Cell Biology

Novel Interactions between TGF-β1 Actions and the 12/15-Lipoxygenase Pathway in Mesangial Cells

Young-Sook Kim, Zhong-Gao Xu, Marpadga A. Reddy, Shu-Lian Li, Linda Lanting, Kumar Sharma, Sharon G. Adler and Rama Natarajan
JASN February 2005, 16 (2) 352-362; DOI: https://doi.org/10.1681/ASN.2004070568

Abstract

Diabetic nephropathy (DN) is characterized by mesangial cell (MC) hypertrophy and progressive accumulation of glomerular extracellular matrix (ECM). It was reported recently that 12/15-lipoxygenase (12/15-LO) expression is increased in high-glucose (HG)–stimulated MC and in experimental DN. 12-LO products could also directly induce MC hypertrophy and ECM expression and mediate growth factor effects, thus implicating the 12/15-LO pathway in DN. Because TGF-β is a major player in the pathogenesis of DN, whether there is an interplay between the TGF-β and 12/15-LO pathways in MC was evaluated. Treatment of rat MC (RMC) with TGF-β significantly increased levels of the 12/15-LO product 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] and also 12/15-LO mRNA and protein expression. HG-induced TGF-β mRNA expression in RMC was inhibited by a specific ribozyme and siRNA targeted to knockdown rat 12/15-LO. It is interesting that direct treatment of RMC with 12(S)-HETE increased TGF-β mRNA and protein levels, as well as p-Smad2/3, which are TGF-β–specific target transcription factors. 12(S)-HETE also increased transcription from a minimal TGF-β promoter. Furthermore, TGF-β expression and p-Smad2/3 levels were lower in MC from 12/15-LO knockout mice relative to control mice. Reciprocally, mouse MC stably overexpressing 12/15-LO had greater TGF-β mRNA and also nuclear p-Smad2/3 relative to mock-transfected cells. 12/15-LO and TGF-β could functionally signal and increase ECM expression via the p38 mitogen-activated protein kinase signaling pathway. These results indicate for the first time that the 12/15-LO and TGF-β pathways can cross-talk and activate each other. These novel interactions may amplify the signal transduction cascades and molecular events that lead to DN.

Accumulating evidence suggests that TGF-β1 is a key mediator in the pathogenesis of progressive renal diseases such as diabetic nephropathy (DN) (1,2). Multifunctional cytokines of the TGF-β family can regulate cell growth, differentiation, development, extracellular matrix (ECM) production, and apoptosis (3). TGF-β1, 2, and 3 are expressed in mammals. TGF-β1 is typically associated with fibrosis in the kidney and other organs (3–5). TGF-β2 and TGF-β3 have also been shown to have fibrotic effects in renal cells, although their effects were partially mediated by TGF-β1 (5).

Factors that are relevant to the pathogenesis of DN, such as high glucose (HG) and advanced glycation end products (AGE), can increase TGF-β1 expression in glomerular mesangial cells (MC) and endothelial cells (6–8). Increased renal production of TGF-β has been observed in patients with diabetes and also in diabetic animal models (1,2,9). TGF-β has several effects in renal cells, including the stimulation of production of types I and IV collagen, laminin, heparin sulfate proteoglycan, and fibronectin (FN) (1,2,10–12). TGF-β also inhibits plasminogen activator-1 production (13) while increasing matrix metalloproteinase-2 (12). In vivo evidence of the pathologic role played by TGF-β in diabetic kidney disease was demonstrated by the improvement in glomerular filtration rates induced by an anti–TGF-β antibody in experimental DN (14), although, interestingly, proteinuria did not improve.

When TGF-β interacts with its receptors, it induces the phosphorylation and nuclear translocation of the receptor-regulated Smad2 and Smad3 transcription factors (4,15,16). These phosphorylated Smad2 and Smad3 proteins then can associate with Smad4 (common Smad), and this complex translocates to the nucleus, leading to gene regulation. MC express Smad2/3, Smad4, and Smad7 (inhibitory Smad), which mediate TGF-β–induced gene expression, including that of ECM genes such as plasminogen activator-1 and type I collagen (11,13,17–19). There is also evidence that, apart from the Smad pathway, the matrix-inducing actions of TGF-β may also be mediated via activation of mitogen-activated protein kinases (MAPK) (20). Overall, TGF-β is a well-established pathologic and profibrotic agent in the kidney. However, although dyslipidemia is associated with renal disease, very little is known regarding the role of lipids in mediating TGF-β actions or its expression.

Lipoxygenases (LO) are a family of nonheme iron-containing enzymes that insert molecular oxygen into polyunsaturated fatty acids such as arachidonic and linoleic acids (21,22). They are classified as 5-, 8-, 12-, and 15-LO on the basis of the carbon atom of arachidonic acid at which oxygen is inserted (21,22). 12-LO activation can lead to the formation of oxidized lipids such as 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] (21). Human and rabbit 15-LO as well as the leukocyte-type 12-LO have high homology and are classified as 12/15-LO (especially in rat and mouse) because they can form both 12(S)-HETE and 15(S)-HETE from arachidonic acid (21,22). Recently, there has been heightened interest in 12/15-LO pathway because of key data implicating it in the pathogenesis of atherosclerosis, restenosis, and hypertension (23–25).

Increased urinary 12(S)-HETE excretion was noted in patients with diabetes, suggesting a renal origin (26). 12/15-LO is present in the kidney (27,28), and recent data indicate its potential significance and function. Thus, 12/15-LO mRNA and protein are increased in glucose-stimulated MC and in experimental DN (27). Furthermore, in vivo expression of the matrix protein FN and TGF-β in diabetic rat glomeruli were associated with increased glomerular 12/15-LO expression (27), thereby implicating the 12/15-LO pathway in the pathogenesis of DN. Factors that are relevant to the pathogenesis of DN, such as HG, angiotensin II (Ang II), and PDGF, increased leukocyte-type 12/15-LO activity and expression in rat MC (RMC) and vascular smooth muscle cells (VSMC) (27,29–31). The growth-promoting and matrix-inducing effects of Ang II in MC were blocked by pharmacologic 12-LO inhibitors as well as a novel 12-LO ribozyme (31). Furthermore, 12(S)-HETE could directly induce cellular hypertrophy and expression of the ECM protein FN in RMC with similar potency as Ang II (31). 12(S)-HETE–induced effects were mediated at least in part by p38 MAPK and its target transcription factor, cAMP response element binding protein (31,32).

We also recently demonstrated the potential in vivo functional role of 12/15-LO in MC growth related to glomerulosclerosis and nephropathy by comparing the properties of mouse MC (MMC) derived from 12/15-LO knockout (LOKO) mice with those obtained from genetic control wild-type mice (WT) (33). Cellular growth, matrix production, activation of oxidant stress, MAPK activation, and transcription factor cAMP response element binding protein activation were attenuated in LOKO cells relative to WT cells (33).

