Mechanism of Increased Angiotensin II Levels in Glomerular Mesangial Cells Cultured in High Glucose

Culture of Mesangial Cells

All experiments were conducted on primary mesangial cells obtained from 100 to 150-g male Sprague-Dawley rats (Harlan, Indianapolis, IN) as described previously (7). In brief, glomeruli were isolated from kidney using a graded-sieving technique with stainless steel and nylon meshes under sterile conditions. Primary culture of mesangial cells was established by plating isolated glomeruli in RPMI 1640 tissue culture medium containing 12% fetal calf serum (FCS), 0.67 U/ml insulin, 100 U/ml penicillin, and 100 μg/ml streptomycin. Cells were allowed to grow at 37°C in 5% CO₂ and 95% air in 24-well cell culture plates or cell culture flasks as required. The identity of mesangial cells was confirmed by differential immunofluorescence staining using antibodies against cytokeratin (negative), actin (positive), and Factor VIII (negative). Cells were used between passage 1 to 3.

Experimental Conditions

To glucose-free RPMI 1640 media (Life Technologies BRL, Life Technologies, Grand Island, NY), either 5 mM glucose (NG) or 30 mM glucose (HG) was added. Mesangial cells were incubated in this media (without serum and insulin) for a period of 1 to 5 d. Either 5 mM glucose + 25 mM 2-deoxy-D-glucose (2-DG) or 5 mM glucose + 25 mM mannitol (HM) were used as osmotic controls. The cells remained healthy after 5 d of culture in the absence of serum under these experimental conditions. At the end of each experiment, cells were washed, scraped in ice-cold phosphate-buffered saline (PBS), and sonicated for 2 min on ice. This was followed by centrifugation at 13,000 × g for 20 min. The supernatant was collected and stored at −70°C until used for various determinations.

Measurement of AGT Levels in Mesangial Cells

Antibody to AGT was prepared as follows. Rabbits were immunized with 500 μg of antigen (porcine AGT; Sigma Chemical Co., St. Louis, MO) emulsified in complete Freund adjuvant in several intracutaneous sites on the back. After 4 wk, a booster injection of 250 μg of antigen in incomplete Freund adjuvant was administered intramuscularly in the flanks. The animals were bled after 2 wk, and the serum was tested for antibodies. Anti-AGT antibodies reacted to rat endogenous AGT as determined by Western blot analysis and shown in Figure 1. No cross-reaction of anti-AGT antibodies toward AngI and AngII was observed when tested by ELISA (data not shown). The anti-AGT antibody was used to measure AGT levels in mesangial cells by a competitive ELISA as follows. A 96-well plate was sensitized overnight with AGT (10 μg/ml) in 50 mM borate buffer (pH 10.5). The first incubation was carried out with standards (porcine AGT) or samples and anti-AGT antibody (1:10,000) for 2 h at room temperature followed by washing and then incubation with a secondary antibody (anti-rabbit IgG-peroxidase, 1:1000) for 1 h. The final reaction was developed using TMB and H₂O₂ as substrate and measured by reading absorbance at 450 nm after termination with 2N HCl. The amount of immunoreactive AGT in samples was calculated from a standard curve.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1. A Western blot analysis showing the reactivity of anti- angiotensinogen (AGT) antibody against rat endogenous AGT. Samples of rat plasma and extracts of rat liver and kidney were electrophoresed on 8% SDS gel and transferred electrophoretically to nitrocellulose membrane. Membranes were incubated in blocking buffer, washed, and then incubated with anti-AGT antibody (1:100) for 2 h at room temperature. This was followed by incubation with a peroxidase conjugated anti-rabbit antibody (1:200) for 1 h. Reaction was developed with DAB and H₂O₂ as a substrate. Membranes were washed and stored in H₂O. Reaction bands were observed near 50 kD for all samples, which coincides with the reported molecular weight for rat AGT (lane 1, molecular weight marker; lane 2, rat kidney; lane 3, rat liver; lane 4, rat plasma).

