Molecular Cloning of NHE3 from LLC-PK₁ Cells and Localization in Pig Kidney

Cell Culture

To aid in cloning, we used in LLC-PK₁ line (PKE20) with a three- to fivefold elevated activity of the apical Na⁺/H⁺ exchanger (26). PKE20 was selected from the parent LLC-PK₁/Cl₄ cell line by its ability to survive acid-loading in the presence of EIPA (11); it has remained stable in culture for up to 20 passages. LLC-PK₁/Cl₄ and PKE20 were maintained in α-minimum essential medium supplemented with 10% fetal calf serum under a 5% CO₂ atmosphere at 37°C. Subculturing was performed at 5- to 7-d intervals by trypsinization and reseeding. The cells were periodically confirmed to be free of mycoplasma.

cDNA Synthesis and Reverse Transcription-PCR

Oligonucleotides were synthesized by the Yale University Department of Pathology DNA Synthesizing Service and 5′ end-phosphorylated with ATP using T4 polynucleotide kinase. First strand cDNA was made from 1 μg of poly(A)⁺ RNA using Superscript II reverse transcriptase (Life Technologies, Grand Island, NY) primed by oligo-(dT)₁₇ as described by the manufacturer. Reverse transcription (RT)-PCR was carried out in a reaction volume of 50 μl as described previously (25,27). The reaction mixture was heated for 5 min at 94°C in a thermal cycler (Perkin Elmer, Norwalk, CT) and then cooled to 4°C. Taq DNA polymerase (2.5 U) was added, and the mixture was overlaid with mineral oil. Forty cycles of RT-PCR were performed, each consisting of denaturation for 1 min at 94°C, annealing of oligonucleotides for 1 min at 50°C, and elongation for 3 min at 72°C. A final elongation of 15 min was performed at 72°C. Every RT-PCR included a reagent control that contained all components except template DNA. Such controls were negative for each cDNA amplified (data not shown). The oligonucleotide pair for the first RT-PCR was designed based on the published rabbit NHE3 sequence (4). The DNA sequence of these oligonucleotides was: 1369+, CCGCTGGTGCAGTGGCTGAA; and 2496-, TCACATGTGTGTGGACTCG. Oligonucleotides were designated by their 5′-most nucleotide according to the rabbit sequence, with plus corresponding to the sense sequence, and minus corresponding to the antisense sequence. Two additional RT-PCR reactions were carried out in which one oligonucleotide was derived from the LLC-PK₁ sequence that had already been obtained, and the second was degenerate and based on the previously reported rabbit and rat NHE3 sequences (4,5). These oligonucleotides were: 121+, GTCAC(C/G)TTCAAATGGCACCAC; 541+, CTGCT(A/G)TT(C/T)GGCAGCCTCAT; 614-, GACGTGCACCTCCTCGAA; and 1626-, TCAGGCGTCCTTCAAGTTGAGCT. Degenerate nucleotides are enclosed within parentheses. The three RT-PCR products were subcloned and sequenced as described previously (25,27).

5′ Rapid Amplification of cDNA Ends

5′ rapid amplification of cDNA ends (RACE) was carried out using a commercially available kit as described by the manufacturer (Life Technologies). Briefly, first-strand cDNA was synthesized with a sequence-specific primer, 339-, AACAGCAACAGCTTCTCA. After RNase H removal of the RNA template, the first-strand cDNA was purified using GLASSMAX DNA isolation spin cartridges. A homopolymeric tail was added using terminal deoxynucleotidyltransferase and dCTP. Thirty-five cycles of PCR were performed, each consisting of denaturation for 1 min at 94°C, annealing of oligonucleotides for 30 s at 57°C, and elongation for 2 min at 72°C, using the 5′ RACE anchor oligonucleotide (CTACTACTACTAGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG) and a second sequence-specific oligonucleotide (218-, CTTGTGGGACAGGTGGAAGC). The products of this PCR then served as a template for a second nested PCR reaction using the universal anchor oligonucleotide (CTACTACTACTAGGCCACGCGTCGACTAGTAC), and a third sequence-specific oligonucleotide (180-, CCAGAGCGCAATGATGTACG).