Although the presence and significance of 12/15-LO and profibrotic TGF-β are now recognized in connection with glomerular matrix accumulation, the interrelationships between TGF-β and 12/15-LO in MC or DN is not known. In this study, we examined for the first time the effect of TGF-β on 12/15-LO activity and expression and also the reciprocal effects of the 12-LO product 12(S)-HETE on TGF-β expression and phosphorylation of Smad2/3 in MC. We also examined the signaling pathways involved and functional consequences. Our results reveal a novel cross-regulation of these two pathways that could result in the amplification of the pathologic processes that lead to DN.

Materials and Methods

12(S)-HETE and its stereoisomer 12(R)-HETE were from Biomol (Plymouth Meeting, PA); Smad2/3 and p-Smad2/3 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA); pan-specific TGF-β antibody and normal rabbit IgG, recombinant human TGF-β, and TGF-β ELISA kits were from R&D systems (Minneapolis, MN); inhibitors of p38 MAPK (SB202190) and ERK1/2 pathway (PD98059) were from Calbiochem (La Jolla, CA); antibodies for phosphospecific and nonphospho-p38 MAPK and -ERK1/2 and horseradish peroxidase–conjugated secondary antibodies were from Cell Signaling (Beverly, MA); Supersignal chemiluminescence reagent was from Pierce (Rockford, IL); β-actin antibody was from Sigma (St. Louis, MO); relative multiplex reverse transcriptase–PCR (RT-PCR) kits and primers for Quantum RNA 18S internal standards were from Ambion (Austin, TX); Lipofectamine 2000 transfection reagent was from Invitrogen (Carlsbad, CA); pEGFP-N1 was from Clontech (Palo Alto, CA); and RNA-STAT 60 reagent was from Tel-Test (Friendswood, TX).

Cell Culture

Primary cultures of RMC from Sprague-Dawley rats were obtained and cultured as described previously (27). Cells between 5 and 12 passages were used. An immortalized MMC cell line was cultured as described (33). Primary cultures of MMC from genetic control (C57BL/6, WT) and leukocyte-type 12/15-LOKO mice (Jackson Laboratories; strain B6.129S2-Alox15tm1Fun) were obtained as described (33) and according to a protocol approved by the Institutional Research Animal Care Committee.

12(S)-HETE Assay

Serum-depleted RMC were treated with recombinant human TGF-β (10 ng/ml) for 30 min or 1 h. Culture dishes then were cooled, and the supernatants were aspirated and saved at −70°C. Cell pellets were lysed and deacetylated. 12(S)-HETE levels in cell extracts and supernatants were quantitated by a specific RIA as described previously (29,34).

RNA Isolation and RT-PCR

Isolation of total RNA and RT-PCR using gene-specific primes along with 18S RNA primers as internal standards were performed as described previously (31). The following gene-specific primers were used in the RT-PCR reactions: Rat 12/15-LO (290-bp product): sense 5′-GTC TAC TCC ACC ACC TAT TTT C-3′) and antisense 5′-CTG TGC TCA TTG CCT TGT C-3′; mouse TGF-β1(300-bp product): sense 5′-CAA CGC CAT CTA TGA GAA AAC C-3′ and antisense 5′-AAG CCC TGT ATT CCG TCT CC-3′; rat TGF-β1 (403-bp product): sense 5′-CGA GGT GAC CTG GGC ACC ATC C-3′ and antisense 5′-CTG TGC TCA TTG CCT TGT C-3′; rat collagen α1 (I) (413-bp product): sense 5′-GTG AAC CCG GCA AAC AAG GT-3′ and antisense 5′-CTG GAG ACC AGA GAA GCC AC-3′; rat FN (446-bp product): sense 5′-GCA AGC CTG AAC CTG AAG AGA CC-3′ and antisense 5′-CCT GGT GTC CTG ATC ATT GCA TC3′.

Western Blotting

Cells were lysed in Laemmli’s sample buffer, fractionated on 10% SDS-PAGE gels (Bio-Rad, Hercules, CA), and immunoblotted with antibodies to 12/15-LO (1:400) (30,33), phospho-p38 MAPK (1:1000), phospho-ERK1/2 (1:1000), or phospho-Smad2/3 (1:200) as described (31,32). The blots were stripped and then reprobed with an antibody to β-actin (1:5000), total p38 MAPK (1:1000), total ERK1/2 (1:1000), or Smad2/3 (1:200). Immunoblots were scanned using GS-800 densitometer, and protein bands were quantified with Quantitation One software (Bio-Rad).

Immunofluorescence

Confluent MMC on glass slides were fixed with 2% paraformaldehyde in PBS for 15 min. Cells were permeabilized with 0.2% Triton-X100 in PBS and washed. For reducing nonspecific binding, cells were treated with 5% goat serum in PBS and then incubated with 1:40 p-Smad2/3 antibody, followed by incubation with rhodamine-conjugated secondary antibody (1:200) and viewed using a fluorescence microscope.

Transfection of Rat 12/15-LO Ribozyme

RMC were plated in 60-mm culture dishes and transfected the next day (80% confluent) with a chimeric DNA-RNA hammerhead ribozyme (Rz) targeted to cleave rat leukocyte-type 12/15-LO (Rz) or control catalytically inactive mutant 12/15-LO Rz (mRz) oligonucleotides using Lipofectamine 2000 as described (31). After 6 h, cells were washed and fresh medium that contained 1% FCS was added. The next day, cells were placed in serum-free RPMI 1640 medium that contained 0.2% BSA and 5.5 mM glucose (normal glucose) or 25 mM glucose (high glucose [HG]). Twenty-four hours later, total RNA was extracted and TGF-β mRNA levels were determined by RT-PCR.

