CCR2 Signaling Contributes to Ischemia-Reperfusion Injury in Kidney

Chemotaxis Assay

Murine spleen was removed from 7-wk-old ICR mouse (Clea Japan, Tokyo, Japan). Spleen cells were dispersed in PBS and suspended in RPMI 1640 medium (Life Technologies Laboratories, Grand Island, NY) supplemented with 0.5% BSA and 25 mM Hepes pH 7.4. Cells were incubated with the indicated concentrations of RS-504393 for 20 min and then applied to the chemotaxis assay.

Migration of murine spleen cells by murine MCP-1 and macrophage inflammatory protein 1α (MIP-1α) was assayed in a 48-well microchemotaxis chamber (Neuro Probe, Gaithersburg, MD) and 5-μm-pore-size polyvinylpyrrolidone-free polycarbonate filter membranes (Neuro Probe). Twenty-six microliters of the medium (RPMI 1640 medium supplemented with 0.5% BSA, 25 mM HEPES, pH 7.4) containing 1.25 nM murine MCP-1 (R&D Systems, Minneapolis, MN) or MIP-1α were (R&D Systems) added to the lower chamber. The filter membrane was sandwiched between lower and upper chambers, and 50 μl of spleen cell suspension (2 × 10⁶ cells/ml) was added to the upper chamber. After incubation for 2 h, the migrated cells on the filter membrane were fixed, stained with Diff-Quik solution (International Reagents, Kobe, Japan), and counted by microscopic observation in high-power fields (×600).

Animals

Mice deficient in the expression of CCR2 were generated by the process of gene targeting in murine embryonic stem cells (19), and a breeding colony was maintained under specific-pathogen-free conditions. The male CCR2-deficient and wild-type control animals were on an outbred C57BL/6J × 129/Ola genetic background (more than eight generations) and were used at 8 wk of age. All procedures used in the animal experiments complied with the standards set out in the Guidelines for the Care and Use of Laboratory Animals in Takara-machi Campus of Kanazawa University.

Renal Ischemic Model

CCR2-deficient and wild-type mice were anesthetized with diethyl ether and pentobarbital sodium. The flank incision was made, and the renal artery and vein of the left kidney were occluded with a vascular clamp for 60 min. The clamp was then removed, and the organ was allowed to reperfuse. After the clamp was released, the frank incision was closed in two layers with 4-0 silk sutures. The animals received warm saline instilled into the peritoneal cavity during the procedure and were then allowed to recover with free access to food and water. Sham operation was performed in a similar manner, except for clamping the renal vessels. Zero, 4, 24, or 48 h after ischemia-reperfusion, renal tissues from five mice at each time point were removed for pathologic examination. Blood samples were taken from the abdominal aorta at each time point to evaluate renal function. Blood urea nitrogen (BUN) was measured by standard urease assays.

To evaluate the postnatal inhibition of MCP-1/CCR2 signaling, we determined the therapeutic effects of propagermanium and RS-504393. Mice received propagermanium (8 mg/g orally) from 8 d before ischemia until the day the animal was killed. Mice also received RS-504393 (2 mg/kg orally) from the day of ischemia every 12 h until the day the animal was killed. The left kidneys of propagermanium and RS-504393–treated mice were occulted with a vascular clamp for 60 min and killed 4, 24, 48, or 96 h after ischemia-reperfusion for pathologic examination.

Tissue Preparation

One portion of the renal tissue was fixed in 10% buffered formalin followed by embedding in paraffin and staining with hematoxylin and eosin as well as periodic acid–Schiff reagent. Two independent observers with no knowledge of the experimental design evaluated each section. Total glomerular cell numbers were measured at least 50 glomeruli for each mouse and expressed as the number per glomerular cross section. The number of interstitial infiltrated cells was counted in 20 randomly selected high-power fields (×400) of outer medulla. Tubular necrosis was evaluated by determining the percentage of tubules in the outer medulla in which epithelial necrosis or necrotic debris was observed. However, the tubuli with repaired tubular epithelial cells were not approved as the necrotic area. The percentage of area of tubular necrosis in outer medulla of diseased kidney was evaluated by NIH image. A part of each specimen was prefixed with 2.5% glutaraldehyde and postfixed with 4% osmic acid, progressively dehydrated in an alcohol series, embedded in Epok 812, and cut into ultrathin sections. These were double-stained with uranyl acetate and lead citrate and were examined by electron microscopy (Hitachi H-600, Tokyo, Japan).