Detection of RACE Products

RACE products were size-fractionated by agarose gel electrophoresis, transferred to a nylon filter, and fixed by ultraviolet transillumination. An internal sequence-specific oligonucleotide (121+, GTCACCTTCAGATGGCACCAC) was radiolabeled with [γ-³²P]dATP using T4 polynucleotide kinase. Filters were prehybridized for 24 h in Church-Gilbert (0.5 M sodium phosphate, pH 7.2, 1 mM ethylenediaminetetra-acetic acid, 7% sodium dodecyl sulfate [SDS], and 1% bovine serum albumin [BSA]) at 55°C, then hybridized for 24 h at 55°C in the same medium that contained 100 μg of denatured salmon sperm DNA/ml, and 10⁶ cpm/ml ³²P-labeled probe. Filters were washed 5 min in 2 × SSC at room temperature, 5 min in 0.5 × SSC that contained 0.1% SDS at 55°C, and exposed to film.

Genomic Library Screening

The first 20 nucleotides of the coding region were obtained by screening a commercially available porcine genomic library in the bacteriophage EMBL3 SP6/T7 (Clontech Laboratories, Palo, Alto, CA). The library was screened using the plaque-lift method. A ³²P-labeled probe was generated by random primer extension in the presence of [α-³²P]dCTP using as template the 5′ RACE product (nt 21 to 180) (28). Duplicate nylon filters were prepared from the plated genomic library. Filters were prehybridized in 6 × SSC (1 × SSC is 0.15 M NaCl and 0.015 M sodium citrate [pH 7.0]), 5 × Denhardt's solution, 0.1% SDS, and 100 μg of denatured salmon sperm DNA/ml at 55°C; hybridized for 24 h in the same medium plus 10⁶ cpm/ml ³²P-labeled probe; washed in 2 × SSC at room temperature and in 2 × SSC, 0.5% SDS at 55°C for 30 min; and exposed to film. Phage that gave positive signals on duplicate filters were plaque-purified through secondary and tertiary screens. Tertiary positives were purified using a modification of the method of Yamamoto et al. (29). Purified phage was digested with SacI and BamHI, size-fractionated by agarose gel electrophoresis, transferred to a nylon filter, and fixed by ultraviolet transillumination. The filter was then probed in the same manner as the genomic library.

Northern Analysis

Poly(A)⁺ RNA was purified from LLC-PK₁/Cl₄ and PKE20 cells grown to confluence in 175-cm² plastic flasks, and from pig kidney cortex. In each case, the RNA was size-fractionated by denaturing agarose gel electrophoresis and transferred to a nylon filter. A 1085-bp cDNA (nt 1369 to 2496) encoding most of the cytoplasmic domain of the exchanger was radiolabeled using random primer extension as described above (Genomic library screening). Filters were prehybridized in 6× SSC, 5× Denhardt's solution, 0.1% SDS containing 50% formamide, and 100 μg of denatured salmon sperm DNA/ml at 42°C; hybridized for 24 h in the same medium plus 10^{6 32}P-labeled probe; washed in 2× SSC at room temperature for 30 min and in 0.1×SSC, 0.1% SDS at 65°C for 30 min; and exposed to film. In comparing NHE3 transcript expression between PKE20 and LLC-PK₁/Cl₄, an actin probe was used as an RNA loading control.

Genomic Southern Analysis

One microgram of genomic DNA from LLC-PK₁/Cl₄ and PKE20 cells was digested with either HindIII or EcoRI, size-fractionated on a 0.6% agarose gel, transferred to a nylon filter, and fixed by ultraviolet transillumination. The filter was prehybridized, hybridized, and probed as described above (Northern analysis). The probe for genomic Southern analysis spanned nucleotides 541 to 1626. The filter was then washed in 2× SSC at room temperature for 30 min; in 2× SSC, 0.1% SDS at 55°C for 30 min; and exposed to film.

Generation of Fusion Protein and Polyclonal Antisera

A porcine NHE3 fusion protein was generated by subcloning a PCR product that was amplified from cloned PKE20 NHE3 into p-mal-cII (New England Biolabs, Beverly, MA). The following oligonucleotides were used in the PCR: 1561+, AGGTCGGCTCAAAAGTCACGA; and 1770-, TCAATTCTCCCTCAGGAGGTAGGA. The integrity of the cloning site and the NHE3 cDNA was verified by DNA sequencing. For purification of the fusion protein, transformed bacteria (Escherichia coli strain DH5α) were grown in Luria-Bertani medium, and fusion protein synthesis was induced by incubation with 0.3 mM IPTG for 2 h. A sonicated cell lysate was prepared and passed over an amylose affinity column as described by the manufacturer (New England Biolabs), and the fusion proteins were eluted with 10 mM maltose. Purified fusion proteins were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and quantified based on Coomassie Blue staining relative to known concentrations of BSA. Polyclonal antisera were raised in three female rabbits. One hundred micrograms of the protein was injected subcutaneously into each animal at monthly intervals, and immune sera were collected. Because antisera from all animals gave the identical result, only one was chosen for further study. This antiserum was then purified over a column of bacterial lysate coupled to cyanogen bromide-activated Sepharose-4B to remove antibodies directed against contaminating Escherichia coli proteins and the maltose-binding protein. Purification was verified by enzyme-linked immunosorbent assay (ELISA).

