Immunology and Pathology

Induction of Metalloproteinases by Glomerular Mesangial Cells Stimulated by Proteins of the Extracellular Matrix

JOHN MARTIN, LISA EYNSTONE, MALCOLM DAVIES and ROBERT STEADMAN
JASN January 2001, 12 (1) 88-96;

Abstract

Abstract. Human glomerular mesangial cells (HMC) are embedded in the mesangial matrix (MM) and control its turnover through a dynamic equilibrium between synthesis and degradation. Degradation is controlled by matrix metalloproteinases (MMP), whose activity has been causally implicated in the progression of glomerular disease. In other systems, MMP secretion may be directly affected by exposure to specific matrix proteins. The present study, therefore, investigated the effect of different matrix components on the adherence of HMC and on their secretion and activation of the gelatinases MMP2 and MMP9. HMC adhered strongly (quantified using crystal violet staining) to collagen IV and collagen I (P < 0.01, relative to binding to control, bovine serum albumin (BSA)-coated wells) and to a lesser extent to gelatin IV and fibronectin (P < 0.05). Binding to vitronectin and laminin was not statistically different to control wells. After the addition of these matrix proteins (0.1 μg/ml to 100 μg/ml) to growth-arrested HMC for 72 h, zymography of the conditioned medium established that only fibronectin and collagens I and IV dose-dependently increased latent (72 kD) MMP2 secretion and activation. Fibronectin, however, also induced the secretion of MMP9. Membranes from HMC that had been co-cultured with fibronectin for 72 h were prepared to investigate whether the activation of MMP2 in this system was due to the action of membrane-type (MT)-MMP. When incubated with latent MMP2 for times up to 24 h, these membranes activated the enzyme in a time- and dose-dependent manner. The results demonstrate that specific matrix components increased the secretion of MMP2 and MMP9 from HMC. In addition, MT-MMP activity, selectively induced by fibronectin, was implicated in the activation of the secreted proteinases.

The normal function of the renal glomerulus depends on the integrity of the glomerular basement membrane (GBM) and of the extracellular matrix (ECM) of the mesangium. These matrices, however, are dynamic structures that are subject to continuous turnover. This turnover is the result of a tightly controlled equilibrium between the synthesis of new matrix constituents and the degradation and removal of old. In renal disease, this balance may be lost with an inappropriate swing toward either matrix degradation or matrix accumulation. In several studies, changes in the amount and composition of matrix have been linked to profound effects on the normal function of cells (1,2). Thus, an understanding of the mechanisms that determine the amount and composition of the glomerular ECM is of paramount importance to understanding normal glomerular function and the consequences of pathologic changes.

The principal enzymes implicated in the remodeling of ECM are the matrix metalloproteinases (MMP), a group of enzymes that, together, are able to degrade all of the constituents of the ECM. Metalloproteinase production by glomerular cells is now well documented (3,4,5). In particular, human glomerular mesangial cells (HMC) can secrete MMP2 and MMP9, gelatinases that degrade the major constituent of the GBM type IV collagen. These enzymes are zinc-dependent proteinases that are active in the neutral pH of the extracellular environment, and their final activity is carefully controlled at several levels: by the regulation of transcription, the rate of secretion, and the activation of the enzymes. The MMP are secreted as a proenzyme or latent form, and the activation of these enzymes is due to the proteolytic removal of the propeptide exposing the active site (6). The activation of MMP2 seems to be through a different mechanism to that described for the other secreted MMP, and it now seems that the newly described membrane type metalloproteinases, the MT-MMP, are involved in the activation of this enzyme (7). In addition, the active enzymes can be inhibited on a one-to-one basis by their specific inhibitors, the tissue inhibitors of metalloproteinases (TIMP) of which TIMP I and TIMP II are the best described. Thus, the modification of MMP activity at any one of these steps can affect the turnover of the glomerular matrix.

The regulation of the rate of secretion of these enzymes by cytokines has received a great deal of attention (8,9,10). Less well understood, however, is the effect that matrix itself may have on the degree and kinetics of its own turnover through the control of MMP activity. Changes in the status and composition of the ECM have been shown to affect the function of a variety of different cells and to modulate the synthesis and release of MMP in other systems (11,12,13,14). Thus, any change in the composition of the mesangial matrix or in the degradation of the constituent proteins that cause the release of soluble protein fragments would be expected to have profound effects on the normal activity of these HMC. This study examines the interaction of HMC with matrix proteins and determines the effect of these proteins on the secretion and activation of the MMP.

Materials and Methods

Tissue culture media and supplements were obtained from Sera Lab/JRH Biosciences Ltd. (Crawley, UK) or ICN Biomedical (Basingstoke, Hampshire, UK), and Sigma Chemical Company (Poole, Dorset, UK). Tissue culture plastics were purchased from Falcon; Becton Dickinson (Oxford, UK). Type I collagen was prepared from rat tail tendon as described (15) and denatured at 60°C for 30 min to provide gelatin 1. Collagen IV, fibronectin, vitronectin, and laminin were of tissue culture grade and were purchased from Sigma. Gelatin IV was prepared from denatured collagen IV as above. The purity of all of the matrix proteins used in this study was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Electrophoresis reagents were purchased from Bio-Rad Laboratories Ltd. (Hemel Hempstead, Herts, UK). All other chemicals were of the highest quality available.