Immunohistochemical Studies

The other portion of fresh renal tissue, embedded in OCT compound and snap-frozen in n-hexane cooled with a mixture of dry ice and acetone, were cut at 6 μm on a Cryostat (Tissue-Tek systems; Miles, Naperville, IL). The presence of F4/80-positive macrophages and granulocytes was detected immunohistochemically by rat anti-mouse F4/80 monoclonal antibody (clone A3-1; BMA Biomedicals, Augst, Switzerland) or rat anti-mouse granulocyte monoclonal antibody (clone RB6-8C5; Leinco Technologies, MO). The presence of inducible nitric oxide synthetase (iNOS) was detected immunohistochemically by rabbit anti-murine iNOS antibodies (Wako Pure Chemicals Industries, Osaka, Japan). The number of interstitial infiltrated F4/80-positive macrophages, granulocytes, and iNOS-positive cells was counted in 20 randomly selected high-power fields (×400) of outer medulla, where cell migration was maximal. Two observers independently examined the immunohistochemical findings without knowledge of the experimental design.

MCP-1 Expression

The presence of MCP-1 protein was demonstrated immunohistochemically in tissue specimens of ischemia-reperfusion kidney by the indirect avidin-biotinylated peroxidase complex method with goat anti-mouse MCP-1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) as described previously (22). The antigen was retrieved with Target Retrieval Solution (DAKO, Carpinteria, CA). To evaluate the specificity of these antibodies, tissue specimens were stained with the absorbed antibodies with excess amount of the blocking peptide (Santa Cruz Biotechnology). To determine the expression of MCP-1 mRNA, total RNA was extracted from the whole kidneys from five mice in each group. cDNA was reverse-transcripted from 5 μg total RNA and combined from five mice in each group (1 μg RNA per mouse) with SuperScript II RNase H⁻ reverse transcriptase (InVitrogen, San Diego, CA). Reverse transcription was performed by the following parameters: 10 min at 25°C, 30 min at 48°C, and 5 min at 95°C. For all PCR experiments, the LightCycler (Roche Diagnostics, Basel, Switzerland) was used. Subsequently, real-time reverse transcriptase–PCR (RT-PCR) was performed in the LightCycler using the LightCycler-FastStart DNA Master SYBR Green I (Roche Diagnostics). Primers for MCP-1 (forward: 5′-ACTGAAGCCAGCTCTCTCTTCCTC-3′, reverse: 5′-TTCCTTCTTGGGGTCAGCACAGAC-3′) (23) and 2 μl of the cDNA prepared above were used to detect MCP-1. The reactions were incubated at 95°C for 10 min, followed by 40 cycles of 15 s at 95°C, 10 s at 55°C, and 20 s at 72°C. MCP-1 mRNA expression in each sample was finally described as copies/μg·total RNA. The expression of MCP-1 in each sample was quantitated in separate wells. No PCR products were detected in the real-time RT-PCR procedure without reverse transcription, indicating that the contamination of genomic DNA was negligible. Gels of the PCR products after quantification of MCP-1 were negligible. Gels of the PCR products after quantification of MCP-1 by real-time RT-PCR showed a single band (270 bp) with the expected size (data not shown).