ELISA

Indirect ELISA was carried out as described previously (30). Serial dilutions of antiserum (before and after passage over the bacterial lysate column) were incubated with a 1:1000 dilution of both the maltose-binding protein and the fusion protein. Detection was performed with a horseradish peroxidase-conjugated goat anti-rabbit IgG. If antibodies to the maltose-binding protein portion of the construct, as well as other contaminants, were successfully removed by passage over the bacterial lysate column, then the purified antiserum should react only with the fusion protein and not the maltose-binding protein alone.

Western Analysis

Microsomes were prepared from LLC-PK₁ and PKE20 as described previously (20). The protease inhibitors phenylmethylsulfonylfluoride (40 mg/ml), pepstatin (0.7 mg/ml), ethylenediaminetetraacetic acid (1 mM), and leupeptin (0.5 mg/ml) were present in all solutions. Protein concentration was determined by Lowry assay with BSA as the standard. Membranes were separated by 7.5% SDS-PAGE under reducing conditions and electroblotted onto polyvinylidene difluoride (Millipore Immobilon-P; Bedford, MA) filters. To verify the specificity of the polyclonal antisera for NHE3, Western analysis was also carried out, using a polyvinylidene difluoride filter to which solubilized LAP1 cells (a mouse cell line that is deficient in Na⁺/H⁺ exchange activity) transfected separately with rabbit NHE1, -2, -3, and -4 as described previously (18) had been transferred (a generous gift of Dr. Peter Aronson and Dr. Daniel Biemesderfer). Immunoblots were blocked for 4 h with Blotto and incubated overnight with a 1:1500 dilution of purified antiserum. After further washing with Blotto, filters were incubated with a 1:1000 dilution of horseradish peroxidase-conjugated goat anti-rabbit IgG, and then developed using enhanced chemiluminescence Western blot detection system as recommended by the manufacturer (Pierce, Rockford, IL). Filters were then exposed to Kodak X-Omat AR film.

Preparation of Riboprobes for in Situ Hybridization

Riboprobes were prepared from two partial-length cDNA encoding porcine NHE3. The first probe comprised the predicted cytoplasmic domain (nucleotides 1369 to 2494), and the second comprised a portion of the membrane-associated domain (nucleotides 765 to 1616). Each cDNA was subcloned into the EcoRV site of the pBluescript II KS+ plasmid. RNA probes were synthesized and labeled by in vitro transcription using digoxigenin-11-dUTP. Sense and antisense probes were generated using either T3 or T7 polymerase (as determined by the orientation of the cDNA), after linearization of the plasmid. RNA probes for in situ hybridization were shortened by alkaline hydrolysis to an average length of 200 bases.

In Situ Hybridization and Immunocytochemistry

Cryostat sections (5 to 7 μm thick) were thawed onto silanized glass slides and processed as described previously (31). Hybridization was performed at 40°C for 16 to 18 h. Slides were washed once at 47°C for 30 min in 1× SSC containing 50% formamide, twice for 30 min in 0.5× SSC containing 50% formamide, and twice for 30 min in 0.1× SSC containing 50% formamide. The slides were then rinsed twice in 0.5× SSC at room temperature for 10 min, once in 0.2× SSC for 10 min, and twice in buffer I (100 mM Tris-HCl, 150 mM NaCl, pH 7.5). Blocking of nonspecific antibody binding sites was performed by incubation with blocking medium (2% normal sheep serum, 0.5% BSA, 3% Triton X-100 in buffer I). To identify specific nephron segments that express NHE3, combined in situ hybridization and immunohistochemistry with antibodies specific to defined nephron segments were performed on the same section. To label thick ascending limb cells, a commercially available goat anti-human Tamm-Horsfall antibody was used (Organon Technika, Durham, NC). To identify connecting tubular cells, a guinea pig anti-rabbit Na⁺/Ca²⁺ exchanger antibody was used (30). After removal of the blocking medium, a mixture of sheep anti-digoxigenin alkaline phosphate conjugate and one of the specific antibodies was diluted in blocking medium. This mixture was incubated with the sections for 2 h at room temperature in a moisture chamber, followed by 16 h at 4°C. Slides were then washed twice for 15 min in buffer I. The primary antibodies were detected using the biotin-streptavidin Texas Red detection system. Afterward, message was detected using the nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate system as detailed previously (31).

