Abstract
ABSTRACT. Renal hypouricemia is an inherited and heterogeneous disorder characterized by increased urate clearance (Cua). The authors recently established that urate was reabsorbed via URAT1 on the tubular apical membrane and that mutations in SLC22A12 encoding URAT1 cause renal hypouricemia. This study was undertaken to elucidate and correlate clinical and genetic features of renal hypouricemia. The SLC22A12 gene was sequenced in 32 unrelated idiopathic renal hypouricemia patients, and the relationships of serum urate levels, and Cua/creatinine clearance (Ccr) to SLC22A12 genotype were examined. Uricosuric (probenecid and benzbromarone) and anti-uricosuric drug (pyrazinamide) loading tests were also performed in some patients. Three patients had exercise-induced acute renal failure (9.4%), and four patients had urolithiasis (12.5%). The authors identified eight new mutations and two previously reported mutations that result in loss of function. Thirty patients had SLC22A12 mutations; 24 homozygotes and compound heterozygotes, and 6 heterozygotes. Mutation G774A dominated SLC22A12 mutations (74.1% in 54 alleles). Serum urate levels were significantly lower and Cua/Ccr was significantly higher in heterozygotes compared with healthy subjects; these changes were even more significant in homozygotes and compound heterozygotes. These Cua/Ccr relations demonstrated a gene dosage effect that corresponds with the difference in serum urate levels. In contrast to healthy subjects, the Cua/Ccr of patients with homozygous and compound heterozygous SLC22A12 mutations was unaffected by pyrazinamide, benzbromarone, and probenecid. The findings indicate that SLC22A12 was responsible for most renal hypouricemia and that URAT1 is the primary reabsorptive urate transporter, targeted by pyrazinamide, benzbromarone, and probenecid in vivo. E-mail: ichida@jikei.ac.jp
Approximately 90% of all urate that is filtered through the glomerulus is eventually reabsorbed. A four-component hypothesis has been proposed to explain the renal urate transport mechanisms; it includes glomerular filtration, presecretory reabsorption, secretion, and postsecretory reabsorption (1,2⇓). Renal hypouricemia is a common inherited and heterogeneous disorder characterized by impaired tubular urate transport (3). The incidence of renal hypouricemia has been reported to be 0.12 to 0.72% (4,5⇓), and exercise-induced acute renal failure and nephrolithiasis have been reported as complications (6).
Renal hypouricemia has been classified into the following five types according to responses to the anti-uricosuric drug pyrazinamide, and the uricosuric drug, probenecid: (a) a pre-secretory reabsorptive defect with an attenuated response to both pyrazinamide and probenecid (3); (b) a post-secretory reabsorptive defect when pyrazinamide suppressible urate clearance (Cua) is not influenced by probenecid (7); (c) total inhibition of urate reabsorption when pyrazinamide induces elimination of Cua exceeding the rate of glomerular filtration (8); (d) enhanced secretion when the pyrazinamide suppressible Cua is increased by probenecid (9); and (e) subtotal defect in urate transport without any response to either pyrazinamide or probenecid (10).
The four-component hypothesis and the classification of renal hypouricemia are rather complicated and have presumed that pyrazinamide inhibits urate secretion. However, some reports using membrane vesicles have recently indicated that the anti-uricosuria induced by pyrazinamide was due to enhanced urate reabsorption through exchange of its active metabolite, pyrazine carboxylic acid (PZA), via the urate/anion exchanger at the brush-border membrane (11–13⇓⇓). Reconsideration of the four-component hypothesis and the classification of renal hypouricemia are crucial. Therefore, a classification based on gene mutations in SLC22A12 and prospective urate transporter genes is needed.