Dual Staining

To identify the CCR2-positive cells, we used a dual-labeled color immunofluorescence immunohistochemistry. Briefly, sections were first incubated with goat anti-mouse CCR2 antibodies (clone sc-6228; Santa Cruz Biotechnology) overnight. After rinsing in PBS, the rat anti-mouse F4/80 antibody (clone A3-1; BMA Biomedicals) or rat anti-mouse granulocyte antibody (clone BR6-8C5; Leinco Technologies) was added and the sections incubated overnight. To evaluate the specificity of goat anti-mouse CCR2 antibodies, tissue specimens were stained with the absorbed antibodies with excess amount of CCR2 protein (sc-6228P; Santa Cruz Biotechnology) and goat IgG as a negative control. The CCR2 staining was visualized by incubating the sections for 120 min with FITC-conjugated donkey anti-goat IgG antibodies (1:200; Jackson Immunoresearch Laboratory, West Grove, PA). After rinsing, the sections were incubated for 120 min with Cy3-conjugated donkey anti-rat IgG antibodies (1:200; Jackson Immunoresearch Laboratory) to visualize F4/80 or granulocytes.

Adobe Photoshop software was used for image handling, and the three-color channels were handled separately. Moreover, to evaluate the relation between MCP-1– and F4/80-positive cells, we used a dual-labeled color immunofluorescence immunohistochemistry with rabbit anti-mouse MCP-1 antibodies and rat anti-mouse F4/80 antibody. Briefly, Vectastain ABC-alkaline phosphatase kit (Vector Laboratories, Burlingame, CA) was used to detect MCP-1. Then the slides were blocked by 0.1% sodium azide and 0.3% H₂O₂ in methanol for 15 min. After this process, the Vectastain ABC-peroxidase kit (Vector Laboratories) was used to detect F4/80.

Detection of KC, MIP-2, Epithelial Cell–Derived Neutrophil-Activating Peptide 78, and Neutrophil-Activating Peptide 2 Transcripts in Diseased Kidneys

To determine the renal transcripts of KC, MIP-2, epithelial cell–derived neutrophil-activating peptide 78 (ENA-78), and neutrophil-activating peptide 2 (NAP-2), total RNA was extracted from the whole kidneys from five mice in each group after ischemia-reperfusion to perform RT-PCR. cDNA was reverse transcripted from 5 μg total RNA and combined from five mice in each group (1 μg RNA per a mouse) by using a RT-PCR kit (Takara Shuzo, Tokyo, Japan). The cDNA product was amplified by PCR. Primers for KC (5′ primer TGC ACCCAAACCGAAGTCATAG; 3′ primer GTGGTTGACACTTAGTGGTCTC) (24), MIP-2 (5′ primer GGCACATCAGGTACGATCCAG; 3′ primer ACCCTGCCAAGGGTTGACTTC) (25), ENA-78 (5′ primer CTCAGTCATAGCCGCAACCGAGC; 3′ primer CCGTTCTTTCCACTGCGAGTGC) (26), or NAP-2 (5′ primer GTTGCAGAGGTTGCTTG; 3 ′primer ACATCCCTTCCCCTTTC) (27) were used to detect KC, MIP-2, ENA-78, or NAP-2 transcripts. The housekeeping gene GAPDH was used for PCR controls. Ten microliters of PCR products were run on 2.0% agarose gel and stained with ethidium bromide; then gene-specific bands were visualized under ultraviolet light.

Statistical Analyses

The mean and SEM were calculated on all of the parameters determined in this study. Statistical analyses were performed by Wilcoxon rank-sum test, unpaired t test, Kruskal-Wallis test, and ANOVA. P < 0.05 was accepted as statistically significant.

RS-504393 Inhibited Murine MCP-1–Induced Chemotaxis

The effects of RS-504393 on murine MCP-1–induced chemotaxis were evaluated. Murine MCP-1 induced spleen cell chemotaxis (Figure 1). In contrast, RS-504393 inhibited the MCP-1–induced migration in a dose-dependent manner, with a 50% inhibitory concentration value of 0.8 μM. Even though murine MIP-1α induced spleen cell chemotaxis in the same way as MCP-1, RS-504393 did not inhibit the MIP-1α–induced migration at all.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. RS-504393 inhibited monocyte chemoattractant protein 1 (MCP-1)–induced chemotaxis. Spleen cells were treated with the indicated concentrations of RS-504393 for 20 min and subjected to MCP-1– or macrophage inflammatory protein 1α (MIP-1α)–induced chemotaxis. The number of migrated cells counted in high-power fields was shown. RS-504393 inhibited MCP-1–induced chemotaxis with a 50% inhibitory concentration value of 0.8 μM. However, RS-504393 did not inhibit MIP-1α–induced chemotaxis. Values are mean ± SEM. P < 0.05 versus control.