Materials

Chemicals were molecular biology grade from Sigma Chemical Co. (St. Louis, MO), Life Technologies, or U.S. Biochemical Corp. (Cleveland, OH). Solutions for use with RNA were treated with diethylpyrocarbonate and autoclaved before use. All restriction endonucleases and DNA-modifying enzymes were from New England Biolabs or Promega (Madison, WI). PCR reagents were from Perkin Elmer. ³²P-labeled nucleotides were from Amersham. Escherichia coli strain DH5α (Life Technologies) was maintained as frozen stocks, and grown on Luria-Bertani plates.

Molecular Cloning

As described above, the object of this study was to clone and characterize a cDNA encoding the apical Na⁺/H⁺ exchanger of LLC-PK₁ cells. For three reasons, this seemed likely to be the NHE3 isoform. First, measurements on differentiated LLC-PK₁/Cl₄ epithelia have given IC₅₀ values for the inhibition of apical Na⁺/H⁺ exchange by EIPA (10 to 13 μM) that agree well with published values for NHE3 (17). Second, NHE3 protein has been detected on the brush border of the proximal tubule in immunolocalization studies in rabbit (18) and rat kidney (19), and LLC-PK₁ cells are thought to be of proximal tubular origin (23). Third, immunoblots of LLC-PK₁ luminal membranes with polyclonal antisera directed against cytoplasmic epitopes of rat NHE3 labeled 90- and 95-kD proteins consistent with NHE3 (32).

On the basis of these findings, unique oligonucleotides were designed to amplify NHE3 cDNA from LLC-PK₁ cells by means of the PCR. Poly(A)⁺ RNA was isolated from the PKE20 line of LLC-PK₁ cells, which displays a three- to fivefold elevated activity of the apical exchanger (24), and was subjected to RT-PCR with oligonucleotides based on the sequence of rabbit NHE3 cDNA (4). For the initial RT-PCR, oligonucleotides corresponding to the putative cytoplasmic domain were used. To clone cDNA encoding the membrane-associated region, two additional RT-PCR reactions were performed. For each of these PCR, one oligonucleotide was derived from the LLC-PK₁ sequence that had already been obtained, while the other was a degenerate oligonucleotide based on the previously reported rabbit and rat NHE3 sequences (4,5). 5′ RACE was then carried out in an attempt to amplify a cDNA that contained the first 120 nucleotides of the coding region. This resulted in the identification of a product whose 5′ end began at nucleotide 21 of the coding region.

Several additional attempts to clone the first 20 nucleotides of the coding region with 5′ RACE were unsuccessful due to the extraordinarily high GC content of this portion of the gene (>80%). For this reason, the remainder of the coding region was obtained by screening a commercially available porcine genomic library in the bacteriophage EMBL3 SP6/T7 (Clontech Laboratories) using the RACE product as probe. Where the five DNA fragments overlapped, their sequences were identical, consistent with the notion that they originated from the same transcript. Overlapping sequence was obtained for both strands of all fragments. Taken together, the four clones spanned nucleotides -116 to 2496, numbered according to the rabbit sequence (4). The DNA sequence of the coding region of the LLC-PK₁ Na⁺/H⁺ exchanger was highly conserved when compared to rabbit and rat, with 90 and 87% nucleotide identity in the membrane-associated domain, and 84 and 82% identity in the cytoplasmic domain. The deduced amino acid sequence was also highly conserved compared to rabbit and rat, with 89% identity in the membrane-associated domain, and 81 and 84% identity in the cytoplasmic domain. A comparison of the deduced amino acid sequence of the porcine and rabbit exchangers is shown in Figure 1. The single, long open reading frame is predicted to encode a protein of 846 amino acids. Phylogenetic tree reconstruction confirms that this gene is a member of the NHE3 subfamily (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Deduced amino acid sequence comparison of porcine and rabbit NHE3. Deduced amino acids are indicated by their single letter codes and are numbered to the right.