Construction of Rat Leukocyte Type 12/15-LO-Specific Short Hairpin RNA Vectors and Transfection

We also used RNA interference initiated by small interfering RNA (siRNA) to effectively suppress 12/15-LO gene expression. For more stable suppression of gene expression, we constructed Pol III U6 promoter-driven short hairpin RNA (shRNA) targeting rat leukocyte-type 12/15-LO using a modification of a protocol that uses a PCR-based strategy for rapid screening of siRNA accessibility sites (35,36). Briefly, the siRNA target sequences on rat 12/15-LO mRNA are GCAACTGGATTTCTGTGAAGG (m233) and GAAGCGGATTTCTTCCTTCTG (m826). We used a combination of shRNA to both of these sites because we obtained better gene suppression with two together than individually as also reported for other genes (35,36). The final PCR products included the U6 promoter, followed by 21nt sense siRNA sequence, 9nt hairpin, and 21nt antisense sequence. For PCR, the vector pTZU6 + 1 was used as template. The universal U6 forward primer was 5′-GGAAGATCTGGATCCAAGGTCGGGCAGG-5′, and the reverse primers were 5′-CCAAGCTTCCCGGGAAAAAAGCAACTGGATTTCTGTGAAGGCTACACAAACCTTCACAGAAATCCAGTTGCGGTGTTTCGTCCTTTCC-3′ (for m233) and 5′-CCAAGCTTCCCGGGAAAAAAGAAGCGGATTTCTTCCTTCTGCTACACAAACAGAAGGAAGAAATCCGCTTCGGTGTTTCGTCCTTTCC-3′ (for m826). These PCR products were inserted into pCR3.1 vector to generate the shRNA (pCR3.1-m233 or -m826 siRNA) first and then an EGFP fragment was inserted into these pCR3.1-shRNA vectors to track transfection efficiency and facilitate cell sorting. This was done by first digesting the vector pEGFP-N1 at AseI and Afl II sites followed by ligation of the CMV promoter and EGFP fragments to Hinc II and SacI sites of pCR3.1-shRNA to generate the pCR3.1/EGFP shRNA vectors. We also used GGATATATCCCGAACTAGACA sequence to make a control scrambled shRNA unrelated to any gene. The empty vector has everything except siRNA. RMC were transfected with the shRNA using Lipofectamine 2000 reagent. Forty-eight hours after transfection, the cells were selected with 400 μg/ml G418 for 1 wk.

Transient Transfection and Reporter Gene Assays

Immortalized MMC were plated in 12-well plates and transfected the next day with 1 μg/well TGF-β1-Luc promoter construct (pA835) (6) using Lipofectamine 2000. Cells then were allowed to recover overnight in serum that contained medium and then transferred to serum-free medium that contained 0.2% BSA. The next day, they were stimulated with 12(S)-HETE (0.1 μM). Cells then were lysed, and luciferase activities were assayed as described (32,33).

ELISA

Cell supernatants were frozen at −20°C until assay by a sandwich TGF-β ELISA kit according to the manufacturer’s specifications. Acid activation of supernatants of MMC was first performed to convert latent TGF-β into active TGF-β form that can be recognized by the antibody. Total (latent + active) TGF-β in a sample was compared with known standards and read as ng/ml.

Statistical Analyses

Data are expressed as mean ± SEM of multiple experiments. Paired t tests were used to compare two groups, or ANOVA with Dunnet’s post test for multiple groups using PRISM software (Graph Pad, San Diego, CA). Statistical significance was detected at the 0.05 level.

Results

TGF-β Induces 12/15-LO mRNA and Protein Expression in RMC

Quiescent MC were stimulated with TGF-β for 0 to 24 h, and 12/15-LO mRNA expression was determined by RT-PCR. Figure 1A shows that TGF-β (10 ng/ml) treatment can induce 12/15-LO mRNA expression in RMC by 6 h, and this remains sustained for 24 h. 12/15-LO transcript levels were quantified as the ratio of density of 12/15-LO to 18S band and depicted by the bar graph in Figure 1B. To determine whether this increase in 12/15-LO mRNA was associated with an increase in 12/15-LO protein expression, we performed immunoblotting using 12/15-LO antibody. Figure 1C shows that TGF-β treatment for 8 h increased 12/15-LO protein levels in RMC even at 1 ng/ml.

Figure 1.
Figure 1.

Effect of TGF-β on 12/15-lipoxygenase (12/15-LO) mRNA and protein in rat mesangial cells (RMC). (A) Quiescent RMC were treated in serum-free medium with TGF-β (10 ng/ml) for various time periods, and expression of 12/15-LO mRNA was determined by relative reverse transcriptase–PCR (RT-PCR). (B) The ratio of 12/15-LO mRNA to internal standard 18S RNA was determined by densitometric analysis. There was significant increment in 12/15-LO/18S mRNA in RMC that were exposed to TGF-β. Data represent mean ± SEM of four independent experiments (*P < 0.01 versus Ctrl). (C) Cells were treated with increasing concentrations of TGF-β for 8 h, and 12/15-LO protein levels were examined by immunoblotting.

TGF-β Increases Levels of the 12/15-LO Product 12(S)-HETE in RMC

We next examined whether TGF-β alters 12/15-LO activity by examining levels of cell-associated and released 12/15-LO product, 12(S)-HETE by a RIA specific to 12(S)-HETE (29). Figure 2 shows that TGF-β treatment significantly increased the levels of cell-associated 12(S)-HETE and released 12(S)-HETE in cell supernatants, respectively, in RMC at 30 min as well as 1 h. Thus, TGF-β increases 12/15-LO activity by 30 min to 1 h, whereas protein and mRNA expression are increased by 6 h.

Figure 2.
Figure 2.

Effect of TGF-β on formation of the LO product 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] in RMC. Serum-depleted cells were left alone or treated with TGF-β for 30 min or 1 h. Cell-associated 12(S)-HETE in cell lysates (A) and cell-released 12(S)-HETE in culture supernatants (B) were extracted, and levels were quantified by a specific RIA. The results were expressed as pg/106 cells. Data represent mean ± SEM of three independent experiments (A: *P < 0.01 versus 30 min Ctrl; **P < 0.05 versus 1 h Ctrl, B: *P < 0.01 versus 30 min Ctrl and 1 h Ctrl).

12(S)-HETE Induces TGF-β mRNA Expression in RMC

We hypothesized that 12/15-LO activation can in turn increase TGF-β expression. We therefore treated RMC with 12(S)-HETE for time periods ranging from 1 to 24 h and examined rat TGF-β mRNA expression by RT-PCR. Figure 3A shows that 12(S)-HETE can increase TGF-β mRNA expression by 2 h, and this remains sustained for 24 h. Bar graph quantification is seen in Figure 3B. We also confirmed that this effect of 12(S)-HETE was specific because a stereoisomer, 12(R)-HETE, which is not a LO product, did not increase TGF-β mRNA expression (Figure 3C).

Figure 3.
Figure 3.

12(S)-HETE induces TGF-β mRNA expression in RMC. (A) Quiescent RMC were treated with 12(S)-HETE for indicated time periods, and expression of TGF-β mRNA was determined by relative RT-PCR using 18S RNA as an internal control. (B) The ratio of TGF-β mRNA to internal standard 18S RNA was determined by densitometric analysis. There was significant increment in TGF-β/18S mRNA in RMC that were exposed to 12(S)-HETE from 2 to 24 h. Data represent mean ± SEM of three independent experiments (*P < 0.01 versus Ctrl). (C) RMC were treated with 12(S)-HETE or 12(R)-HETE (0.1 μM each) for 24 h, and TGF-β mRNA expression was analyzed by RT-PCR.