CCR2 Deficiency Reduced the Extent of Acute Tubular Necrosis and Preserved Renal Function

Marked acute tubular necrosis was observed after ischemia-reperfusion in outer medulla in wild-type mice 4, 24, and 48 h after ischemia-reperfusion (Figure 1, A, C, and E). In contrast, tubular necrosis after ischemia-reperfusion in outer medulla was significantly reduced in CCR2-deficient mice at each time point (Figure 2, B, D, and F). The area of acute tubular necrosis in CCR2-deficient mice was significantly lower than that of wild-type mice (Figure 3A). However, acute tubular necrosis was hardly detected in kidneys of sham-operated mice or normal mice (Figures 2G and 3A⇓). Moreover, the number of interstitial infiltrated cells was also decreased in CCR2-deficient mice at each time point (Figure 3B). We did not detect pathologic changes, including acute tubular necrosis or interstitial cell infiltration, both in CCR2-deficient mice (data not shown) or wild-type mice just after 1 hr of ischemia (Figure 2H). Electron microscopical analyses demonstrated that tubular epithelial cells in sham-operated mice have long microvilli (Figure 2I). After 60 min of ischemia, the greater parts of tubular epithelial cells in the outer medulla were necrotic, and the rest of parts of tubular epithelial cells lost their microvilli in wild-type mice (Figure 2J) and CCR2-deficient mice (data not shown) 24 h after ischemia-reperfusion. In contrast, the renal function preserved in CCR2-deficient mice after ischemia-reperfusion injury. The increase of blood urea nitrogen after ischemia-reperfusion was significantly prevented in CCR2-deficient mice compared with wild-type mice 24 h (sham, 21.1 ± 0.7 mg/dl: CCR2 deficient, 18.5 ± 1.4 mg/dl; wild type, 29.8 ± 1.2 mg/dl, P < 0.001, n = 5, respectively) and 48 h (CCR2 deficient, 24.5 ± 1.2 mg/dl; wild type, 33.6 ± 2.6 mg/dl, P = 0.013, n = 5, respectively) after ischemia- reperfusion.

• Download figure
• Open in new tab
• Download powerpoint

Figure 2. CCR2-deficient mice reduced cell infiltration and acute tubular necrosis in light microscopic and electron microscopic findings. Histopathological examination was performed by periodic acid–Schiff–stained renal tissues. Huge numbers of infiltrated cells and tubular necrosis were mainly observed in outer medulla in left kidney of wild-type mice 4, 24, and 48 h after ischemia-reperfusion (A, C, E). In contrast, the number of infiltrated cells and tubular necrosis decreased in left kidney of CCR2-deficient mice 4, 24, and 48 h after ischemia-reperfusion (B, D, F). (G) Histologic features of sham-operated left kidney. One-hour ischemia did not induce morphologic changes in kidneys of a wild-type mouse (H). Tubular epithelial cells in sham-operated mice have long microvilli (I). After 60 min ischemia, the greater parts of tubular epithelial cells in the outer medulla were necrotic and the rest of parts of tubular epithelial cells lost their microvilli in wild-type mice (J). CCR2 k/o indicates CCR2-deficient mice; wild, wild-type mice. Original magnification, ×200 for light microscopic findings and ×1500 in electron microscopic findings.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3. The number of interstitial cells and the area of acute tubular necrosis in outer medulla were reduced in CCR2-deficient mice and propagermanium- or RS-504393–treated mice. Tubular necrosis was evaluated by determining the percentage of tubules in the outer medulla in which epithelial necrosis or necrotic debris was observed. The area of tubular necrosis in CCR2-deficient mice and propagermanium- or RS-504393–treated mice was significantly smaller than that of wild-type mice 4, 24, and 48 h after ischemia-reperfusion in outer medulla (A). The number of interstitial infiltrated cells was counted in randomly selected high-power fields (×400) of outer medulla. The number of interstitial infiltrated cells significantly decreased in CCR2-deficient mice and propagermanium- or RS-504393–treated mice 4, 24, and 48 h after ischemia-reperfusion (B). Each group contained five mice. CCR2 k/o indicates CCR2-deficient mice; PG, propagermanium-treated mice; RS, RS-504393–treated mice; and wild, wild-type mice. Values are expressed as mean ± SEM.