Expression of an NHE3 Transcript in Pig Kidney and LLC-PK₁ Cells

To determine the size of the NHE3 transcript, Northern analysis was performed. A 1085-nt cDNA (nt 1369 to 2496) encoding most of the cytoplasmic domain of NHE3 was chosen as the probe since there is a relatively low degree of nucleotide identity (25 to 31%) between members of the NHE gene family in this region. Poly(A)⁺ RNA from pig kidney cortex, as well as confluent LLC-PK₁/Cl₄ and PKE20 cells, was hybridized to the cDNA probe and washed at high stringency. As shown in Figure 2A, a transcript of 6.5 kb was detected in pig kidney cortex. In PKE20 cells, a major transcript of 6.5 kb and a minor transcript of 4.4 kb were detected after a 1-d exposure (Figure 2B, lane 1), whereas in LLC-PK₁/Cl₄ (lane 2) a 6-d exposure was required to detect the same two transcripts. In addition, the relative abundance of the two NHE3-related transcripts was different in the two cell lines. The 6.5-kb transcript predominated in PKE20, whereas the 6.5- and 4.4-kb transcripts were present in similar amounts in LLC-PK₁/Cl₄. The relative abundance of the NHE3-related transcripts in LLC-PK₁/Cl₄ and PKE20 could not be quantified due to the much longer exposure required to visualize the transcript in LLC-PK₁/Cl₄. It appeared, however, that transcript levels were increased much more than the three- to fivefold increase in apical amiloride-resistant Na⁺/H⁺ exchange activity. An actin probe was used to verify that an equal amount of poly(A)⁺ RNA was loaded into each lane.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2.

Northern analysis. (A) Pig kidney cortex. Poly(A)⁺ RNA isolated from pig kidney cortex was probed with an NHE3 cDNA as described in Materials and Methods. The sizes of the RNA markers are shown on the left. (B) LLC-PK₁/Cl₄ and PKE20. Poly(A)⁺ RNA from PKE20 (lane 1) and LLC-PK₁/Cl₄ (lane 2) was analyzed by Northern analysis as in Panel A.

Genomic Analysis of LLC-PK₁/Cl₄ and PKE20

Given the marked increase in NHE3 transcript levels between PKE20 and LLC-PK₁/Cl₄, genomic Southern analysis was carried out to determine whether the NHE3 gene had undergone duplication during the selection process that was used to isolate PKE20 (acid-loading in the presence of EIPA). Although apical amiloride-resistant Na⁺/H⁺ exchange activity in PKE20 is increased three- to fivefold, basolateral Na⁺/H⁺ exchange activity, which has been shown to be the result of NHE1 expression (25), is the same as in LLC-PK₁/Cl₄. Genomic DNA was isolated from both cell lines, restricted with EcoRI, size-fractionated by agarose gel electrophoresis, and transferred to a nylon membrane. Southern analysis performed with an NHE3-specific probe detected a 9.3-kb band (Figure 3). There was a slight increase in the intensity of hybridization to PKE20 DNA (Figure 3, lane 2) compared with LLC-PK₁/Cl₄ (Figure 3, lane 1). To quantify this difference, the autoradiograph was scanned and densitometric analysis was performed using NIH Image 1.61. There was a 20% increase in optical density in PKE20 compared with LLC-PK₁/Cl₄.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3.

Genomic Southern analysis. EcoRI-restricted genomic DNA from LLC-PK₁/Cl₄ (lane 1) and PKE20 (lane 2) was analyzed by Southern analysis as described in Materials and Methods. DNA size markers are shown to the left.

Antibody Generation and Western Analysis

To further demonstrate that the cloned cDNA encoded NHE3, polyclonal antisera were generated against a fusion protein that contained a portion of the porcine NHE3 cytoplasmic domain fused to the maltose-binding protein. The specificity of the affinity-purified antisera for NHE3 was assessed by Western analysis. Plasma membranes were isolated from mouse fibroblasts devoid of endogenous Na⁺/H⁺ exchange activity that were transfected with either full-length rabbit NHE1, -2, -3, or -4 cDNA. As can be seen in Figure 4A, the affinity-purified antisera identified a protein in fibroblasts transfected only with NHE3 (lane 3), and not in those transfected with NHE1, -2, or -4 (lanes 1, 2, and 4). Plasma membranes from rabbit kidney cortex served as a positive control (lane 5). We next investigated whether the marked increase in NHE3 transcript that was detected in PKE20 compared with LLC-PK₁/Cl₄ was reflected by a similar increase in the transcribed protein. Western analysis was then carried out on plasma membranes isolated from PKE20 and LLC-PK₁/Cl₄ (Figure 4B). Equal amounts of protein (100 μg) were loaded in each lane as determined by Lowry assay, and verified by Coomassie staining of duplicate aliquots (data not shown). An 87-kD protein was detected in both cell lines, and more of the protein was detected in PKE20 (lane 2) compared with LLC-PK₁/Cl₄ (lane 1). Densitometric analysis was again performed using NIH Image 1.61, and a 2.5-fold increase in NHE3 was noted in PKE20. The polyclonal antibody has not worked in immunofluorescence studies under conditions tested to date.