12(S)-HETE Increases the Transcriptional Activity of TGF-β1 Promoter in MMC

Because 12(S)-HETE increased TGF-β mRNA levels, we next examined whether 12(S)-HETE could also increase the transcriptional activity of the TGF-β promoter. MMC were transiently transfected with a plasmid pA835, which contains the luciferase gene under the control of a minimal TGF-β promoter (6) and were left untreated or stimulated with 12(S)-HETE or HG for 18 h. Figure 4 shows that 12(S)-HETE could induce the transcriptional activity of TGF-β promoter as demonstrated by significant increase in luciferase activity. HG also increased the transcriptional activity as expected. Furthermore, the effects of HG and 12(S)-HETE together were also synergistic indicating a potential cross-talk between the HG and 12(S)-HETE activated pathways leading to TGF-β transcription.

Figure 4.
Figure 4.

12(S)-HETE increases the transcriptional activity of TGF-β in mouse mesangial cells (MMC). After transfection with the TGF-β promoter construct (pA835), MMC were stimulated with 12(S)-HETE or high glucose (HG) or 12(S)-HETE + HG for 18 h. Luciferase activity then was determined as described in the Materials and Methods section (*P < 0.05 versus Ctrl; **P < 0.01 versus Ctrl).

Inhibition of HG Induced TGF-β mRNA Expression by a 12/15-LO Ribozyme or 12/15-LO shRNA in RMC

We have previously shown that HG culture of RMC significantly increased 12/15-LO activity and expression (27). Evidence also shows that hyperglycemia in RMC and human and experimental DN are associated with enhanced production and action of TGF-β (14,37,38). We therefore hypothesized that HG-induced TGF-β may be mediated at least in part by 12/15-LO activation. To test this, we used a novel short hammerhead Rz as a molecular tool to cleave and inactivate rat 12/15-LO (31). Control for the Rz was an mRz with a point mutation at the catalytic site. RMC were transfected with the Rz or the mRz and then treated with HG (25 mM) for 24 h. Results shown in Figure 5A indicate that the 12/15-LO Rz could clearly reduce HG-induced rat TGF-β mRNA expression by >50%. The control mRz, however, had no effect.

Figure 5.
Figure 5.

Inhibition of HG induced TGF-β mRNA expression by a 12/15-LO ribozyme (Rz) or 12/15-LO short hairpin RNA (shRNA) in RMC. (A) RMC were transfected with the Rz or the mutant Rz (mRz) and then treated with HG for 24 h. Total RNA then was subjected to relative RT-PCR to quantify TGF-β mRNA levels. There was marked increment in TGF-β/18S mRNA in RMC that were exposed to HG. This was reduced by the Rz but not the mRz. (B) RMC were transfected with either the empty vector or the scrambled 12/15-LO shRNA or a mixture of 12/15-LO shRNA (m223+m826), and 12/15-LO protein levels were examined by Western blotting. (C) RMC were transfected with 12/15-LO shRNA (m223+m826) and then treated with HG for 24 h. Total RNA then was subjected to relative RT-PCR to quantify TGF-β mRNA levels. (D) Bar graph represents the ratio of TGF-β mRNA to internal standard 18S RNA and shows significant inhibition of HG-induced TGF-β mRNA. Scrambled shRNA (Scr) was used as control. Data show mean ± SEM from four independent experiments (*P < 0.01 versus Scr; #P < 0.01 versus 12/15-LO shRNA+HG).

Furthermore, we also used novel U6 promoter-driven shRNA to evaluate this further. We designed and tested siRNA to rat 12/15-LO using a novel rapid PCR method. The siRNA were cloned into pCR3.1 to obtain shRNA expression vectors. RMC were transfected with 12/15-LO shRNA to two different sites (m233 and m826), which we found had the optimum gene knockdown effects. We confirmed that 12/15-LO shRNA but not scrambled control can effectively knock down 12/15-LO protein expression in RMC (Figure 5B). Results shown in Figure 5, C and D, indicate that the 12/15-LO shRNA significantly reduced HG-induced TGF-β mRNA in RMC. These new results suggest that HG-induced TGF-β expression is mediated, at least in part, by the 12/15-LO pathway.

12(S)-HETE Treatment Increases Smad2/3 Phosphorylation in RMC

Because 12(S)-HETE could increase TGF-β expression, we anticipated that it should also increase the activity of Smad2/3, which are TGF-β-specific transcription factors. RMC were treated with 12(S)-HETE for various time periods, and Smad2/3 phosphorylation was evaluated by immunoblotting with an antibody that recognizes p-Smad2 and 3. 12(S)-HETE (0.1 μM) could increase p-Smad2/3 levels in a time-dependent manner, peaking at 6 h and declining by 24 h (Figure 6A, top). No change in total Smad2/3 was seen under these conditions (Figure 6A, bottom). The ratio of pSmad2/3 and total Smad2/3 in control samples and cells stimulated with 12(S)-HETE for 6 h is shown in Figure 6B.

Figure 6.
Figure 6.

Effect of 12(S)-HETE on Smad2/3 activity in RMC. (A) RMC were treated with 0.1 μM 12(S)-HETE for indicated periods of time and examined for Smad2/3 activation by immunoblotting cell lysates with p-Smad2/3 or Smad2/3 antibodies. Results are representative of three experiments. (B) Bar graph representation of data. There was significant increment in the ratio of phosphorylated to total Smad2/3 in RMC that were exposed to 12(S)-HETE for 6 h. Data represent mean ± SEM of four independent experiments (*P < 0.01 versus Ctrl).

TGF-β mRNA Expression and Smad2/3 Activity Are Elevated in an MMC Cell Line Stably Overexpressing 12/15-LO

Because 12(S)-HETE increased TGF-β expression and Smad2/3 activity in MC, we hypothesized that these parameters must be elevated in MC that overexpress 12/15-LO. We stably overexpressed mouse 12/15-LO cDNA in an immortalized MMC line that retains MC characteristics (31,33). We compared levels of TGF-β mRNA and p-Smad2/3 in these cells versus control pcDNA3.1 vector (mock transfected). As shown in Figure 7, A and B, the 12/15-LO-overexpressing cells had greater levels of mouse TGF-β mRNA expression relative to mock-transfected pcDNA cells. 18S RNA levels were similar in both cells. In addition, as shown in Figure 7, C and D, the 12/15-LO-overexpressing cells had significantly greater levels of p-Smad2/3 relative to mock-transfected pcDNA cells. Furthermore, immunofluorescent staining with anti-p-Smad2/3 demonstrates higher levels of nuclear p-Smad2/3 in 12/15-LO-overexpressing cells relative to pcDNA (Figure 7E). These results are consistent with our hypothesis that 12/15-LO products increase TGF-β as well as phosphorylation of downstream effector Smad transcription factors associated with TGF-β signaling.