Although membrane vesicles studies have suggested that a voltage-sensitive pathway and urate exchangers are located at both the apical and basolateral membranes of proximal tubule cells (12–14⇓⇓), no transporters have been identified that alter serum urate levels and urinary urate excretion in vivo. We recently cloned urate transporter 1 (URAT1 encoded by SLC22A12), located at the apical membrane in the proximal tubules. We also demonstrated that URAT1 regulates serum urate levels by showing that three patients with renal hypouricemia have defects in SLC22A12 (15). The following questions remain: (a) What proportion of renal hypouricemia cases have SLC22A12 defects? and (b) What variation of mutations exist in SLC22A12?
In this study, we elucidated clinical and genetic features of renal hypouricemia and the significance of URAT1 in maintaining serum urate levels in vivo using 32 unrelated patients. In addition, we performed loading tests with the anti-uricosuric drug pyrazinamide and the uricosuric drugs probenecid and benzbromarone in a number of the patients to establish URAT1 as the active site of pyrazinamide, probenecid, and benzbromarone for urate transport modification in vivo.
Materials and Methods
Materials
We examined 32 patients with idiopathic renal hypouricemia. These patients either came to Jikei University Hospital and Tottori University Hospital between January 1, 1998, and August 31, 2002, or their doctors consulted with Jikei University Hospital and Tottori University Hospital between January 1, 1998, and August 31, 2002. One patient was hospitalized for exercised-induced acute renal failure. These patients are unrelated and provided informed consent for various analysis procedures at the outset of the study. Pyrazinamide loading tests were performed in 15 patients, probenecid loading tests in 6 patients, and benzbromarone in 13 patients.
Methods
Pyrazinamide, probenecid, and benzbromarone loading tests were conducted according to the methods previously described (16–18⇓⇓). Serum urate, Cua, and creatinine clearance (Ccr) were measured before and after administration of 3g of pyrazinamide, 2 g of probenecid, or 100 mg of benzbromarone.
Genomic DNAs of the patients were isolated from peripheral blood cells using a QIAGEN blood and cell culture DNA kit (Qiagen, Hilden, Germany) for direct sequencing (19). Using primers designed from the sequences of the introns, the entire genomic DNA sequences equivalent to the open reading frame of URAT1 cDNA were determined (Table 1).
Table 1. The primers for genomic amplification of URAT1 coding region
For the detection of the genotype of the G774A mutation in SLC22A12, the exon 4 of SLC22A12 was amplified by nested PCR using the exonic primer RH-EX4f-MspI and the intronic primer RH-r3. The nested PCR finally amplified a 135-bp fragment of genomic DNA, including nucleotide position 774. By setting C instead of T at the 3′ end of primer RH-EX4f-MspI, a new MspI digestion site was created in the PCR product. Upon digestion of the PCR product with the restriction enzyme MspI, only the PCR product that does not have a G to A base substitution at position 774 in SLC22A12 is cleaved into 109-bp and 26-bp fragments.
When two different mutations in SLC22A12 were identified, we performed PCR in which the DNA products included the two mutations; the primers in Table 1 were used to identify whether one SLC22A12 mutation and another SLC22A12 mutation were located on the same allele or not. We direct-sequenced several clones after the amplified DNA fragment was subcloned using TOPO XL PCR Cloning Kit (Invitrogen, San Diego, CA).
For the construction of a missense mutant, we used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The mutagenic oligonucleotide primers for generation of G269A, G412A, G490A, A1145T, T1298C, and deletion of 1639–1643 mutants were: 5′-GAGGCCCCATCAGTGCCGCC(A)CTTCCGCCAG CCACAGTGGCAGC-3′, 5′-CGTGGCCAAGTGGAACCTC(A)TGTGTGACTCTCACGCTCTGAAGCC-3′, 5′-CTGGTGGGAGCTGCTGCGTGC(A)GCCCTGCCTCAGACAGGTTTGGG-3′, 5′-GGG CAGCAACATCTTCCTGCTCC(T)AATGTTCATTGGTGTCGTG G-3′, 5′-CACGCTGGTGCCCCACGAAA(C)GGGGGCTCTGCGCT CAGCCTTG-3′, and 5′-CATGGCACGCTGGGGAACTCT()AAAATCCACACAGTTTTAGCCTCC-3′, respectively (sense strands; mutated nucleotides are in parentheses). Proper construction of the mutated cDNA was confirmed by complete sequencing.