Northern Blot Analysis of AGT mRNA Expression

Total RNA was isolated from mesangial cells using a commercial RNA isolation kit (Promega, Madison, WI). A sample of total RNA was separated on a 1.2% agarose gel and transferred onto a Hybond XL nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ). The membrane was sequentially probed with ³²P-labeled cDNA of AGT and β-actin. The membrane was subsequently washed and exposed to autoradiography. The band densities for AGT and β-actin were determined using image analysis.

The cDNA probes for AGT and β-actin were synthesized by RT-PCR using total RNA from mesangial cells and the following primers: AGT, 5′ CTGACCCAGTTCTTGCTGCC-3′ (forward), 5′ TGGGGGTTATCACTCTGCC 3′ (reverse) (13); β-actin, 5′ TCATGAAGTGTGACGTTGACATCCGT 3′ (forward), 5′ CCTAGAAGCATTTGCGGTGCACGATG 3′ (reverse) (15). The RT-PCR products were 720 bp for AGT and 285 bp for β-actin as expected from primer positions. The bands were excised from the gel and eluted by centrifugation. The probes were labeled by the random primer method (Stratagene, Cedar Creek, TX) using alpha ³²P-dCTP as the label and purified by ethanol precipitation.

Measurement of Renin Activity

Renin activity was measured as AngI formed in the presence of excess renin substrate. For these experiments, we utilized commercially available porcine AGT (Sigma Chemical Co., St. Louis, MO), because it is known that rat renin can cleave porcine AGT. Samples were incubated with or without excess of AGT (1 μM) at 37°C for 1 h followed by measurement of AngI levels using a commercial ELISA kit (Peninsula Laboratories, Belmont, CA).

Western Blot Analysis for ACE

Sample proteins from mesangial cell extracts were separated on 8% SDS-PAGE under reducing conditions and transferred to PVDF membrane (Bio-Rad Lab., Hercules, CA) overnight at 4°C using transfer buffer containing 25 mM Tris-HCl, 192 mM glycine, 20% wt/vol methanol. After incubation in blocking buffer and washings, membranes were incubated with anti-ACE antibody (1:100; Santa Cruz Biotechnology Inc., Santa Cruz, CA) followed by incubation with a HRP-conjugated secondary antibody (1:1000; Santa Cruz Biotechnology Inc.). Specific proteins on the membranes were detected by chemiluminescence using the ECL detection system (Amersham Biosciences, Piscataway, NJ).

Measurement of ACE Levels and Activity

Mesangial cells were incubated in NG, HG, or 2-DG for a period of 1 to 5 d. Cell extracts were prepared and analyzed for ACE levels using an ELISA kit (Chemicon International, Inc., Tamecula, CA). ACE levels in samples were calculated from a standard curve run with each assay. ACE activity was measured by fluorometric assay using a fluorescence substrate o-aminobenzoylglycyl-p-nitro-L-phenylalanyl-L-proline (16).

Measurement of AngI and AngII Levels in Mesangial Cells

AngI and AngII levels were determined in mesangial cell extracts using commercial ELISA kits (Peninsula Laboratories, Belmont, CA) as described previously (7). In brief, cells were scraped in extraction buffer (20 mM Tris-HCl, pH 7.4; 10 mM EDTA; 5 mM EGTA; 5 mM β-mercaptoethanol; 50 μg/ml phenylmethyl sulfonyl fluoride; 10 mM benzamidine; and 0.1 μg/ml aprotinin) and dounce homogenized. Samples were centrifuged, and supernatants were collected and passed through a Centricon-10 filter with a cutoff of 10,000 kD. The filtrate was used for AngI and AngII measurements and protein content. The amount of AngI or AngII was calculated from a standard curve for AngI and AngII, respectively.