Cell Culture and Identification

Human glomeruli were obtained by the serial sieving of the normal regions of human kidney recovered at nephrectomy. HMC were maintained in RPMI-1640 containing 20% vol/vol fetal calf serum (FCS). Cells in low passage number (between passages 1 and 5) were used in all experiments. Before experimental procedures, HMC were growth-arrested for 48 h by culture in medium containing 0.2% (wt/vol) lactalbumin hydrolysate (Difco Laboratories, Detroit, MI) in the absence of serum (4). The cells were confirmed to be mesangial cells by morphology and the use of immunohistochemistry as described (9). Cells showed positive staining for intracellular myosin fibrils and were negative for factor VIII and cytokeratin. The effect of all subsequent treatments on cell viability was assessed by 3-[4,5-dimethylthiazole-2-yl]-2,4 diphenyltatrazolium bromide assay (10).

Cell Adhesion to Defined ECM Proteins

Ninety-six-well plates were precoated with the following matrix proteins overnight at 4°C: collagen IV, gelatin IV, collagen 1, gelatin I, fibronectin, vitronectin, and laminin (10 μg/ml in phosphate-buffered saline [PBS]). Then they were washed with PBS and blocked with PBS/BSA (1 mg/ml) before use. Controls consisted of wells treated with BSA (1 mg/ml) in PBS. HMC were removed from confluent cultures by the use of ethylenediaminetetraacetate (EDTA; 2 mM in PBS) alone, washed in RPMI, added to the wells at a concentration of up to 6 × 104/ml in RPMI BSA (1 mg/ml), and allowed to adhere for 1 h at 37°C in an atmosphere of 5% CO2. Nonadhered cells were removed by washing with PBS containing 2 mM MgCl2. Adhered cells were fixed with paraformaldehyde (3% vol/vol) for 15 min and stained with a solution of crystal violet (0.5% wt/vol) for 3 min. The cells were then washed with PBS, dried, and solubilized with SDS (1% wt/vol), and the absorbance at 540 nm was determined on a Dynatech MR5000 platereader (Billinghurst, UK).

Determination of Gelatinolytic Activity

To determine the effect of matrix proteins on the secretion of gelatinolytic activity by the cells, we growth-arrested confluent wells of mesangial cells by culture for 48 h in serum-free medium supplemented with 0.2% (wt/vol) lactalbumin hydrolysate. Extracellular matrix proteins (10 μg/ml) were added in solution in the above medium, and the incubation was continued for an additional 72 h. The conditioned medium (CM) was then collected and subjected to zymography. Gelatinolytic activity was determined by subjecting a sample of CM to SDS-PAGE using either a 7.5% gel or a 5 to 12% gradient gel, incorporating gelatin (1 mg/ml) under nonreducing conditions, as described previously (4). To determine net gelatinolytic activity (not inhibited by TIMP) in the supernatants, we assayed samples of CM for their potential to degrade 14C-labeled gelatin as described previously (4,5).

Purification of Latent MMP2

Gelatinolytic activity was semipurified by passing the CM containing latent MMP2 down a gelatin agarose affinity column (Sigma), equilibrated with 50 mM Tris (pH 7.4), containing 0.5 M NaCl, 0.05% Brij wt/vol, and 10 mM EDTA, and then washed in the same buffer. Activity was eluted with 50 mM Tris, containing 1 M NaCl 0.05% (vol/vol) Brij, 10 mM EDTA, and 5% dimethyl sulfoxide (vol/vol). The enzyme was then dialysed into 50 mM Tris (pH 7.4), 0.5M NaCl, 0.05% Brij, 5 mM CaCl2, and stored at -20°C until use.

Detection of Cell-Associated MT1-MMP Protein

HMC were lysed in SDS-PAGE sample buffer, and whole-cell lysates were separated on 7.5% SDS-PAGE gels. After electrophoretic transfer to nitrocellulose and blocking in 5% skimmed milk in PBS, 0.5% Tween 20, the blots were incubated with 10 μg/ml anti-MT1-MMP antibody (TCS Biologicals Ltd., Bodolph Claydon, UK) in PBS, 0.5% Tween 20, 1% BSA overnight. Primary antibody binding was visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech UK, Ltd., Little Chalfont, UK).

Preparation of Mesangial Cell Membranes

HMC were scraped off flasks and pelleted by centrifugation in PBS containing a cocktail of proteinase inhibitors (pepstatin A, aprotinin and leupeptin at 10 μg/ml, phenylmethylsulfonyl fluoride at 0.5 μM; Sigma). Cells were resuspended in hypotonic buffer (10 mM Tris [pH 7.2] containing 1 mM MgCl2 plus proteinase inhibitor cocktail), mixed with 4 volumes of sucrose buffer (0.25 M sucrose dissolved in hypotonic buffer) and homogenized in this buffer using a Dounce pestle.