URAT1 mutant cRNA was synthesized, using an mMESSAGE mMACHINE kit (Ambion, Inc., Austin, TX), from each linearized URAT1 mutant cDNA by NotI. Poly (A)+ tail was added using Poly (A) Tailing kit (Ambion). The injection of 50 ng of wild-type or mutant URAT1 cRNA into Xenopus leavis oocytes and maintenance of the oocytes and uptake studies were performed as described previously (15,20⇓). Uptake studies were performed at room temperature in ND96 (in mM: 96 NaCl, 2.0 KCl, 1.8 CaCl2, 1.0 MgCl2, 5.0 HEPES, pH 7.4) containing 10 μM 14C-urate (1.85 to 2.22 GBq/mmol; American Radiolabeled Chemicals, Inc., St. Louis, MO) and 100 μM cold urate. After uptakes were stopped and washed five times with ice-cold ND96, pH 7.4, each oocyte solubilized with 200 μl of 10% SDS was mixed with 2.5 ml of Aquasol-2 (Packard, Meriden, CT) for radioactivity determination using a scintillation counter (LC-3010; ALOKA, Tokyo, Japan).
The subcellular localization of URAT1 mutants was determined by immunocytochemical analysis. Anti-URAT1 N-terminal polyclonal antibody was obtained as 1.705 mg/ml of IgG fraction by immunization of rabbit with a keyhole limpet hemocyanin-conjugated synthetic peptide SELLDLVGGLGR, corresponding to URAT1 amino acid sequence 4–15, and by peptide affinity-purification. Xenopus oocytes, which were injected with 50 ng of wild-type or mutant URAT1 cRNA and cultured for 3 d at 18°C, were fixed in 4% paraformaldehyde in ND96 for 30 min at room temperature. Three-micrometer paraffin sections were stained with anti-URAT1 N-terminal antibody (1:100), followed by staining with Cy5-conjugated anti-rabbit IgG (1:200; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Images were visualized by a confocal laser microscope (FLUOVIEW FV500; Olympus Co., Tokyo, Japan).
Values for clinical data were expressed as mean ± SD. The experiments for urate uptake of URAT1 mutant in vitro were performed using three batches of oocytes, and results from the representative experiments were expressed as means ± standard errors, respectively. Statistical analyses were performed using the unpaired t test.
Results
Clinical Features of Patients with Renal Hypouricemia
Data related to urate handling of all the patients are shown in Table 2. Serum urate levels of all the patients were below 2 mg/dl and averaged 0.93 ± 0.49 mg/dl (n = 32). Both mean Cua (68.3 ± 31.6 ml/min; n = 30) and mean fractional excretion of Cua (Cua/Ccr) (0.584 ± 0.264; n = 32) were significantly increased. These data are compatible with patterns observed in patients with renal hypouricemia. Three patients had a past history of exercise-induced acute renal failure (9.4%). Urolithiasis was identified in 4 of the 32 patients (12.5%). Two patients had chronic renal failure; one was due to hypertension, and another was due to unknown origin.
Table 2. Clinical data and SLC22A12 mutations of the patients with renal hypouricemia
Mutation Analysis
Thirty of thirty-two patients had SLC22A12 mutations (93.8%), whereas two patients had none in the URAT1-coding region. All the patients with serum urate levels of 1.0 mg/dl or below did have SLC22A12 mutations. Cua/Ccr over 1 was identified in only two patients. We detected SLC22A12 mutations in 54 (84.4%) of 64 alleles. Eight new mutations in SLC22A12 were identified and are summarized in Table 2, together with the two of three mutations we previously reported (C650T and G774A) (15). Mutations included two nonsense mutations, one splice-site mutation, a 5-bp deletion, and six missense mutations.