Analysis of AngII Formation from Exogenous AngI or Ang(1–9) Using High-Pressure Liquid Chromatography (HPLC)

Mesangial cell extracts were incubated with 10⁻⁴ M of exogenous AngI or Ang(1–9) for 1 h at 37°C. Samples containing 25 μg of protein were injected into HPLC and analyzed on a C-18 μBond reverse-phase column using an ultraviolet detector set at 214 nm (Isco Inc., Lincoln, NE). The flow rate was maintained at 1 ml/min. Mobile phase A consisted of water with 0.00005% trifluoroacetic acid, and mobile phase B consisted of 100% acetonitrile containing 0.00005% trifluoroacetic acid. The gradient program was set as 0 to 5 min 90% A:10% B, 5 to 32 min 60% A:40% B, 32 to 40 min 90% A:10% B to elute the products. The position of each Ang peptide peak was confirmed on the basis of the retention time for each Ang peptide standard (Bachem Bioscience Inc., King of Prussia, PA) peak recorded in a preceding run. Absorbance data at 214 nm for each peptide was used to generate sample chromatograms shown in Results. Quantification of peptide peaks was carried out by measuring peak absorbance of each peptide and normalizing it by peak absorbance of the exogenous substrate [AngI or Ang(1–9)]. The results are then presented as the ratio of Ang peptide/AngI or AngII/Ang(1–9).

Statistical Analyses

Experiments were conducted using primary mesangial cells derived from pooled glomeruli obtained from a group of three to four rats. Values are expressed as mean ± SEM, and n denotes the total number of experiments for a given test condition. Results obtained from experiments where cells were subjected to two or more than two test conditions were compared using the t test or one-way ANOVA, respectively. A P-value of <0.05 was considered to be significant.

High Glucose Increases AGT in Mesangial Cells

Incubation of mesangial cells in media containing 30 mM glucose (HG) produced a significant 1.5-fold increase in AGT levels compared with 5 mM glucose (NG) (Figure 2). In contrast, incubation in 30 mM 2-deoxy-D-glucose (2-DG) did not increase AGT levels (Figure 2). Concentrations of glucose ≥ 15 mM produced similar effects on AGT in mesangial cells as shown in Figure 3A. The increase in AGT levels was observed within 24 h of incubation in HG and was maintained after 2 and 5 d of incubation (Figure 3B). The effect of HG on AGT mRNA expression is shown in Figure 4. In the presence of HG for a 24-h period, there was an increase in AGT mRNA expression in mesangial cells compared with that in the presence of 5 mM glucose (Figure 4A). Densitometric analysis of the bands showed a significant increase in the ratio of AGT mRNA/β-actin mRNA in HG compared with NG (Figure 4B).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2. Immunoreactive (IR) AGT levels in mesangial cells incubated in 5 mM glucose (NG), 30 mM glucose (HG), or 5 mM glucose + 25 mM 2-deoxy-D-glucose (2-DG) for 24 h. Values are mean ± SEM of five experiments. *P < 0.05 compared with NG and 2-DG.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3. (A) Concentration-dependent effect of high glucose on IR-AGT. Mesangial cells were incubated with various concentrations of glucose for 24 h, extracted, and analyzed for AGT levels by ELISA. Values are mean ± SEM (n = 4); *P < 0.05 compared with 5 mM. (B) Time-dependent effect of glucose on IR-AGT. Mesangial cells were incubated with 5 mM (□) or 30 mM (▪) glucose for 1, 2, and 5 d, extracted, and assayed for AGT levels by ELISA. Values are means ± SEM of four experiments; *P < 0.05 compared with 5 mM glucose.

• Download figure
• Open in new tab
• Download powerpoint

Figure 4. (A) A representative Northern blot showing AGT mRNA expression in mesangial cells exposed to either 5 mM (NG) or 30 mM (HG) glucose for 24 h. (B) Densitometric analysis for AGT mRNA expression expressed as the ratio of AGT mRNA/β-actin mRNA. Values are mean ± SEM (n = 3). * P < 0.05 compared with NG.

High Glucose Does Not Increase Renin Activity

Renin activity in mesangial cells was measured as AngI formation in the presence of excess exogenous AGT (1 μM). AngI formation was increased by more than fivefold in mesangial cells incubated in media containing AGT compared with cells incubated in media without AGT. However, the increase in AngI levels in the presence of AGT was similar between NG and HG. In mesangial cells incubated in HG, AngI formation from exogenous AGT was 2.5 ± 0.3 ng/mg protein per h compared with 2.8 ± 0.4 ng/mg protein per h in cells incubated in NG (P = NS).