The homogenate was centrifuged at 500 × g for 5 min to remove debris. A membrane-enriched fragment was prepared by centrifuging the supernatant at 25,000 × g for 30 min at 4°C, and the resulting pellet was resuspended in PBS containing 1 mM phenylmethylsulfonyl fluoride. The protein content of the membrane samples was determined by the method of Bradford (16). Membranes were stored at -70°C until use.

To determine the activating properties of the membrane preparations, latent MMP2 was added to membrane fractions (10 μg protein) and the mixture was incubated for 24 h at 37°C. The degree of MMP activation was then determined by gelatin zymography as described.

Reverse Transcription-PCR

Confluent wells of mesangial cells were growth-arrested as described and cultured in the presence of fibronectin for an additional 6 h. Total RNA was extracted using RNA Isolator (Genosys Ltd., Cambridge, UK) according to the manufacturer's instructions. cDNA was prepared by the reverse transcription of 1 μg of RNA using random primers, and the equivalent of 0.05 μg was amplified by PCR using the following primers specific for MT1-MMP, MT2-MMP, MT3-MMP, and α actin (Genosys Ltd., Cambridge, UK):

  • MMP2

  • 5′ TTTTCTCGAATCCATGATGG 3′

  • 5′ CTGGTGCAGCTCTCATATTT 3′

  • MMP9

  • 5′ AGACCTGAGAACCAATCTCAC 3′

  • 5′ GGCACTGAGGAATGATCTAA 3′

  • MT1-MMP

  • 5′ GCGCCCCCGATGTGGTGTTC 3′

  • 5′ TGCCCCGGCGGTCATCATC 3′

  • MT2-MMP

  • 5′ GCCCCCACACCGCTCTATTC 3′

  • 5′ CCGACGTCCTCCCACCAA 3′

  • MT3-MMP

  • 5′ TATTCGCCGTGCCTTTGATGT 3′

  • 5′ TGGGGGCACTGTCGGTAGAG 3′

  • α actin

  • 5′ GGAGCAATGATCTTGATCTT 3′

  • 5′ CCTTCCTGGGCATGGAGTCCT 3′

  • β actin

  • 5′ CTGGGCCATTCTCCTTAG 3′

  • 5′ ATCCCCCAAAGTTCACAA 3′

Northern Blot Analysis

Total RNA (up to 10 μg) was run on a denaturing agarose gel and transferred by vacuum blotting onto a Hybond nylon membrane (Amersham). mRNA for MT-MMP was detected by hybridization with a 32P-labeled probe prepared from PCR products and detected as described previously (9).

Analysis of TIMP I and TIMP II

TIMP I and TIMP II were measured by enzyme-linked immunosorbent assay on suitably diluted samples using reagents generously supplied by Dr. A. J. P. Docherty (Celltech Ltd., Slough, UK) essentially as described previously (10,17). Standards of TIMP I and TIMP II were prepared using purified TIMP kindly supplied by Prof. T. E. Cawston (Department of Medicine [Rheumatology], University of Newcastle, UK) in the range of 0.15 to 150 ng/ml for TIMP 1 and in the range of 0.15 to 300 ng/ml for TIMP II.

Statistical Analyses

Results are expressed as mean ± SEM of n experiments. All data were analyzed using the Wilcoxon signed rank test.

Results

HMC Binding to Matrix Proteins

After seeding in the wells of 96-well plates, which had been precoated with individual matrix proteins, there was significantly increased HMC adherence to collagens I and IV (P < 0.01) and to denatured type IV collagen (gelatin IV) and fibronectin (P < 0.05; Figure 1). Cells also bound to vitronectin, laminin, and denatured collagen I, but the number bound was not significantly increased above control.

Figure 1.
Figure 1.

Adherence of human glomerular mesangial cells (HMC) to matrix proteins. HMC (6 × 104/ml) were added to the precoated wells of 96-well plates and allowed to adhere for 60 min. Adhered cells were stained with crystal violet, and the degree of staining (A540 nm) was compared with that of cells added to wells treated only with bovine serum albumin (BSA). The results are expressed as the percentage adhered relative to BSA-coated wells and are the mean ± SEM of 12 experiments using cells derived from different kidneys. **, P < 0.001; *, P < 0.05.

Matrix Protein Stimulation of MMP Release

The addition of soluble matrix proteins to HMC resulted in the selective modulation of MMP release, detected by zymography. This release, however, was not directly associated with the degree of HMC binding that each protein supported. Figure 2 demonstrates that of the matrix proteins added, collagen I and fibronectin stimulated an increase in the amount of latent MMP2 present in the CM, and, in a similar manner to collagen IV, they also induced its conversion to a lower molecular weight band (66 kD) on the zymogram. In addition, fibronectin induced the secretion and activation of MMP9 seen as bands of lysis at 92 and 95 kD. The effect of fibronectin was dose-dependent with maximal activation of MMP2 and induction of MMP9 occurring above 10 μg/ml (Figure 3). The increase in MMP protein levels was paralleled by an increase in the mRNA (as shown by reverse transcription-PCR [RT-PCR]) for MMP2 and the induction of the mRNA for MMP9 (data not shown). This effect was mimicked by incubation with anti-CD49e monoclonal antibody specific for the α5 integrin chain (Immunotech, Birmingham, UK; Figure 4), suggesting that the response to fibronectin was mediated through this integrin.