Two nonsense mutations, both G774A and C889T within exon 4 and 5 of SLC22A12, produce a truncated protein that lacks half of the mature protein. The G774A mutation was identified in 40 (74.1%) of 54 affected SLC22A12 alleles, 11 homozygotes, 13 compound heterozygotes, and 5 heterozygotes (Table 2). The splice-site mutation (IVS2 + 1G→A) modifies the GT donor splice site of intron 2, suggesting aberrant splicing in this patient.
All of the six missense mutations were localized within the putative transmembrane domains (G164S, T217M, and Q382L) or within the putative intracellular loops (R90H, V138M, and M430T) (Figure 1). None of the missense mutations lie within the extracellular loops of the URAT1 protein. Four of six single–amino acid residue mutations of SLC22A12 (R90H, V138M, G164S, and Q382L) alter residues that are conserved in URAT1 and OAT4 encoded by SLC22A11. G269A and G412A were identified in 5 (9.3%) and 2 (3.7%) of 54 affected SLC22A12 alleles, respectively, and G650T we previously reported in one (1.6%).
Figure 1. The predicted membrane-spanning secondary structure of URAT1 and positions of the mutations. (A) Boxes indicate exons of SLC22A12. The mutations are pointed by line. (B) Predicted secondary structure of URAT1 is shown. Each circle represents one amino acid. A chain of open or gray circles indicates that corresponding amino acids were derived from the same exon. Mutations are indicated by closed circles.
Functional and Immunocytochemical Analysis of URAT1 Mutants
The new missense mutations (G269A, G412A, G490A, A1145T, and T1289C) and the 5-bp deletion (1639-1643delGTCCT) were tested for urate transport activity by in vitro expression analysis in Xenopus oocytes. As shown in Figure 2, the urate transports of all URAT1 mutants were significantly decreased in comparison with that of wild-type and were similar to that of oocytes that were not injected with URAT1 cRNA. G490A, A1145T, and T1289C mutants partially conserved urate transport function.
Figure 2. Urate transport ability of the URAT1 mutants found in the patients. Urate uptakes by all the oocyte-expressed mutants were significantly decreased compared with oocytes injected with wild-type URAT1 cRNA († P < 0.001). Urate uptakes of G490A, A1145T, and T1289C mutants–expressed oocytes significantly increased compared with the non-injected oocytes. * P < 0.01; ** P < 0.001.
To investigate the influence of URAT1 localization on urate transport activity, sections of mutant-expressing oocytes were stained with anti-URAT1 N-terminal polyclonal antibody. Staining at the plasma membrane was clearly observed in sections of wild-type URAT1-expressing oocytes (Figure 3). Oocytes expressing mutants G269A, G412A, G490A, or A1145T revealed significant immunopositive staining of the plasma membrane. In contrast, the sections of oocytes expressing T1289C or 1639-1643del mutants revealed only weak plasma membrane staining.
Figure 3. Immunocytochemical analysis of oocytes injected with 50 ng of cRNA encoding the wild-type or mutant URAT1. (A and B) Water-injected oocyte (A) and oocyte injected with the wild-type cRNA (B). (C through H) Oocytes injected with cRNA of G269A (C), G412A (D), G490A (E), A1145T (F), T1289C (G), or 1639–1643del (H). The mutants G269A, G412A, G490A, and A1145T exhibited similar staining to wild-type URAT1 at the plasma membrane. Staining of mutant T1289C and 1639–1643del was faint. Typical results of representative experiments are shown.