• Download figure
• Open in new tab
• Download powerpoint

Figure 4.

Western analysis. (A) Membrane fractions isolated from LAP1 cells transfected with NHE1 (lane 1), NHE2 (lane 2), NHE3 (lane 3), NHE4 (lane 4), and rabbit kidney cortex (lane 5) were Western blotted with a polyclonal antibody directed against a portion of the cytoplasmic domain of porcine NHE3. (B) Membrane fractions isolated from LLC-PK₁/Cl₄ (lane 1) and PKE20 (lane 2) were Western blotted as in panel A.

In Situ Hybridization and Immunohistochemical Studies

Regional expression of the NHE3 transcript was studied in pig kidney by means of in situ hybridization. Sense and antisense riboprobes were prepared from two partial-length LLC-PK₁ NHE3 cDNA. The first (nt 1369 to 2496) encoded the predicted cytoplasmic domain, and the second (nt 765 to 1616) encoded a portion of the membrane-associated domain. Labeling was identical for both antisense probes. Therefore, results from only the first cRNA probe are shown. There was an excellent signal-to-background ratio and an absence of non-specific staining when an adequate time for signal development was used (15 to 20 h for enzyme-substrate reaction). Negative controls using sense cRNA probes showed no staining (data not shown).

The antisense NHE3 cRNA probe primarily labeled the distal convoluted tubule. A transition between a thick ascending limb (marked by the letter T) and the distal convoluted tubule (marked by the letter D) is illustrated in Figure 5. The macula densa is shown between the arrowheads. Although only the distal convoluted tubule is labeled in this section, faint labeling was often observed in the thick ascending limb in other sections (data not shown). Labeling was of sufficient intensity to allow further examination of the proximal and distal extent of the distal tubular expression of NHE3. Low-power microscopy of double labeling with an antibody directed against Tamm-Horsfall protein (Figure 6A), and NHE3 in situ hybridization (Figure 6B) indicated that there was no overlap between the two labels. A transition between thick ascending limb and distal convoluted tubule is shown on the right side of the figure, where one portion of the tubular lumen is stained by the anti-Tamm-Horsfall antibody and the other portion by the NHE3 riboprobe. Low-power microscopy of double labeling with an antibody to the Na⁺/Ca²⁺ exchanger a marker for the connecting tubule (30) (Figure 7A), and NHE3 in situ hybridization (Figure 7B) showed no overlap between the two labels. NHE3 staining was visualized in the distal convoluted tubule but not in the connecting tubule.

• Download figure
• Open in new tab
• Download powerpoint

Figure 5.

In situ hybridization with an NHE3 riboprobe. Labeling is seen in a subpopulation of tubules in the cortex. A transition is shown between the cortical thick ascending limb (T) and the distal convoluted tubule (D). The macula densa is shown between the arrows. Magnification, ×360.

• Download figure
• Open in new tab
• Download powerpoint

Figure 6.

Double labeling with an antibody directed against Tamm-Horsfall protein. (A) Staining with an anti-Tamm-Horsfall antibody. (B) In situ hybridization with an NHE3 riboprobe. A distal nephron profile shows NHE3 mRNA along half of a sectioned transition between the cortical thick ascending limb and the distal convoluted tubule (line). Magnification, ×330.

• Download figure
• Open in new tab
• Download powerpoint

Figure 7.

Double labeling with an antibody directed against the Na⁺/Ca²⁺ exchanger. (A) Staining with an anti-Na⁺/Ca²⁺ exchanger antibody. (B) In situ hybridization with an NHE3 riboprobe. There is no overlap between NHE3 mRNA-positive and Na⁺/Ca²⁺ exchanger-immunoreactive segments. Magnification, ×330.