Figure 2.
Figure 2.

Stimulation of matrix metalloproteinase (MMP) release by matrix proteins. Proteins (10 μg/ml) were added to growth-arrested HMC and incubated for 72 h, after which the culture medium was analyzed by zymography. Lane 1, control; lane 2, laminin; lane 3, vitronectin; lane 4, collagen 1; lane 5, collagen IV; lane 6, fibronectin; and lane 7, positive control (latent and active MMP2). Results are representative of five separate experiments.

Figure 3.
Figure 3.

Stimulation of MMP release by fibronectin. Increasing doses of fibronectin were added to growth-arrested HMC and the incubation was continued for an additional 72 h, after which the conditioned medium (CM) was subjected to zymography. Results are representative of four separate experiments.

Figure 4.
Figure 4.

Stimulation of MMP release by anti-α5 integrin antibody. HMC were incubated for 72 h with fibronectin (10 μg/ml [lane 2] or 100 μg/ml [lane 3]) or anti-α5 integrin antibody (0.4 μg/ml [lane 4], 2 μg/ml [lane 5], or 4 μg/ml [lane 6]) or were left untreated (lane 1). Positive control (latent and active MMP2) is shown in lane 7. Results are representative of three separate experiments.

Changes in the amount of MMP detected were not related to changes in proliferation, and there was no difference in cell number in response to co-culture with any of the ECM proteins under the conditions used (data not shown). Furthermore, analysis (Cytosets Antibody Pair kits, Biosource International, Nivelle, Belgium) of the CM from stimulated HMC demonstrated that there were no detectable levels of cytokines previously described as potential promoters of MMP secretion (interleukin-6 [IL-6] and IL-8 below 15 pg/ml, IL-1β and tumor necrosis factor-α below 10 pg/ml, transforming growth factor-β below 5 pg/ml; data not shown).

MMP Activation by HMC

MMP2 is now believed to be activated in vivo by the action of the membrane bound metalloproteinases, the MT-MMP. To determine whether this might be occurring in this instance, we incubated latent MMP2 with cell membranes isolated from HMC cultured with different concentrations of fibronectin. HMC membranes were shown to activate latent MMP2, and this activity was markedly increased in the membranes of cells that had been incubated in the presence of fibronectin or FCS (Figure 5). This effect was dose-dependent and became apparent at 10 μg/ml fibronectin (Figure 6).

Figure 5.
Figure 5.

HMC membranes activate latent MMP2. Purified latent MMP2 was incubated for 24 h with membrane preparations from HMC previously incubated with control medium (lane 1), fibronectin (10 μg/ml, lane 2) or 10% FCS (lane 3). Lane 4 shows the activation of MMP2 by p amino phenyl mercuric acetate (1 mM).

Figure 6.
Figure 6.

Fibronectin increases the MMP-activating potential of HMC membranes. Purified latent MMP2 was incubated for 24 h with membranes prepared from HMC that had been incubated with increasing concentrations of fibronectin.

To ascertain whether this result could be due to an increase in the amount of the MT-MMP synthesized by the HMC, we examined the levels of mRNA for MT1-MMP, MT2-MMP, and MT3-MMP relative to actin by RT-PCR (Figure 7) and Northern blotting (Figure 8). The mRNA for all three MT-MMP was detected in HMC. There was, however, no increase in the levels of mRNA. Densitometric analysis of these figures confirmed that there was no increase in the amount of mRNA for these MT-MMP relative to actin, confirming that there was no increased expression of these potential MMP2 activators. Analysis of whole-cell lysates by SDS-PAGE and immunoblotting, however, demonstrated an increase in the ratio of the lower molecular weight form of MT1-MMP over the larger form with increasing concentrations of fibronectin (Figure 9).

Figure 7.
Figure 7.

The effect of fibronectin on membrane-type (MT)-MMP mRNA levels. Fibronectin (10 μg/ml) was added to growth-arrested HMC and incubated for up to 12 h. The RNA was extracted, and reverse transcription-PCR (RT-PCR) was carried out using primers specific for MT1-MMP (A), MT2-MMP (B), and MT3-MMP (C). Actin was used as the housekeeping gene, and the PCR products were separated on 2% agarose gels.

Figure 8.
Figure 8.

The effect of fibronectin on MT-MMP mRNA levels. Northern blot analysis of MT-MMP mRNA. Total RNA from unstimulated HMC (control) or from HMC incubated with collagen IV or fibronectin (10 μg/ml) was subjected to electrophoresis on a 1% agarose gel, transblotted onto Nylon (Hybond N+, Amersham), and probed with radiolabeled probes specific for actin and for MT1-MMP (A), MT2-MMP (B), and MT3-MMP (C).

Figure 9.
Figure 9.