Genotype-Phenotype Correlation in Renal Hypouricemia
On the basis of the functional analysis experiment, we classified the 32 patients into three groups: (a) homozygotes and compound heterozygotes (n = 24); (b) heterozygotes (n = 6); and (c) patients with wild-type URAT1 (n = 2). Correlation of serum urate levels with Cua/Ccr of the renal hypouricemia patients and the controls are shown in Figure 4. The curve plotted is similar to that previously reported using healthy volunteers (21). Although the areas on the curve representing the homozygotes and compound heterozygotes, the heterozygotes and patients with wild-type URAT1, and the controls overlapped, each group is distinctively clustered. Lower serum urate levels and higher Cua/Ccr in the homozygotes and compound heterozygotes were statistically significant compared with the heterozygotes and the controls (Figure 5). Serum urate levels and Cua/Ccr in the heterozygotes were significantly lower and higher than those of the controls, respectively. This relation of Cua/Ccr among the homozygotes and compound heterozygotes, the heterozygotes, and the controls demonstrated a gene dosage effect, correlating with the difference in serum urate levels. The two patients with wild-type URAT1 had levels intermediate between the heterozygotes and the controls.
Figure 4. Correlation of serum urate levels with Cua/Ccr of the patients with renal hypouricemia and the controls. ⋄: homozygotes; □: compound heterozygotes; •: heterozygotes; ▵: patients with wild type URAT1; ▪: controls. The regression curve is plotted. R: correlation coefficient, y = 0.5068x−0.8227, R2 = 0.8056.
Figure 5. (A) Serum urate levels of the patients with homozygous and compound heterozygous SLC22A12 mutations, the patients with heterozygous SLC22A12 mutations, the patients with wild-type URAT1, and controls. (B) Cua/Ccr of the patients with homozygous and compound heterozygous SLC22A12 mutations, the patients with heterozygous SLC22A12 mutations, the patients with wild-type URAT1, and controls. Serum urate levels and Cua/Ccr in the patients with wild-type URAT1 were not statistically analyzed with those of other groups because only two patients were classified for the patients with wild-type URAT1. * P < 0.05; ** P < 0.001.
Drug Loading Tests for Renal Hypouricemia Patients
We conducted pyrazinamide, probenecid, and benzbromarone loading tests in a number of the patients. Cua/Ccr of the homozygotes and compound heterozygotes and the heterozygotes did not change significantly in response to the pyrazinamide and benzbromarone loading tests, although those of healthy subjects markedly decreased and increased, respectively (Figure 6). On the other hand, Cua/Ccr in the homozygotes and compound heterozygotes increased significantly in response to the probenecid loading test (P < 0.01). In addition, a patient with wild-type URAT1 had responses similar to healthy subjects for three loading tests.
Figure 6. Changes of Cua/Ccr ratio of the patients with homozygous and compound heterozygous SLC22A12 mutations, the patients with heterozygous SLC22A12 mutations, and the patients with wild-type URAT1 by the loading tests. The rate of change is shown by % of the Cua/Ccr value before loading. Data of healthy subjects were previously described (16,17⇓). * P < 0.05; ** P < 0.001 versus the Cua/Ccr value before loading. (A) Pyrazinamide loading test. This test was performed for ten patients with homozygous and compound heterozygous SLC22A12 mutations, four patients with heterozygous SLC22A12 mutations, and one patient with wild type URAT1. (B) Benzbromarone loading test. This test was performed for eight patients with homozygous and compound heterozygous SLC22A12 mutations, four patients with heterozygous SLC22A12 mutations, and one patient with wild-type URAT1. (C) Probenecid loading test. This test was performed for four patients with homozygous and compound heterozygous SLC22A12 mutations, one patient with heterozygous SLC22A12 mutations, and one patient with wild-type URAT1. We did not conduct statistical analysis of the reaction in the patient with wild-type URAT1 for the three loading tests, nor in the patient with heterozygous SLC22A12 mutations for the probenecid loading test.
Discussion
This study examined 32 unrelated patients with renal hypouricemia to correlate clinical and genetic features. We described eight new SLC22A12 renal hypouricemia mutations, which, together with those reported previously, increases the number of known mutations in SLC22A12 to 11. Mutation G774A is revealed as the major SLC22A12 renal hypouricemia allele (74.1%).