High Glucose Increases AngI and AngII Levels in Mesangial Cells

In the presence of HG for a 24-h incubation period, AngI levels in mesangial cells were increased significantly compared with NG or 2-DG (Figure 5A). The increase in mesangial AngI level was maintained after 5 d of incubation in HG; 188 ± 11% compared with 100% NG control (P < 0.05, n = 4).

• Download figure
• Open in new tab
• Download powerpoint

Figure 5. Effect of high glucose on IR-AngI (A) and IR-AngII (B) in mesangial cells incubated in 5 mM glucose (NG), 30 mM glucose (HG), or 5 mM glucose + 25 mM 2-deoxy-D-glucose (2-DG) for 24 h. Immunoreactive AngI and AngII levels were measured by ELISA. Values are mean ± SEM of four experiments. *P < 0.05 compared with NG and 2-DG.

A significant increase in AngII level was also observed in mesangial cells incubated in HG for 24 h in contrast to cells incubated in NG or 2-DG (Figure 5B). After 5 d of incubation, AngII levels were 167 ± 11% in mesangial cells incubated in HG compared with 100% NG control (P < 0.05, n = 3). These results demonstrate that AngI and AngII formation is increased in mesangial cells in the presence of high levels of glucose.

High Glucose Does Not Affect ACE Levels or Activity

ACE in mesangial cells is present as a membrane-bound ectoenzyme and also in a secreted form; therefore, cell extracts and conditioned media were analyzed for ACE activity and levels. After a 24-h incubation period, ACE activity in media from cells incubated in HG was 22 ± 0.6 versus 25 ± 0.6 pmol/mg protein per min in media from cells incubated in NG. Similarly, ACE levels as determined by ELISA were similar in media from NG-treated and HG-treated cells (NG: 8.5 ng/mg protein versus 8.4 ng/mg protein in HG). Western blot analysis of the conditioned media from cells incubated in the presence of NG, HG, and 2-DG confirmed that ACE is secreted into the culture medium by mesangial cells. As shown in Figure 6A, a distinct band at 145 kD corresponding to the ACE protein was identified by Western analysis. However, no significant differences in the band density were observed among NG-, HG-, and 2-DG-treated cells (Figure 6A). ACE levels in mesangial cell extracts remained unchanged after 24 h or 5 d of incubation in HG (Figure 6B).

• Download figure
• Open in new tab
• Download powerpoint

Figure 6. (A) Western blot analysis showing angiotensin-converting enzyme (ACE) protein in media from mesangial cells incubated in 5 mM glucose (NG), 30 mM glucose (HG), or 5 mM glucose + 25 mM 2-deoxy-D-glucose (2-DG) for 24 h. A distinct band at 145 kD molecular weight was identified as that of ACE protein. (B) Effect of high glucose on ACE levels in mesangial cells incubated in NG, HG, or 2-DG for 1 to 5 d. Values are mean ± SEM of five experiments.

Formation of AngII from Exogenous AngI in Mesangial Cell Extracts

Formation of AngII and other Ang peptides from AngI was examined by HPLC. First, stability of exogenous AngI was tested in incubation buffer (PBS) at 37°C. AngI (10⁻⁴ M) was incubated in PBS buffer at 37°C for a period of 1 to 4 h. At the end of each hour, a 25-μl sample was injected into the column, and peak absorbance at 214 nm was calculated from the AngI peak height. AngI peak absorbances were 1.6 units at 1, 2, 3, and 4 h. No other Ang peptide peaks were detected at any time point. These observations indicated that incubation of AngI with PBS buffer resulted in stability of the AngI with no appearance of metabolites.