The effect of fibronectin on MT1-MMP protein. Total protein from whole-cell lysates of HMC treated with 0 (control), 1, 10, or 100 μg/ml of fibronectin for 72 h was separated on a 7.5% SDS-PAGE. The MT1-MMP was visualized by immunoblotting, and the ratio of active to latent bands was determined by densitometry. Results shown are representative of four separate experiments.

Effect of Exogenous Fibronectin Added to HMC on TIMP Release

The consequence of the addition of fibronectin to HMC on the secretion of the inhibitors of MMP was examined by enzyme-linked immunosorbent assay. There was no statistically significant effect on the secretion of either TIMP I or TIMP II in response to fibronectin (Figure 10), although there was a trend toward an increase in TIMP II secretion with increasing concentrations of fibronectin in some experiments. Whether this trend reflected a real change in the total gelatinolytic activity released by HMC was investigated in a radiometric assay of net activity in the CM of stimulated cells (4,5). In response to 10 μg/ml fibronectin or 4 μg/ml anti-α5 integrin antibody, however, there was a 1.5-fold increase or a 3.6-fold increase in activity, respectively, over unstimulated cells, suggesting that the observed trends in TIMP II expression were not sufficient to inhibit the increased gelatinolytic activity released from the cells.

Figure 10.
Figure 10.

Percentage of tissue inhibitors of metalloproteinases (TIMP) release compared with control (100%) from HMC incubated with fibronectin. Fibronectin (5 to 100 μg/ml) was added to growth-arrested HMC, and the incubation continued for 72 h. TIMP I (A) and TIMP II (B) were then measured in the CM by enzyme-linked immunosorbent assay. The results shown are the mean + SEM of four separate experiments.

Discussion

The present study demonstrates that HMC bound specifically to several of the matrix proteins found in the glomerular ECM and to others not normally present. There was, however, a rank order to the binding, with collagen I, collagen IV, gelatin IV, and fibronectin supporting the strongest binding. These data concur with those of a previous report describing the attachment of rat MC to matrix substrates (18). As a result of incubating HMC with the same proteins, fibronectin, collagen I, and collagen IV were also found to stimulate the specific secretion and activation of MMP2. The activation was seen as an additional band of lysis below the latent enzyme. In addition, fibronectin stimulated the induction and activation of MMP9, suggesting an activating mechanism selectively induced by the interaction with this matrix protein. Matrix components have previously been shown to influence the phenotype of cultured mesangial cells (1,2,19). These alterations included a change in the synthesis of matrix components when the cells were cultured on different types of ECM (20) and increased proliferation when the cells were cultured in collagen gel matrices (21). By adding the matrix components under investigation to growth-arrested cells in serum-free conditions, we were able to exclude mesangial cell proliferation from contributing to the altered secretion of the metalloproteinases seen in this study.

Activation of MMP2 occurs through a different mechanism to that for the other MMP. The enzyme is activated in vitro by incubation with mercuric salts such as p-amino phenyl mercuric acetate. It has also been reported that MMP2 may be activated by other proteinases, such as plasmin (22), or by oxygen radicals. Recently, another activation mechanism involving MT-MMP has been described. Five MT-MMP have now been described (23,24,25), at least two of which (MT1-MMP and MT2-MMP) are capable of activating latent MMP2. MMP2 is secreted by cells in an inactive form and is activated on the cell surface as part of a complex involving the MT-MMP and TIMP II. It is now accepted that the MT1-MMP binds to TIMP II and that this complex acts as a receptor for MMP2 by binding to the carboxyl end of the molecule (7,26,27). MT1-MMP then proteolytically cleaves the propeptide of the MMP2, activating the latent enzyme. However, if TIMP II is present in excess, it will function as a specific inhibitor by binding through its N terminal domain. Therefore the presence of TIMP II in the extracellular milieu can serve either to assist in the activation of the gelatinase or to inhibit the active enzyme in a 1:1 manner. Such a role for this inhibitor would seem to ensure that the MMP2 will be active locally but be inhibited before it can degrade matrix proteins more distal from the cell surface. In vivo, other mechanisms may also be involved in MMP activation. For example, urokinase plasminogen activator induces the activation of MT1-MMP in HMC (28). In addition, the activation of MMP9 that was observed after the addition of fibronectin to HMC may be secondary to the production of activated MMP2 as active MMP2 has been demonstrated to activate the latent MMP9 in vitro (29) and this enzyme is known to have a different activation mechanism to MMP2.

In the present study, membrane-associated activity, selectively induced by fibronectin, was implicated in the activation of the secreted MMP2. There was, however, no increase detected in the level of mRNA coding for MT1-MMP, MT2-MMP, or MT3-MMP either by RT-PCR or by Northern blots. This finding suggests that the increase in activity seen in the membrane preparation may be due to a modification of the MT-MMP rather than to an increase in the amount produced by the cell. This is further supported by the demonstration that the ratio of the smaller molecular weight (active) form to the larger (latent) form increases with increasing concentrations of fibronectin. This is in agreement with the work of Stanton et al. (30). These workers demonstrated an increase in the activity of MT1-MMP that was paralleled by a decrease in its molecular weight in the absence of any increase in the amount of mRNA present in HT1080 fibrosarcoma cells after their culture on fibronectin. Only a slight increase in total MT1-MMP protein production was seen, whereas there was a marked increase in the amount of activated MT1-MMP present. Similarly, Preaux et al. (31) recently demonstrated an activation of MMP2 from myofibroblasts cultured on collagen I with no increase in MT1-MMP mRNA. However, Haas et al. (32) demonstrated an increase in the transcription of MT1-MMP by proliferating endothelial cells in a three-dimensional collagen matrix.