The incidence rates of exercise-induced acute renal failure and urolithiasis in patients with renal hypouricemia have not been adequately determined to date, despite the fact that most renal hypouricemic patients have been identified from the onset of these two conditions (18,22,23⇓⇓). The reported incidence rate of renal hypouricemia is 0.12% (5), and fewer than 70 patients with renal hypouricemia have been reported to develop exercise-induced acute renal failure in Japan. Accordingly, the perceived incidence rate of exercise-induced acute renal failure in patients with renal hypouricemia has been extremely lower than our frequency of 9.4%. A number of patients with renal hypouricemia who developed exercise-induced acute renal failure might have been overlooked due to the fact that the serum urate levels in these patients increase to the normal to high-normal range, during an exercise-induced acute renal failure episode. How renal hypouricemia accounts for exercise-induced acute renal failure remains an open question. Two mechanisms have been proposed: either urate nephropathy results from an increase in urate production during exercise (6,18⇓), or renal reperfusion injury due to vasoconstriction results from an exercise-induced increase in oxygen free radicals and a lack of urate, free radical scavengers (24). The first hypothesis raises an interesting question; why has tubular urate precipitation been identified in renal biopsy specimens of only one (6) of these renal hypouricemic patients with exercise-induced acute renal failure (25–28⇓⇓⇓)? Conversely, with regards to the second hypothesis, why has exercise-induced acute renal failure not been reported in xanthinuric patients who lack xanthine dehydrogenase and whose serum urate levels are almost 1 mg/dl or below, similar to renal hypouricemic patients? As SLC22A12 renal hypouricemia is proven to be primarily responsible for the renal hypouricemia documented in this study, we need to reconsider the mechanism from the viewpoint of URAT1 functional loss. Although it is difficult to obtain evidence for these hypotheses, understanding this mechanism may provide insights into other etiologies of acute renal failure.
The prevalence of urolithiasis is approximately 2 to 3% in the general population; however, 12.5% of the patients in this study had a history of urolithiasis. This high prevalence is probably related to the increased amount of urinary urate in these patients compared with healthy subjects, because the correlation of urinary urate with the prevalence of urolithiasis is well known (29,30⇓). Renal hypouricemia should be recognized as one of the diseases to consider that leads to the formation of kidney stones.
This study demonstrated that URAT1 was responsible for most of the renal hypouricemia, especially severe renal hypouricemia with serum urate levels of 1.0 mg/dl or less. We also demonstrated a gene dosage effect of SLC22A12 on Cua/Ccr, correlating with the difference in serum urate levels, despite the possibility that some renal hypouricemia alleles lacking mutations may be explained by large deletions or insertions, mutations in the promoter region, or mutations in intron sequences that were not screened. These facts indicate that URAT1 acts as the most significant renal tubular urate transporter for reabsorption and fluctuations of serum urate levels in vivo. Additionally, the fact that 24 of 30 patients had homozygous or compound heterozygous SLC22A12 mutations indicates that SLC22A12 renal hypouricemia is autosomal recessive in principle, which is compatible with previous reports (22,31⇓). In contrast, the present study showed individual variability in the SLC22A12 renal hypouricemia phenotype, as illustrated by the different Cua/Ccr and serum urate levels. For example, the homozygous G774A mutations resulted in variable Cua/Ccr values from 0.466 to 1.295. We preliminarily found some healthy subjects with the heterozygous G774A mutation whose serum urate level and Cua/Ccr were in the lower normal range (data not shown). This variability and both phenotypes, normouricemia and hypouricemia, in subjects with heterozygous SLC22A12 mutations suggest that other environmental and/or genetic factors affect Cua/Ccr and serum urate levels.