Figure 7.
Figure 7.

TGF-β mRNA levels as well as p-Smad2/3 activity in an MMC cell line stably overexpressing mouse 12/15-LO. MMC stably overexpressing 12/15-LO were prepared as described (33). These 12/15-LO–overexpressing cells as well as control mock-transfected cells were serum-depleted for 48 h and then used to extract RNA for PCR to quantify mouse TGF-β1 mRNA expression by RT-PCR using 18S RNA as an internal control (A). (B) Graphical presentation shows that the ratio TGF-β/18S was significantly increased in 12/15-LO–overexpressing cells compared with mock-transfected cells. Data represent mean ± SEM of three independent experiments (*P < 0.01 versus Ctrl). Cell lysates were immunoblotted with p-Smad2/3 or Smad2/3 antibodies (C). (D) Graphical presentation shows that the ratio of phosphorylated to total Smad2/3 was significantly increased in 12/15-LO–overexpressing cells compared with mock-transfected cells. Data represent mean ± SEM of three independent experiments (*P < 0.01 versus Ctrl). (E) Confluent MMC on glass slides were incubated with p-Smad2/3 antibody, followed by incubation with rhodamine-conjugated secondary antibody and viewed by fluorescence microscopy. Hoescht dye was used to stain nuclei as control (E).

Comparison of TGF-β and Phospho-Smad2/3 Levels in MMC Derived from WT versus 12/15-LOKO Mice

Because LO products could increase TGF-β expression and MMC overexpressing 12/15-LO had elevated TGF-β levels, we next hypothesized that MMC derived from LOKO mice would have lower levels of TGF-β than those from control WT mice. MMC from WT and LOKO mice were serum-depleted for 48 h and then treated with or without FCS (10%) for 24 h. Supernatants were saved for measurement of TGF-β protein levels by ELISA, whereas cells were used to determine TGF-β mRNA or phospho-Smad levels. Figure 8A shows that basal and FCS-stimulated expression levels of TGF-β protein were markedly lower in MMC derived from LOKO mice relative to WT. Furthermore, Figure 8B shows that TGF-β mRNA levels were also lower in MMC derived from LOKO mice. Figure 8, C and D, shows that p-Smad2/3 levels were also significantly lower in MMC derived from LOKO mice. Overall, these results are supportive of 12/15-LO playing a key role in TGF-β expression and activation of its downstream effector Smad2/3, and vice versa, thus demonstrating a cross-talk in MC.

Figure 8.
Figure 8.

TGF-β expression and p-Smad2/3 activities in WT and 12/15-LOKO MMC. MMC from WT and 12/15-LOKO were serum-depleted for 48 h and then stimulated with FCS (10%) for 24 h. (A) TGF-β protein was measured by ELISA in supernatants of cells that were unstimulated (Basal) or stimulated with 10% FCS (FBS). (B) Cells were used to extract RNA for the determination of mouse TGF-β mRNA expression by RT-PCR. (C) p-Smad2/3 activity was examined by immunoblotting of cell lysates with anti–p-Smad2/3 or Smad2/3 antibodies. (D) Graphical presentation shows that the ratio of phosphorylated to total Smad2/3 was significantly decreased in LOKO cells compared with control cells. Data represent mean ± SEM of four independent experiments (*P < 0.01 versus Ctrl).

Role of MAPK Activation in Mediating 12(S)-HETE and TGF-β Effects in RMC

We next examined the role of specific common signal transduction mechanisms by which 12(S)-HETE and TGF-β exert their effects and potentially mediate a cross-talk. We therefore examined the activation of key growth- and stress-related MAPK. Serum-depleted RMC were treated with 12(S)-HETE (0.1 μM) or TGF-β (10 ng/ml) for various time periods, and MAPK activation was determined by Western blotting with phosphospecific antibodies that recognize only the activated kinases. As shown in Figure 9A, a marked increase in p38 MAPK activation could be seen within 1 h after stimulation with 12(S)-HETE and remained elevated until 24 h. However, 12(S)-HETE did not significantly activate ERK1/2. These results demonstrate that 12(S)-HETE is a potent activator of p38 MAPK but not ERK1/2 in RMC. As shown in Figure 9B, TGF-β in turn could increase both p38 MAPK and ERK1/2 activation from 1 to 6 h.

Figure 9.
Figure 9.

Effect of 12(S)-HETE or TGF-β on p38 mitogen-activated protein kinase (MAPK) and ERK1/2 phosphorylation in RMC. Quiescent RMC were treated in serum-free medium with 12(S)-HETE (A) or TGF-β (B) for various time periods, and p38 MAPK and ERK1/2 phosphorylation were determined by Western blotting with phosphospecfic antibodies (p-38 and p-ERK1/2). Blots were stripped and reprobed using total p38 and ERK1/2 antibodies as internal controls. Data shown are representative of three similar experiments.

Given that 12(S)-HETE increased both p38 MAPK phosphorylation and TGF-β mRNA expression, we posed the question of whether the p38 MAPK pathway was involved in mediating 12(S)-HETE-induced TGF-β mRNA expression. Serum-depleted RMC were pretreated with the p38 MAPK inhibitor SB202190 (10−6 M) for 30 min and then stimulated with 12(S)-HETE for 24 h. SB202190 significantly inhibited the activation of p38 MAPK by 12(S)-HETE (data not shown). In the presence of SB202190, 12(S)-HETE-induced increase in TGF-β mRNA was clearly attenuated (Figure 10A, top). Furthermore, we examined whether MAPK activation plays a functional role in ECM accumulation by 12(S)-HETE. We observed that 12(S)-HETE increased mRNA expression of the ECM proteins collagen α1 (I) and FN, and these were blocked by the p38 MAPK inhibitor (Figure 10A, middle and bottom).

Figure 10.
Figure 10.

Effect of MAPK inhibitors on 12(S)-HETE–induced (A) or TGF-β1–induced (B) induced gene expression in RMC. (A) Quiescent RMC were pretreated with p38 MAPK inhibitor SB202190 for 30 min and then stimulated with 0.1 μM 12(S)-HETE for 24 h. Rat TGF-β1, collagen α1(I), and fibronectin (FN) mRNA was determined by relative RT-PCR. (B) Quiescent RMC were pretreated with SB202190 or ERK1/2 pathway inhibitor PD98059 for 30 min and then stimulated with TGF-β (10 ng/ml) for 24 h. Rat 12/15-LO, collagen α1(I), and FN mRNA was determined by relative RT-PCR. Data shown are representative of three experiments.

