologic classification of focal segmental glomerulosclerosis: A working proposal.
Am J Kidney Dis 43
: 368
–382, 2004[CrossRef][Medline]
Moeller MJ, Soofi A, Sanden S, Floege J, Kriz W, Holzman LB: An efficient system for tissue-specific overexpression of transgenes in podocytes in vivo.
Am J Physiol Renal Physiol 289
: F481
–F488, 2005[Abstract/Free Full Text]
Kriz W, Hahnel B, Hosser H, Ostendorf T, Gaertner S, Kranzlin B, Gretz N, Shimizu F, Floege J: Pathways to recovery and loss of nephrons in anti-Thy-1 nephritis.
J Am Soc Nephrol 14
: 1904
–1926, 2003[Abstract/Free Full Text]
Moeller MJ, Kovari IA, Holzman LB: Evaluation of a new tool for exploring podocyte biology: Mouse Nphs1 5' flanking region drives LacZ expression in podocytes.
J Am Soc Nephrol 11
: 2306
–2314, 2000[Abstract/Free Full Text]
Moeller MJ, Soofi A, Braun GS, Li X, Watzl C, Kriz W, Holzman LB: Protocadherin FAT1 binds Ena/VASP proteins and is necessary for actin dynamics and cell polarization.
EMBO J 23
: 3769
–3779, 2004[CrossRef][Medline]
Moeller MJ, Soofi A, Hartmann I, Le Hir M, Wiggins R, Kriz W, Holzman LB: Podocytes populate cellular crescents in a murine model of inflammatory glomerulonephritis.
J Am Soc Nephrol 15
: 61
–67, 2004[Abstract/Free Full Text]
Related Articles
This Month's Highlights
J. Am. Soc. Nephrol. 2009 20: A12.
[Full Text][PDF]
Parietal Epithelial Cells Regenerate Podocytes
Richard Poulsom and Melissa H. Little
J. Am. Soc. Nephrol. 2009 20: 231-233.
[Full Text][PDF]
This article has been cited by other articles:
M. A. Neusser, M. T. Lindenmeyer, A. G. Moll, S. Segerer, I. Edenhofer, K. Sen, D. P. Stiehl, M. Kretzler, H.-J. Grone, D. Schlondorff, et al. Human Nephrosclerosis Triggers a Hypoxia-Related Glomerulopathy
Am. J. Pathol.,
February 1, 2010;
176(2):
594 - 607.
[Abstract][Full Text][PDF]
B. Smeets, M. L. Angelotti, P. Rizzo, H. Dijkman, E. Lazzeri, F. Mooren, L. Ballerini, E. Parente, C. Sagrinati, B. Mazzinghi, et al. Renal Progenitor Cells Contribute to Hyperplastic Lesions of Podocytopathies and Crescentic Glomerulonephritis
J. Am. Soc. Nephrol.,
December 1, 2009;
20(12):
2593 - 2603.
[Abstract][Full Text][PDF]
B. Smeets, S. Uhlig, A. Fuss, F. Mooren, J. F.M. Wetzels, J. Floege, and M. J. Moeller Tracing the Origin of Glomerular Extracapillary Lesions from Parietal Epithelial Cells
J. Am. Soc. Nephrol.,
December 1, 2009;
20(12):
2604 - 2615.
[Abstract][Full Text][PDF]
A. B. Fogo The multi-talented podocyte
Nephrol. Dial. Transplant.,
November 1, 2009;
24(11):
3269 - 3270.
[Full Text][PDF]
B. D. Humphreys Slow-Cycling Cells in Renal Papilla: Stem Cells Awaken?
J. Am. Soc. Nephrol.,
November 1, 2009;
20(11):
2277 - 2279.
[Full Text][PDF]
P. Rosenstiel, A. Gharavi, V. D'Agati, and P. Klotman Transgenic and Infectious Animal Models of HIV-Associated Nephropathy
J. Am. Soc. Nephrol.,
November 1, 2009;
20(11):
2296 - 2304.
[Abstract][Full Text][PDF]
M. H. Little and J. F. Bertram Is There Such a Thing as a Renal Stem Cell?
J. Am. Soc. Nephrol.,
October 1, 2009;
20(10):
2112 - 2117.
[Abstract][Full Text][PDF]
R. Poulsom and M. H. Little Parietal Epithelial Cells Regenerate Podocytes
J. Am. Soc. Nephrol.,
February 1, 2009;
20(2):
231 - 233.
[Full Text][PDF]
Top
Abstract
Introduction
75% of renal mass, a relative lack of podocytes (podocytopenia) and subsequent FSGS in the originally healthy remnant kidney can lead to renal failure.3 Glomerulosclerosis is also the common final pathway of all glomerular diseases leading to ESRD.4 In glomerular diseases such as diabetic nephropathy, glomerulonephritides, or preeclampsia, significant numbers of podocytes are lost as a result of apoptosis, necrosis or excretion of living cells into the urine. Even in normal individuals, low numbers of living podocytes are continuously shed into the urine.5–7 These numbers are too high to be compatible with renal survival for 80 yr, suggesting the existence of a regenerative mechanism. Also, the reversal of early glomerular damage in animal models and humans8–10 argues for the existence of such a mechanism; however, podocytes are postmitotic cells that cannot undergo complete cell divisions and are therefore unable to regenerate themselves.8–10 A potential mechanism for podocyte replacement from bone marrow–derived stem cells has been described in the Alport mouse model as well as in kidney transplants.11–13 Nevertheless, most studies concluded that regeneration occurs predominantly from an as-yet-unknown source of resident renal cells.12,14–16 
). Shortly after weaning, 7% of all PECs were metabolically labeled with BrdU. Over time, BrdU labeling of PECs increased significantly, most likely as a consequence of ongoing proliferation and self-regeneration of this cell population (*P = 0.02, one-sided ANOVA test). (F) BrdU-positive Pod were detected significantly more often at 12 or 14 wk after metabolic labeling (*P = 0.03, **P < 0.01, one-sided ANOVA test; n = 3 animals per time point, 300 glomeruli per animal). During the observation period, adolescent rats more than quadrupled their body weights (gray line). No significant increase in Pod numbers (WT-1–positive cells) relative to all glomerular cells was observed.