Next, a 25-μg sample of cell extract from mesangial cells incubated in NG, HG, or HM was incubated in the presence of exogenous AngI (10⁻⁴ M) for 1 h at 37°C and then injected into a HPLC column. The peak height for each Ang peptide was measured and used for calculating the peak absorbances at 214 nm for each Ang peptide. Figure 7A shows a sample chromatograph reconstructed from the peak absorbance obtained for each Ang peptide in one such experiment using an NG-treated cell extract. As shown in this figure, AngII and other Ang peptides, including Ang(1–9), Ang(1–7), and Ang(3–8), were produced from exogenous AngI. These peptides accumulated in the reaction mixture in a time-dependent manner up to the maximum time (4 h) tested (data not shown). The ratio of Ang peptides/AngI is shown in Figure 7B. There was a significant increase in the ratio of AngII/AngI in cells incubated in HG compared with cells incubated in NG or HM (Figure 7B). These results suggest that AngII formation in the presence of exogenous AngI is stimulated by HG. Production of Ang(1–9) from exogenous AngI did not differ significantly among NG, HG, and HM (Figure 7B). Also, HG did not alter Ang(1–7) and Ang(3–8) generation from exogenous AngI (data not shown). Of note, HPLC of cell extracts without exogenous AngI did not show peaks for angiotensin metabolites.

• Download figure
• Open in new tab
• Download powerpoint

Figure 7. (A) A sample chromatogram showing formation of various Ang peptides from exogenous AngI in mesangial cells incubated in 5 mM glucose (NG). Cell extracts were incubated with exogenous AngI (10⁻⁴ M) for 1 h and analyzed by HPLC. Exogenous AngI was converted into Ang peptides, including AngII, Ang(1-7), Ang(1-9), and Ang(3-8). The peak height for each peptide was measured, and absorbance (214 nm) for each peptide was calculated. Absorbance data was then used to generate a sample chromatograph. (B) Effect of 30 mM glucose (HG) on formation of Ang(1-9) and AngII from exogenous AngI in mesangial cell extracts. The peak absorbance for Ang(1-9) and AngII were calculated (see panel A) and normalized by absorbance for AngI peak. The results are presented as the ratio of Ang(1-9)/AngI and AngII/AngI for each group. Values are mean ± SEM of three experiments. *P < 0.05 compared with NG.

Pre-incubation of mesangial extracts with enalaprilat (10⁻⁴ M) for 30 min resulted in a decrease of 30 to 40% in AngII generation from exogenous AngI in cells incubated in NG, HG, or HM. These findings indicated that conversion of AngI to AngII in mesangial cell extracts is only partly inhibited by ACE inhibitors.

Role of Ang(1-9) in AngII Formation in Mesangial Cells

The possibility of AngII formation from the intermediary ANG peptide Ang(1-9) was examined by HPLC analysis. In these experiments, mesangial cell extracts from NG-, HG-, or HM-treated cells were incubated with exogenous Ang(1-9) (10⁻⁴ M) for 1 h at 37°C and analyzed by HPLC. The result of one such experiment using NG cell extracts is shown in Figure 8A. The ratio of AngII/Ang(1-9) obtained in NG-, HG-, or HM-treated cells is presented in Figure 8B. There was a significant increase in AngII/Ang(1-9) ratio in cells incubated in HG, suggesting that formation of AngII from Ang(1-9) is increased under high glucose conditions. Pre-incubation with enalaprilat produced a decrease of about 30% in the formation of AngII from exogenous Ang(1-9); this effect being similar in cells incubated in NG, HG, or HM.

• Download figure
• Open in new tab
• Download powerpoint

Figure 8. (A) Sample chromatograph showing formation of AngII from exogenously added Ang(1-9) (10⁻⁴ M) to cell extracts from NG. Absorbance for each peak was calculated as explained in Figure 7A. Absorbance data obtained for Ang(1-9) and AngII was used to generate a chromatograph. (B) Effect of 30 mM glucose (HG) on formation of AngII from Ang(1-9) in mesangial cell extracts. The peak absorbance for AngII and Ang(1-9) was calculated from the respective peak height and ratio of AngII/Ang(1-9) is presented. Values are mean ± SEM of three experiments. *P < 0.05 compared with NG.