Next, we evaluated whether the p38 MAPK and ERK1/2 pathways were involved in mediating TGF-β–induced 12/15-LO expression. In the presence of SB202190 (10−6 M) or the ERK pathway inhibitor PD98059 (10−6 M), TGF-β–induced 12/15-LO mRNA expression was markedly attenuated (Figure 10B, top). Furthermore, TGF-β–induced collagen α1(I) and FN mRNA expression were inhibited by both SB202190 and PD98059 (Figure 10B, middle and bottom). SB202190 or PD98059 alone had no effect. These results support the operation of a p38 MAPK-dependent cross-talk between the two pathways.

Inhibition of 12(S)-HETE Induced Collagen α1(I) and FN mRNA Expression by Neutralization with a TGF-β Antibody, and Inhibition of TGF-β Induced Collagen α1(I) and FN mRNA Expression by 12/15-LO shRNA

We next examined whether 12(S)-HETE–induced collagen α1(I) and FN expression can be blocked by neutralization with a TGF-β antibody in RMC. RMC were serum-depleted for 48 h and then stimulated with 12(S)-HETE for 24 h after 1 h of preincubation with pan-specific TGF-β antibody (25 μg/ml) or control IgG. Figure 11A shows that in 12(S)-HETE–treated cells, collagen α1(I) and FN mRNA expression were increased by 24 h, and this was clearly attenuated by pretreatment with the TGF-β antibody but not control IgG. These results suggest that 12(S)-HETE can induce collagen α1(I) and FN mRNA expression in RMC through TGF-β signaling. The former may be mediated by Smad, whereas MAPK may be involved in the latter (13,17). Furthermore, Figure 11B shows that in TGF-β–treated cells, collagen α1(I) and FN mRNA expression were increased by 24 h, and this was clearly attenuated by pretreatment with the 12/15-LO shRNA but not control scrambled shRNA (Scr). These results suggest that TGF-β can induce collagen α1(I) and FN mRNA expression in RMC at least in part through the 12/15-LO pathway.

Figure 11.
Figure 11.

Involvement of TGF-β in 12(S)-HETE–induced collagen α1(I) and FN mRNA expression (A) and involvement of 12/15-LO in TGF-β1–induced collagen α1(I) and FN mRNA expression (B). Quiescent RMC were pretreated with pan-specific TGF-β antibody or IgG (25 ng/ml) for 1 h and then stimulated with 0.1 μM 12(S)-HETE for 24 h. Total RNA was extracted, and expression of rat collagen α1(I) and FN mRNA was determined by relative RT-PCR (A). RMC were treated with 12/15-LO shRNA or scrambled (Scr) control and then stimulated with TGF-β for 24 h. Rat collagen α1(I) and FN mRNA expressions were determined by relative RT-PCR (B).

Discussion

The pathogenesis of DN involves hyperglycemia and growth factor–induced cellular hypertrophy, increased production of ECM proteins, and decreased production of matrix-degrading proteinases. However, much less is known about the role played by lipids that are released by growth factors. TGF-β plays a pivotal role in cellular growth and ECM production, and many of its actions in renal cells resemble those of high ambient glucose in the kidney. We recently demonstrated that the 12/15-LO pathway of arachidonate metabolism was enhanced in experimental DN in rats and correlated with expression of the ECM protein FN (27). 12/15-LO expression and products were also increased in HG-stimulated MC (27). Furthermore, LO products such as 12(S)-HETE could directly increase cellular hypertrophy and FN production in RMC (31). Thus, both 12/15-LO pathway products and TGF-β can mediate cellular growth, ECM production, and HG effects in MC. The present study provides the first evidence of an interaction and cross-talk between the actions of oxidized lipids of the 12/15-LO pathway and TGF-β in MC resulting in a potential feedback/feedforward amplifying loop in glomerulosclerosis.

We observed for the first time that TGF-β can increase the formation of the LO product 12(S)-HETE and also augment 12/15-LO protein and mRNA expression in MC and thus directly activate the 12/15-LO pathway. Evidence shows that other growth factors, such as Ang II and PDGF, can induce 12/15-LO expression and activity in MC and VSMC (29–32). Furthermore, Ang II–induced effects in MC such as hypertrophy and FN expression were mediated, at least in part, by 12/15-LO activation (31). These data indicate that oxidized bioactive lipids such as those generated by the 12/15-LO pathway may mediate the effects of TGF-β as well as other growth factors and thereby play a key role in the pathogenesis of DN.

We observed that the 12-LO product 12(S)-HETE can increase the protein and mRNA expression of TGF-β and also induce TGF-β promoter transcriptional activity. Furthermore, 12(S)-HETE increased phosphorylation of Smad2/3. This coincided temporally with the time that TGF-β expression was induced by 12(S)-HETE. The effects of 12(S)-HETE were specific because an isomer, 12(R)-HETE, which is not a LO product, did not alter TGF-β expression. 12(S)-HETE–induced increase in the transcriptional activity of TGF-β1 was comparable to the effects of HG; furthermore their effects were synergistic, suggesting that HG and 12(S)-HETE may operate through some similar as well as synergistic pathways. The specific molecular mechanisms and promoter elements involved in 12(S)-HETE–induced TGF-β expression are not yet clear and will be the focus of future studies.

Further evidence of TGF-β regulation by 12/15-LO was obtained by data showing that MMC overexpressing mouse 12/15-LO had increased levels of TGF-β mRNA as well as p-Smad2/3 compared with mock-transfected cells. These LO-overexpressing MMC also had elevated levels of FN mRNA (33). Reciprocally, MMC derived from LOKO mice had reduced levels of TGF-β relative to those from WT mice. This is supported by our recent data showing that MMC from these LOKO mice produced significantly lower levels of 12(S)-HETE and also markedly decreased FN expression (33). Overall, these results suggest that 12/15-LO pathway may contribute to renal dysfunction via activation of the TGF-β signaling pathway.