There have been other reports of matrix proteins influencing MMP secretion. For example, it has been shown (11,33) that the ligation of the fibronectin receptor induced the gene expression of both collagenase and stromelysin by fibroblasts. This seemed to be mediated through the 120-kD cell binding fragment. In addition, Larjava et al. (34) described how anti-body binding to β3 integrin in human keratinocytes induced the 92-kD gelatinase (MMP9), although there was no effect of the extracellular proteins themselves—possibly because these workers cultured the cells on these substrates rather than adding them in solution to cells in culture. Brooks et al. (35) demonstrated that an anti-integrin αvβ3 antibody was able to block human breast cancer growth possibly through an effect on MMP activity. Furthermore, the use of an antibody to this vitronectin receptor or the addition of vitronectin itself resulted in the increased secretion of MMP2 by a melanoma cell line (12). Later work, however, showed that the ligation of integrin α5β1 seemed to be more important than that of αvβ3 for stimulating MMP2 secretion in a different melanoma cell line (36). The present study demonstrating the induction of MMP by anti-α5 suggests that in HMC, this receptor is responsible for the observed effects of fibronectin, although whether other receptors may also be involved cannot be ruled out.

The variety of responses to matrix binding, mediated by integrins, has been linked to several different signal transduction pathways. For example, binding to β1 integrins induces phospholipase activation in rat glomerular epithelial cells (37), which may modulate proliferation. In addition, Malik and Parsons (38) demonstrated the activation of the p70 ribosomal S6 kinase signaling pathway. Fibronectin binds to the α5 β1 integrin and, in other systems, induces the activity of the AP1 transcription factor (39,40). It is therefore likely that this is one of the mechanisms operating in the present system because MMP9 possesses an AP1 binding site in its promoter (41).

The work described here demonstrates that the interaction of mesangial cells with specific matrix proteins can modulate the pattern of gelatinolytic activity secreted by the cells. Thus, any change in the composition of the matrix in vivo would be expected to result in a change in the proteolytic activity present in the glomerulus. Such a change in matrix organization is often seen accompanying glomerulosclerosis and interstitial nephritis, where it is directly linked with the progression to end-stage disease. This is seen both in animal models (42) and in human renal diseases in which increased amounts of fibronectin are localized to areas of sclerosis within the mesangium (43,44). Thus, it seems that in certain pathogenic situations in which the normal constituents and quantities of the extracellular matrix have been disturbed, there may be a related change in the MMP profile and/or activation that may result either in a resolution of the abnormality or, conceivably, in a progression to further damage. Because the expression of particular integrins and their capacity for binding individual proteins, the intracellular signals generated, and the responses stimulated in the cells all vary between different cell types, it will be important to investigate the detailed integrin-specific mechanisms involved in the current study. An understanding of whether the same mechanisms apply to other glomerular cells, e.g., epithelial cells, will also allow the more detailed investigation of the role of individual cells in disease progression.