Functional analysis showed that five new missense mutations and the 5-bp deletion out of eight new mutations resulted in loss of urate transport activity. T1289C and 1639-1643del mutant proteins were present only at the plasma membrane, as demonstrated by immunocytochemical analysis. These finding indicate that impaired routing of URAT1 to the cell surface might be related with the loss of function in T1289C and 1639-1643del mutants. URAT1 has PDZ binding motifs at the C terminus, suggesting that URAT1 interacts with a multiple PDZ protein. PDZ domains are often involved in scaffolding protein complexes at plasma membranes, maintaining cell polarity, and signal transduction (32). Further investigation is needed, including identification of the PDZ protein that interacts with the PDZ domain of URAT1, and the interaction of URAT1 with the PDZ protein.
The new splice-site mutation (IVS2 + 1G→A) should not induce urate transport activity by modification of the GT donor splice site of intron 2. Accordingly, all of the mutations in this study, including the new nonsense C889T mutation and missense C650T mutation previously reported (15), should lack urate transport activity. These analyses correspond to the phenotype of our patients with SLC22A12 renal hypouricemia. Interestingly, the G774A mutation accounts for 74.1% of SLC22A12 mutations in our patients. The G774A mutation could have occurred in ancient history and spread over Japan such as the APRT *J mutation of the adenine phosphoribosyltransferase gene (33). Out of 32 patients, two patients without any SLC22A12 mutation were natives of the Chuugoku region in the western part of Japan. Accordingly, the variation of SLC22A12 mutations and the frequency of SLC22A12 renal hypouricemia would differ somewhat in the area.
Guggino et al. (11) and Roch-Ramel et al. (13) suggested that the anti-uricosuric effect of PZA was due to enhanced urate reabsorption through exchange of PZA via the urate/anion exchanger at the brush-border membrane after PZA moved into proximal cells by sodium-cotransport. In contrast, benzbromarone was suggested to inhibit urate reabsorption from the lumen side via the same urate/anion exchanger used by PZA (13, 34⇓). Using Xenopus oocytes injected with URAT1 complementary RNA, we demonstrated that urate is reabsorbed via URAT1 in exchange for organic anions such as lactate at the apical membrane, that URAT1 has affinity for both uricosuric and anti-uricosuric drugs such as benzbromarone, probenecid, and PZA, and that urate uptake was trans-stimulated by PZA (15). The typical responses for pyrazinamide, benzbromarone, and probenecid loading tests were not observed in the homozygotes and compound heterozygotes. From the absence of these drugs’ effects in these patients, we concluded that pyrazinamide, benzbromarone, and probenecid act on URAT1 as the target for their anti-uricosuric and uricosuric effects in vivo. These results correspond with previous studies in vitro (11,13,15,34⇓⇓⇓). In addition, a slight but significant increase in Cua/Ccr of all the homozygotes and compound heterozygotes was observed in the probenecid loading test, suggesting that probenecid might also act on another urate transporter. It has been reported that a population of renal hypouricemic patients with a post-secretory reabsorptive defect have a pyrazinamide suppressible Cua that is not influenced by probenecid (5,7,35,36⇓⇓⇓). This renal hypouricemia might be due to another urate transporter defect.
We identified two hypouricemic patients without SLC22A12 mutations in whom serum urate levels were > 1.0 mg/dl and Cua/Ccr was approximately 0.2. It is possible that they have mutations in other SLC22A12 regions such as the promoter region or the intron that affects URAT1 function. The responses for the loading tests in one of the two patients were similar to those of healthy subjects, rather than those of patients with URAT1 deficiency. Furthermore, most Cua/Ccr in the patients with SLC22A12 mutation did not exceed 1, despite the urate secretion mechanism in the tubules. These facts also suggest that another urate transporter acts on the tubules for urate reabsorption. If the unknown urate reabsorptive transporter plays a role in maintaining serum urate levels, we should recognize the transporter deficit as renal hypouricemia. Since URAT1 is responsible for most renal hypouricemia, the ability of the unknown urate reabsorptive transporter to regulate serum urate levels should not be greater than that of URAT1. We might be able to identify subjects with the unknown urate reabsorptive transporter disorder in the groups who have moderately lower serum urate levels.