In this study, we showed for the first time that 12(S)-HETE can also induce the expression of another key TGF-β–regulated ECM protein, namely α1 chain of type 1 collagen [collagen α1(I)] that is a downstream target gene of Smad. It is interesting that 12(S)-HETE–induced collagen α1(I) and FN expression were blocked by a TGF-β–neutralizing antibody. We then examined whether the effect of TGF-β on collagen α1(I) and FN expression can be attenuated in 12/15-LO shRNA transfected RMC. The recently developed technique of RNA interference (RNAi) mediated by siRNA and shRNA is powerful because it can investigate specific functions of a target gene that cannot be studied easily with knockout mouse models (39–41). We noted that TGF-β–induced collagen α1(I) and FN expression were attenuated by the 12/15-LO shRNA in MC compared with scrambled shRNA transfected cells. These results indicate the operation of a loop mechanism wherein 12(S)-HETE can stimulate collagen α1(I) and FN mRNA expression through activation of TGF-β signaling, whereas TGF-β can stimulate collagen α1(I) and FN mRNA expression through 12/15-LO pathway. The former may be mediated by Smad, whereas MAPK maybe involved in the latter because evidence shows that collagen is a key target of Smad whereas TGF-β–induced FN is Smad independent (13,17). This cross-talk can further amplify ECM protein expression.

To evaluate the interactive signaling mechanisms involved, we examined the effect of 12(S)-HETE and TGF-β on MAPK activation. Our recent data implicated p38 but not ERK1/2 MAPK activation in 12(S)-HETE–induced FN expression in MC (31). Because TGF-β and HG can also activate p38 MAPK in MC (42,43), we reasoned that p38 MAPK activation may be a key focal point of integration of signals from 12(S)-HETE, TGF-β, and possibly HG. In this study, we observed that 12(S)-HETE could directly activate p38 MAPK but not ERK1/2, whereas TGF-β could stimulate both p38 MAPK and ERK1/2 activation as reported earlier (17,43,44). Moreover, a specific chemical inhibitor of p38 MAPK, SB202190, blocked 12(S)-HETE–induced TGF-β, collagen α1(I), and FN expression. The ERK1/2 pathway–specific inhibitor PD98059 and p38 MAPK inhibitor SB202190 inhibited TGF-β–induced 12/15-LO, collagen α1(I), and FN expression. Thus, MAPK seem to play important roles in mediating TGF-β and 12/15-LO interaction and ECM accumulation.

To evaluate further the functional significance in DN, we examined the consequences of 12/15-LO blockade on HG-induced TGF-β mRNA expression by using a novel Rz targeted to cleave rat 12/15-LO and also tested the 12/15-LO shRNA. Rz are RNA enzymes that catalytically cleave specific RNA sequences, resulting in irreversible inactivation of the target RNA (45,46). We showed earlier that a Rz directed to cleave rat leukocyte-type 12/15-LO was effective in vitro in VSMC and in vivo in a rat model of neointimal thickening (47). Furthermore, a modified new generation “short” Rz to rat 12/15-LO could attenuate Ang II–induced FN expression in RMC (31). In this study, we showed that the “short” 12/15-Rz but not mRz could inhibit HG-induced TGF-β mRNA expression in RMC. Similarly, new 12/15-LO shRNA also inhibited HG-induced TGF-β mRNA expression. These results suggest that HG-induced TGF-β is mediated, at least in part, by the 12/15-LO pathway and also illustrate the utility of Rz and shRNA to reduce expression of genes related to the pathogenesis of DN.

Although we mainly used MC in these studies, 12/15-LO and TGF-β interactions may occur in other relevant renal cells, such as podocytes. This is supported by the recent report that increased podocyte 12/15-LO expression is also observed in experimental DN and in HG-stimulated cultured podocytes (48). In summary, our study demonstrates a novel interaction between 12/15-LO and TGF-β actions in mediating MC matrix deposition and glomerulosclerosis associated with DN. HG- or diabetes-induced TGF-β and 12/15-LO activation may influence each other to amplify downstream signaling pathways and gene expression. Thus, new strategies aimed at combined blockade of TGF-β as well as 12/15-LO may yield optimal therapeutic benefits.

Acknowledgments

These studies were supported by National Institutes of Health Grants RO1 DK58191 (to R.N.) and NIH RO1 DK53897 (to K.S.) and the Juvenile Diabetes Research Foundation (to R.N., S.G.A., and K.S.).

We thank Dr. Colin Funk for the mouse 12/15-LO cDNA.