References

  1. ↵
    Rupprecht HD, Schocklmann HO, Sterzel RB: Cell-matrix interactions in the glomerular mesangium. Kidney Int49 : 1575-1582,1996
    OpenUrlCrossRefPubMed
  2. ↵
    Schoecklmann HO, Rupprecht HD, Gauer S, Yao J, Sterzel RB: Mesangial cell-matrix interactions in glomerular inflammation. Kidney Blood Press Res 19:184 -190, 1996
    OpenUrlPubMed
  3. ↵
    Davies M, Thomas G, Martin J, Lovett DH: The purification and characterization of a glomerular-basement membrane degrading neutral proteinase from rat mesangial cells. Biochem J251 : 419-425,1988
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Martin J, Davies M, Thomas G, Lovett D: Human mesangial cells secrete a GBM-degrading neutral proteinase and a specific inhibitor. Kidney Int 36:790 -801, 1989
    OpenUrlCrossRefPubMed
  5. ↵
    Knowlden JM, Martin J, Davies M, Williams JD: Metalloproteinase generation by human glomerular epithelial cells. Kidney Int 47:1682 -1689, 1995
    OpenUrlCrossRefPubMed
  6. ↵
    Van Wart HE, Birkedal-Hansen H: The cysteine switch: A principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc Natl Acad Sci USA 87:5578 -5582, 1990
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA, Goldberg GI: Mechanism of cell surface activation of 72-kDa type IV collagenase: Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270:5331 -5338, 1995
    OpenUrlAbstract/FREE Full Text
  8. ↵
    Martin J, Lovett D, Gemsa D, Sterzel R, Davies M: Enhancement of glomerular mesangial cell neutral proteinase secretion by macrophages: Role of interleukin 1. J Immunol 137:525 -529, 1986
    OpenUrlAbstract
  9. ↵
    Martin J, Knowlden J, Davies M, Williams JD: Identification and independent regulation of human mesangial cell metalloproteinases. Kidney Int 46:877 -885, 1994
    OpenUrlCrossRefPubMed
  10. ↵
    Martin J, Steadman R, Knowlden J, Williams JD, Davies M: Differential regulation of matrix metalloproteinases and their inhibitors in human glomerular epithelial cells in vitro. J Am Soc Nephrol 9:1629 -1637, 1998
    OpenUrlAbstract
  11. ↵
    Werb Z, Tremble PM, Behrendtsen O, Crowley E, Damsky CH: Signal transduction through the fibronectin receptor induces collagenase and stromelysin gene expression. J Cell Biol109 : 877-889,1989
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Seftor RE, Seftor EA, Gehlsen KR, Stetler-Stevenson WG, Brown PD, Ruoslahti E, Hendrix MJ: Role of the alpha v beta 3 integrin in human melanoma cell invasion. Proc Natl Acad Sci USA89 : 1557-1561,1992
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Werb Z: ECM and cell surface proteolysis: Regulating cellular ecology [Review]. Cell 91:439 -442, 1997
    OpenUrlCrossRefPubMed
  14. ↵
    Bafetti LM, Young TN, Itoh Y, Stack MS: Intact vitronectin induces matrix metalloproteinase-2 and tissue inhibitor of metalloproteinases-2 expression and enhanced cellular invasion by melanoma cells. J Biol Chem 273:143 -149, 1998
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Cawston TE, Barrett AJ: A rapid and reproducible assay for collagenase using [1- 14C] acetylated collagen. Anal Biochem 99:340 -345, 1979
    OpenUrlCrossRefPubMed
  16. ↵
    Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248 -254, 1976
    OpenUrlCrossRefPubMed
  17. ↵
    Baker T, Tickle S, Wasan H, Docherty A, Isenberg D, Waxman J: Serum metalloproteinases and their inhibitors: Markers for malignant potential. Br J Cancer 70:506 -512, 1994
    OpenUrlCrossRefPubMed
  18. ↵
    Foellmer HG, Perfetto M, Kashgarian M, Sterzel RB: Matrix constituents promote adhesion and proliferation of glomerular mesangial cells in culture [Abstract]. Kidney Int31 : 318,1987
    OpenUrl
  19. ↵
    Yaoita E: Behavior of rat mesangial cells cultured within extracellular matrix. Lab Invest61 : 410-418,1989
    OpenUrlPubMed
  20. ↵
    Sakatsume M, Saito A, Takeda T, Yamazaki H, Narita I, Nishi S, Nakagawa Y, Arakawa M: Mesangial cell-matrix interactions: Modulation of matrix expression in mesangial cells by extracellular matrices. Exp Nephrol 3:362 -368, 1995
    OpenUrlPubMed
  21. ↵
    Kitamura M, Mitarai T, Maruyama N, Nagasawa R, Yoshida H, Sakai O: Mesangial cell behavior in a three-dimensional extracellular matrix. Kidney Int 40:653 -661, 1991
    OpenUrlPubMed
  22. ↵
    Wong AP, Cortez SL, Baricos WH: Role of plasmin and gelatinase in extracellular matrix degradation by cultured rat mesangial cells. Am J Physiol 263:F1112 -F1118, 1992
    OpenUrlPubMed
  23. ↵
    Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M: A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature 370:61 -65, 1994
    OpenUrlCrossRefPubMed
  24. ↵
    Pei D, Weiss SJ: Transmembrane-deletion mutants of the membrane-type matrix metalloproteinase-1 process progelatinase A and express intrinsic matrix-degrading activity. J Biol Chem271 : 9135-9140,1996
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Llano E, Pendas AM, Freije JP, Nakano A, Knauper V, Murphy G, Lopez-Otin C: Identification and characterization of human MT5-MMP, a new membrane-bound activator of progelatinase A overexpressed in brain tumors. Cancer Res 59:2570 -2576, 1999