In summary, this study correlated clinical and genetic features of renal hypouricemia. Clinically, the frequency of exercise-induced acute renal failure in patients with renal hypouricemia was higher than initially perceived. Genetically, this study illustrated that URAT1 is the main reabsorptive urate transporter because SLC22A12 was responsible for most renal hypouricemia, and the G774A mutation dominated SLC22A12 mutations in Japan. Furthermore, we established that pyrazinamide, benzbromarone, and probenecid exert anti-uricosuric and uricosuric effects by acting on URAT1 in vivo.
Acknowledgments
We thank Kouki Takada, Chief of the 2nd Department of Internal Medicine, JR Hiroshima General Hospital, for the collection of clinical material. This study was supported in part by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (#14207004), the Japan Society for the Promotion of Science (#14571041), the Gout research Foundation of Japan, and the Promotion and Mutual Aid Corporation for Private School of Japan.
- © 2004 American Society of Nephrology
References
Jump to section
More in this TOC Section
Cited By...
- Contribution of Rare Variants of the SLC22A12 Gene to the Missing Heritability of Serum Urate Levels
- Genetic predisposition to hypouricemia on whole-exome sequencing analysis and its utilities in primary screening purposes
- Uric acid priming in human monocytes is driven by the AKT-PRAS40 autophagy pathway
- Sex-specific Relationship of Serum Uric Acid with All-cause Mortality in Adults with Normal Kidney Function: An Observational Study
- Stronger Uricosuric Effects of the Novel Selective URAT1 Inhibitor UR-1102 Lowered Plasma Urate in Tufted Capuchin Monkeys to a Greater Extent than Benzbromarone
- Soluble uric acid primes TLR-induced proinflammatory cytokine production by human primary cells via inhibition of IL-1Ra
- Shared Ligands Between Organic Anion Transporters (OAT1 and OAT6) and Odorant Receptors
- Discovery of URAT1 SNPs and association between serum uric acid levels and URAT1
- Paracellular route is the major urate transport pathway across the blood-placental barrier
- Absence of SLC22A12/URAT1 Gene Mutations in Patients with Primary Gout
- Organic Anion Transporters and Their Implications in Pharmacotherapy
- PDZK1 Regulates Breast Cancer Resistance Protein in Small Intestine
- Recurrent EIARF and PRES With Severe Renal Hypouricemia by Compound Heterozygous SLC2A9 Mutation
- Treating gout with pegloticase, a PEGylated urate oxidase, provides insight into the importance of uric acid as an antioxidant in vivo
- Multiple single nucleotide polymorphisms in the human urate transporter 1 (hURAT1) gene are associated with hyperuricaemia in Han Chinese
- Homozygous SLC2A9 Mutations Cause Severe Renal Hypouricemia
- Uric Acid-Lowering Treatment With Benzbromarone in Patients With Heart Failure: A Double-Blind Placebo-Controlled Crossover Preliminary Study
- Plasma Urate Level Is Directly Regulated by a Voltage-driven Urate Efflux Transporter URATv1 (SLC2A9) in Humans
- Regulation of Tissue-Specific Expression of the Human and Mouse Urate Transporter 1 Gene by Hepatocyte Nuclear Factor 1 {alpha}/beta and DNA Methylation
- Homozygous frameshift mutation in the SLC22A12 gene in a patient with primary gout and high levels of serum uric acid
- Sodium-Hydrogen Exchanger Regulatory Factor-1 Interacts with Mouse Urate Transporter 1 to Regulate Renal Proximal Tubule Uric Acid Transport
- Human Renal Organic Anion Transporter 4 Operates as an Asymmetric Urate Transporter
- Concentration-Dependent Mode of Interaction of Angiotensin II Receptor Blockers with Uric Acid Transporter
- Human Vascular Smooth Muscle Cells Express a Urate Transporter
- The Multivalent PDZ Domain-containing Protein PDZK1 Regulates Transport Activity of Renal Urate-Anion Exchanger URAT1 via Its C Terminus