Interstitial F4/80-Positive Cells Reduced in CCR2-Deficient Mice

Macrophages infiltrated mainly in outer medulla of wild-type mouse kidney 24 and 48 h after ischemia-reperfusion. A significant decrease was observed in the number of interstitial infiltrated F4/80-positive cells in the CCR2-deficient mice 24 and 48 h after ischemia-reperfusion compared with wild-type mice (Figures 2 and 4A⇓). In contrast, there was no significant difference in the number of interstitial infiltrated F4/80-positive macrophages 4 h after ischemia-reperfusion between CCR2-deficient and wild-type mice (Figure 4A). To determine the presence of CCR2 on F4/80-positive cells, a dual-labeled color immunofluorescence immunohistochemistry was used. In wild-type mice, F4/80- (Figure 4B) and CCR2-positive cells (Figure 4D) were detected in ischemia-reperfusion kidney. Most of interstitial infiltrated F4/80-positive cells were also positive for CCR2 in injured kidneys (Figure 4C). CCR2 immunoreactivity was not detected in sections incubated with the absorbed antibodies with excess amount of mouse CCR2 protein (sc-6228P; Santa Cruz Biotechnology) or control goat IgG (Figure 4E), which suggest that this staining was specific to CCR2. In contrast, the cell number in glomeruli did not differ at any time point after ischemia-reperfusion (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

Figure 4. The number of F4/80-positive cells decreased in CCR2-deficient mice. The number of F4/80-positive cells was counted in randomly selected high-power fields (×400) of outer medulla 4, 24, and 48 h after ischemia-reperfusion or sham operation. The number of F4/80-positive cells significantly decreased in CCR2-deficient mice 24 and 48 h after ischemia-reperfusion (A). F4/80-positive cells were visualized with Cy3 and the CCR2 staining with FITC. In wild-type mice, F4/80- (B) and CCR2- (D) positive cells were detected in outer medulla of ischemia-reperfusion kidney 24 h after ischemia-reperfusion. Most of interstitial infiltrated F4/80-positive cells were also positive for CCR2 in injured kidneys (C). CCR2 immunoreactivity was not detected in sections incubated with normal goat IgG (E). Each group contained five mice. CCR2 k/o indicates CCR2-deficient mice; wild, wild-type mice. Values are expressed as mean ± SEM. Original magnification, ×400.

Interstitial iNOS-Positive Cells Were Reduced in CCR2-Deficient Mice

The iNOS-positive cells were detected immunohistochemically in interstitium of ischemia-reperfusion injured kidneys in wild-type and CCR2-deficient mice (Figure 5A). CCR2-deficient mice decreased the number of interstitial iNOS-positive cells 24 and 48 h after ischemia-reperfusion compared with wild-type mice. In contrast, the number of interstitial iNOS-positive cells did not differ between CCR2-deficient and wild-type mice 4 h after ischemia-reperfusion (Figure 5B).