    OpenUrlAbstract/FREE Full Text
  26. ↵
    Butler GS, Butler MJ, Atkinson SJ, Will H, Tamura T, van Westrum SS, Crabbe T, Clements J, d'Ortho MP, Murphy G: The TIMP2 membrane type 1 metalloproteinase “receptor” regulates the concentration and efficient activation of progelatinase A: A kinetic study. Biol Chem 273:871 -880, 1998
  27. ↵
    Nagase H: Cell surface activation of progelatinase A (proMMP2) and cell migration. Cell Res 8:179 -186, 1998
    OpenUrlCrossRefPubMed
  28. ↵
    Kazes I, Delarue F, Hagege J, Bouzhir-Sima L, Rondeau E, Sraer JD, Nguyen G: Soluble latent membrane-type 1 matrix metallo-protease secreted by human mesangial cells is activated by urokinase. Kidney Int 54:1976 -1984, 1998
    OpenUrlCrossRefPubMed
  29. ↵
    Murphy G, Knauper V: Relating matrix metalloproteinase structure to function: Why the “hemopexin” domain? Matrix Biol 15: 511-518,1997
    OpenUrlCrossRefPubMed
  30. ↵
    Stanton H, Gavrilovic J, Atkinson SJ, d'Ortho MP, Yamada KM, Zardi L, Murphy G: The activation of ProMMP2 (gelatinase A) by HT1080 fibrosarcoma cells is promoted by culture on a fibronectin substrate and is concomitant with an increase in processing of MT1-MMP (MMP-14) to a 45 kDa form. J Cell Sci 111:2789 -2798, 1998
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Preaux AM, Mallat A, Van Nhieu JT, d'Ortho MP, Hembry RM, Mavier P: Matrix metalloproteinase-2 activation in human hepatic fibrosis regulation by cell-matrix interactions. Hepatology30 : 944-950,1999
    OpenUrlCrossRefPubMed
  32. ↵
    Haas TL, Stitelman D, Davis SJ, Apte SS, Madri JA: Egr-1 mediates extracellular matrix-driven transcription of membrane type 1 matrix metalloproteinase in endothelium. J Biol Chem274 : 22679-22685,1999
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Huhtala P, Humphries MJ, McCarthy JB, Tremble PM, Werb Z, Damsky CH: Cooperative signaling by alpha 5 beta 1 and alpha 4 beta 1 integrins regulates metalloproteinase gene expression in fibroblasts adhering to fibronectin. J Cell Biol 129:867 -879, 1995
    OpenUrlAbstract/FREE Full Text
  34. ↵
    Larjava H, Lyons JG, Salo T, Makela M, Koivisto L, Birkedal-Hansen H, Akiyama SK, Yamada KM, Heino J: Anti-integrin antibodies induce type IV collagenase expression in keratinocytes. Cell Physiol157 : 190-200,1993
  35. ↵
    Brooks PC, Stromblad S, Klemke R, Visscher D, Sarkar FH, Cheresh DA: Anti integrin alpha v beta 3 blocks human breast cancer growth and angiogenesis in human skin. Clin Invest96 : 1815-1822,1995
  36. ↵
    Seftor RE, Seftor EA, Stetler-Stevenson WG, Hendrix MJ: The 72 kDa type IV collagenase is modulated via differential expression of alpha v beta 3 and alpha 5 beta 1 integrins during human melanoma cell invasion. Cancer Res 53:3411 -3415, 1993
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Cybulsky AV, Carbonetto S, Cyr MD, McTavish AJ, Huang Q: Extracellular matrix-stimulated phospholipase activation is mediated by beta 1-integrin. Am J Physiol 264:C323 -C332, 1993
    OpenUrlPubMed
  38. ↵
    Malik RK, Parsons JT: Integrin-dependent activation of the p70 ribosomal S6 kinase signaling pathway. J Biol Chem271 : 29785-29791,1996
    OpenUrlAbstract/FREE Full Text
  39. ↵
    Yamada A, Nikaido T, Schlossman SF, Morimoto C: Activation of human CD4 T lymphocytes interaction of fibronectin with VLA-5 receptor on CD4 cells induces the AP-1 transcription factor. J Immunol146 : 53-56,1991
    OpenUrlAbstract
  40. ↵
    Tremble P, Damsky CH, Werb Z: Components of the nuclear signaling cascade that regulate collagenase gene expression in response to integrin-derived signals. Cell Biol129 : 1707-1720,1995
  41. ↵
    Fini ME, Bartlett JD, Matsubara M, Rinehart WB, Mody MK, Girard MT, Rainville M: The rabbit gene for 92-kDa matrix metalloproteinase; Role of AP1 and AP2 in cell type-specific transcription. J Biol Chem 269:28620 -28628, 1994
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Floege J, Johnson RJ, Gorsdon K, Iida H, Pritzl P, Yoshimura A, Cambell C, Alpers CE, Causer WG: Increased synthesis of extracellular matrix in mesangial proliferative nephritis. Kidney Int40 : 477-488,1991
    OpenUrlCrossRefPubMed
  43. ↵
    Pettersson EE, Colvin RB: Cold-insoluble globulin (fibronectin, LETS protein) in normal and diseased human glomeruli: Papainsensitive attachment to normal glomeruli and deposition in crescents. Clin Immunol Immunopathol 11:425 -436, 1978
    OpenUrlCrossRefPubMed
  44. ↵
    Scheinman JI, Fish AJ, Matas AJ, Michael AF: The immunohistopathology of glomerular antigens. II. The glomerular basement membrane, actomyosin, and fibroblast surface antigens in normal, diseased, and transplanted human kidneys. Am J Pathol90 : 71-88,1978
    OpenUrlPubMed
View Abstract
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Induction of Metalloproteinases by Glomerular Mesangial Cells Stimulated by Proteins of the Extracellular Matrix
JOHN MARTIN, LISA EYNSTONE, MALCOLM DAVIES, ROBERT STEADMAN
JASN Jan 2001, 12 (1) 88-96;
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section