• Download figure
• Open in new tab
• Download powerpoint

Figure 5. The number of inducible nitric oxide synthetase (iNOS)–positive cells decreased in CCR2-deficient mice. The iNOS-positive cells were detected immunohistochemically in interstitium of ischemia-reperfusion injured kidney for both wild-type mice and CCR2-deficient mice. (A) Wild-type mice 48 h after ischemia-reperfusion. The number of iNOS-positive cells was counted in randomly selected high-power fields (×400) of outer medulla 4, 24, and 48 h after ischemia-reperfusion or sham operation. The number of iNOS-positive cells significantly decreased in CCR2-deficient mice 24 and 48 h after ischemia-reperfusion (B). Each group contained five mice. CCR2 k/o indicates CCR2-deficient mice; wild, wild-type mice. Values are expressed as mean ± SEM. Original magnification, ×400.

Reduction of MCP-1 Expression in CCR2-Deficient Mice

To clarify the effect of CCR2 on MCP-1 expression, MCP-1 protein and mRNA in ischemia-reperfusion injury were evaluated. We detected MCP-1 protein in tubular epithelial cells and interstitial infiltrated cells of ischemia-reperfusion injured kidney in wild-type mice 24 h after ischemia-reperfusion (Figure 6A). MCP-1 protein was predominantly expressed in cytosol of tubular epithelial cells. Nevertheless, MCP-1–positive cells were faintly detected in glomeruli of ischemia-reperfusion injured kidney. In CCR2-deficient mice, MCP-1–positive cells were faintly detected in interstitium of ischemia-reperfusion kidneys (Figure 6B). MCP-1 immunoreactivity was not detected in sections incubated with the absorbed antibodies with excess amount of mouse MCP-1 (Figure 6C) or control rabbit IgG (data not shown), which suggests that this staining was specific to MCP-1. Real-time RT-PCR showed that the expression of MCP-1 transcripts in sham-operated left kidneys or contralateral kidneys was low. The expression of MCP-1 significantly increased in diseased kidneys of wild-type mice, which was decreased in CCR2-deficient mice after ischemia-reperfusion (Figure 6D). The correlation of MCP-1 protein and F4/80-positive cells was demonstrated by a dual staining technique in wild-type mice 24 h after ischemia-reperfusion. F4/80-positive cells infiltrated around MCP-1–positive cells in wild-type mice (Figure 6E). Some interstitial infiltrated F4/80-positive cells were MCP-1 positive (Figure 6E).

• Download figure
• Open in new tab
• Download powerpoint

Figure 6. Reduction of monocyte chemoattractant protein 1 (MCP-1) expression in CCR2-deficient mice. The presence of MCP-1 protein was demonstrated immunohistochemically in diseased kidney by the indirect avidin-biotinylated peroxidase complex method. MCP-1–positive cells were detected in tubular epithelial cells (white arrows) and interstitial infiltrated cells (black arrow) in wild-type mice 24 h after ischemia-reperfusion (A). Nevertheless, in CCR2-deficient mice, MCP-1–positive cells were faintly detected in interstitium of ischemia-reperfusion kidneys (B). MCP-1 immunoreactivity was not detected in sections incubated with the absorbed antibodies (C). The expression of MCP-1 mRNA was evaluated with real-time reverse transcriptase–PCR. MCP-1 mRNA expression in each sample was described as copies/μg·total RNA. Ischemia-reperfusion enhanced renal MCP-1 transcripts in diseased kidneys of wild-type mice, which were decreased in CCR2-deficient mice (D). The correlation of MCP-1 protein and F4/80-positive cells was demonstrated by a dual staining technique in wild-type mice 24 h after ischemia-reperfusion. The black arrows indicate F4/80-positive infiltrated cells (brown), and the white arrows indicate dual positive cells for MCP-1 (red) and F4/80 (brown) (E). Each group contained five mice. CCR2 k/o indicates CCR2-deficient mice; wild, wild-type mice. Original magnification, ×400.

Interstitial Granulocytes Were Reduced in CCR2-Deficient Mice

Granulocytes infiltrated mainly in outer medulla of wild-type mouse kidney after ischemia-reperfusion. By use of a monoclonal antibody against granulocytes, a significant decrease was found in the number of interstitial infiltrated granulocytes in the CCR2-deficient mice 4 and 24 h after ischemia-reperfusion compared with wild-type mice (Figures 2 and 7A⇓). However, the number of interstitial infiltrated granulocytes 48 h after ischemia-reperfusion did not differ between CCR2-deficient and wild-type mice (Figure 7A). To determine the presence of CCR2 on granulocytes, we examined a dual-labeled color immunofluorescence immunohistochemistry. In wild-type mice, granulocytes (Figure 7B) and CCR2-positive (Figure 7D) cells were detected in ischemia-reperfusion kidney after reperfusion. A small but significant number of interstitial infiltrated granulocytes was CCR2-positive in injured kidneys (Figure 7C). Ischemia-reperfusion enhanced renal transcripts of KC, MIP-2, and ENA-78, chemotactic for granulocytes, only 4 h after ischemia- reperfusion in wild-type mice. In contrast, ischemia-reperfusion enhanced renal NAP-2 transcripts in wild-type mice 4, 24, and 48 h after ischemia-reperfusion. The enhanced transcripts of KC, MIP-2, ENA-78, and NAP-2 were not detected in CCR2-deficient mice 4, 24, and 48 h after ischemia-reperfusion (Figure 7E). RT-PCR also failed to detect transcripts of KC, MIP-2, ENA-78, and NAP-2 in sham-operated left kidneys (Figure 7E) or contralateral kidneys (data not shown).

• Download figure
• Open in new tab
• Download powerpoint

Figure 7. The number of granulocytes decreased in CCR2-deficient mice. The number of granulocytes was counted in randomly selected high-power fields (×400) of outer medulla 4, 24, and 48 h after ischemia-reperfusion or sham operation. The number of granulocytes significantly decreased in CCR2-deficient mice 4 and 24 h after ischemia-reperfusion (A). Granulocyte was visualized with Cy3 and CCR2 with FITC. In wild-type mice, granulocytes (B) and CCR2-positive cells (D) cells were detected in ischemia-reperfusion kidney 4 h after ischemia-reperfusion. A small but significant number of granulocytes was CCR2 positive (C). The expression of KC, macrophage inflammatory protein 2 (MIP-2), neutrophil-activating peptide 78 (ENA-78), and neutrophil-activating peptide 2 (NAP-2) mRNA was evaluated by reverse transcriptase–PCR. KC, MIP-2 and ENA-78 were detected in wild-type mice 4 h after ischemia-reperfusion. NAP-2 was detected in wild-type mice 4, 24, and 48 h after ischemia-reperfusion (E). Each group contained five mice. CCR2 k/o indicates CCR2-deficient mice; wild, wild-type mice. Values are expressed as mean ± SEM.

Treatment of Propagermanium and RS-504393 Prevented Renal Injury in Wild-Type Mice after Ischemia-Reperfusion

The area of acute tubular necrosis in propagermanium- or RS-504393-treated mice was significantly smaller than that of wild-type mice 4, 24, and 48 h after ischemia-reperfusion (Figure 3A). Furthermore, the area of acute tubular necrosis in propagermanium- or RS-504393–treated mice was the similar level as CCR2-deficient mice 4, 24, and 48 h after ischemia-reperfusion. On the contrary, the area of acute tubular necrosis in outer medulla reduced 96 h after ischemia-reperfusion both in wild-type mice and propagermanium-treated mice, which displayed no difference (propagermanium, 12.2% ± 0.8%; wild type, 13.5% ± 3.4%, NS, n = 5, respectively).

Moreover, propagermanium and RS-504393 decreased interstitial infiltrated cells, which were similar to those in CCR2-deficient mice 4, 24, and 48 h after ischemia-reperfusion (Figure 3B). In contrast, interstitial infiltrated cells in outer medulla reduced at 96 h both in wild-type mice and propagermanium-treated mice, and there was no difference between two groups (propagermanium, 68.2 ± 9.5 per visual field; wild-type, 94.4 ± 18.0 per visual field, NS, n = 5, respectively). The number of cells in glomeruli did not differ between propagermanium- or RS-504393–treated mice and wild-type mice at any time point after ischemia-reperfusion (data not shown).