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

References

  1. ↵
    Sharma K, Ziyadeh FN: Hyperglycemia and diabetic kidney disease: The case for transforming growth factor-beta as a key mediator. Diabetes 44 : 1139 –1146, 1995
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Reeves WB, Andreoli TE: Transforming growth factor beta contributes to progressive diabetic nephropathy. Proc Natl Acad Sci U S A 97 : 7667 –7669, 2000
    OpenUrlFREE Full Text
  3. ↵
    Roberts AB: Molecular and cell biology of TGF-beta. Miner Electrolyte Metab 24 : 111 –119, 1998
    OpenUrlCrossRefPubMed
  4. ↵
    Roberts AB, McCune BK, Sporn MB: TGF-b: Regulation of extracellular matrix. Kidney Int 41 : 557 –559, 1992
    OpenUrlCrossRefPubMed
  5. ↵
    Yu L, Border WA, Huang Y, Noble NA: TGF-beta isoforms in renal fibrogenesis. Kidney Int 64 : 844 –856, 2003
    OpenUrlCrossRefPubMed
  6. ↵
    Hoffman BB, Sharma K, Zhu Y, Ziyadeh FN: Transcriptional activation of transforming growth factor-beta1 in mesangial cell culture by high glucose concentration. Kidney Int 54 : 1107 –1116, 1998
    OpenUrlCrossRefPubMed
  7. Chen S, Cohen MP, Lautenslager GT, Shearman CW, Ziyadeh FN: Glycated albumin stimulates TGF-beta 1 production and protein kinase C activity in glomerular endothelial cells. Kidney Int 59 : 673 –681, 2001
    OpenUrlCrossRefPubMed
  8. ↵
    Kim YS, Kim BC, Song CY, Hong HK, Moon KC, Lee HS: Advanced glycosylation end products stimulate collagen mRNA synthesis in mesangial cells mediated by protein kinase C and transforming growth factor-beta. J Lab Clin Med 138 : 59 –68, 2001
    OpenUrlCrossRefPubMed
  9. ↵
    Sharma K, Ziyadeh FN, Alzahabi B, McGowan TA, Kapoor S, Kurnik BR, Kurnik PB, Weisberg LS: Increased renal production of transforming growth factor-β1 in patients with type II diabetes. Diabetes 46 : 854 –859, 1997
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Douthwaite JA, Johnson TS, Haylor JL, Watson P, El Nahas AM: Effects of transforming growth factor-β on renal extracellular matrix components and their regulating proteins. J Am Soc Nephrol 10 : 2109 –2119, 1999
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Hansch GM, Wagner C, Burger A, Dong W, Staehler G, Stoek M: Matrix protein synthesis by glomerular mesangial cells in culture: Effects of transforming growth factor β(TGFβ) and platelet-derived growth factor (PDGF) on fibronectin and collagen type IV mRNA. J Cell Physiol 163 : 451 –457, 1995
    OpenUrlCrossRefPubMed
  12. ↵
    Poncelet AC, Schnaper HW: Regulation of mesangial cell collagen turnover by transforming growth factor-β1. Am J Physiol 275 : F458 –F466, 1998
  13. ↵
    Tsuchida K, Zhu Y, Siva S, Dunn SR, Sharma K: Role of Smad4 on TGF-beta-induced extracellular matrix stimulation in mesangial cells. Kidney Int 63 : 2000 –2009, 2003
    OpenUrlCrossRefPubMed
  14. ↵
    Ziyadeh FN, Hoffman BB, Iglesias-De la Cruz M, Ha D, Hon W, Isono M, Chen S, McGowan T, Sharm K: Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal anti transforming growth factor-β antibody in db/db diabetic mice. Proc Natl Acad Sci U S A 97 : 8015 –8020, 2000
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Massague J: TGF-beta signaling: Receptors, transducers, and Mad proteins. Cell 85 : 947 –950, 1996
    OpenUrlCrossRefPubMed
  16. ↵
    Zhang Y, Feng X, We R, Derynck R: Receptor-associated Mad homologs synergize as effectors of TGF-beta. Nature 383 : 168 –172, 1996
    OpenUrlCrossRefPubMed
  17. ↵
    Poncelet AC, de Caestecker MP, Schnaper HW: The TGF-β/SMAD signaling pathway is present and functional in human mesangial cells. Kidney Int 56 : 1354 –1365, 1999
    OpenUrlCrossRefPubMed
  18. Runyan CE, Schnaper HW, Poncelet AC: Smad3 and PKC-delta mediate TGF-β1-induced collagen I expression in human mesangial cells. Am J Physiol Renal Physiol 285 : F413 –422, 2003
    OpenUrlCrossRefPubMed
  19. ↵
    Poncelet A, Schnaper HW: Sp1 and Smad proteins cooperate to mediate TGF-β induced α2(I) collagen in human glomerular mesangial cells. J Biol Chem 276 : 6983 –6992, 2001
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Chin BY, Mohsenin A, Li SX, Choi AM, Choi ME: Stimulation of pro-α1(I) collagen by TGF-β1 in mesangial cells: Role of the p38MAPK pathway. Am J Physiol Renal Physiol 280 : F495 –F504, 2001
    OpenUrlPubMed
  21. ↵
    Yamamoto S: Mammalian lipoxygenase: Molecular structures and functions. Biochim Biophys Acta 1128 : 117 –131, 1992
    OpenUrlCrossRefPubMed
  22. ↵
    Funk CD: The molecular biology of mammalian lipoxygenase and the quest for eicosanoid functions using lipoxygenase-deficient mice. Biochim Biophys Acta 1304 : 65 –68, 1996
    OpenUrlPubMed
  23. ↵
    Cyrus T, Pratico D, Zhao L, Witztum JL, Rader DJ, Rokach J, FitzGerald GA, Funk CD: Absence of 12/15-lipoxygenase expression decreases lipid peroxidation and atherogenesis in apolipoprotein e-deficient mice. Circulation 103 : 2277 –2282, 2001
    OpenUrlAbstract/FREE Full Text
  24. Nozawa K, Tuck ML, Golub M, Eggena P, Nadler JL, Stern N: Inhibition of lipoxygenase pathway reduces blood pressure in renovascular hypertensive rats. Am J Physiol 2592: H1774–H1780, 1990
  25. ↵
    Natarajan R, Nadler JL: Lipoxygenases and lipid signaling in diabetes. Frontiers Biosci 8 : S783 –S795, 2003
  26. ↵
    Antonipillai I, Nadler J, Vu EJ: A 12-lipoxygenase product, 12-hydroxyeicosatetraenoic acid, is increased in diabetics with incipient and early renal disease. J Clin Endocrinol Metab 81 : 1940 –1945, 1996
    OpenUrlCrossRefPubMed
  27. ↵
    Kang SW, Adler SG, Nast CC, LaPage J, Gu JL, Nadler JL, Natarajan R: 12-Lipoxygenase expression is increased in diabetic nephropathy. Kidney Int 59 : 1354 –1362, 2001
    OpenUrlCrossRefPubMed
  28. ↵
    Katoh T, Lakkis FG, Makita N, Badr KF: Co-regulated expression of glomerular 12/15-lipoxygenase and interleukin-4 mRNAs in rat nephrotoxic nephritis. Kidney Int 46 : 341 –349, 1994
    OpenUrlCrossRefPubMed
  29. ↵
    Natarajan R, Gu JL, Rossi, Gonzales N, Lanting L, Xu L, Nadler JL: Elevated glucose and angiotensin II increase 12-lipoxygenase activity and expression in porcine aortic smooth muscle cells. Proc Natl Acad Sci U S A 90 : 4947 –4951, 1993
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Natarajan R, Bai W, Rangarajan V, Gonzales N, Gu JL, Lanting L, Nadler JL: Platelet-derived growth factor BB mediated regulation of 12-lipoxygenase in porcine aortic smooth muscle cells. J Cell Physiol 169 : 391 –400, 1996
    OpenUrlCrossRefPubMed
  31. ↵
    Reddy MA, Adler SG, Kim YS, Lanting L, Rossi JJ, Kang SW, Nadler JL, Shahed A, Natarajan R: Interaction of MAPK and 12-lipoxygenase pathways in growth and matrix protein expression in mesangial cells. Am J Physiol Renal Physiol 283 : F985 –F994, 2002
    OpenUrlCrossRefPubMed
  32. ↵
    Reddy MA, Thimmalapura PR, Lanting L, Nadler JL, Fatima S, Natarajan R: The oxidized lipid and lipoxygenase product 12(S)-hydroxyeicosatetraenoic acid induces hypertrophy and fibronectin transcription in vascular smooth muscle cells via p38 MAPK and cAMP response element-binding protein activation. Mediation of angiotensin II effects. J Biol Chem 277 : 9920 –9928, 2002
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Kim YS, Lanting L, Adler SG, Natarajan R: Differential behavior of mesangial cells derived from 12/15-lipoxygenase knockout mice relative to control mice. Kidney Int 64 : 1702 –1714, 2003
    OpenUrlCrossRefPubMed
  34. ↵
    Nadler JL, Natarajan R, Stern N: Specific action of the lipoxygenase pathway in mediating angiotensin II-induced aldosterone synthesis in isolated adrenal glomerulosa cells. J Clin Invest 80 : 1763 –1769, 1987
  35. ↵
    Castanotto D, Li H, Rossi JJ: Functional siRNA expression from transfected PCR products. RNA 8 : 1454 –1460, 2002
    OpenUrlAbstract
  36. ↵
    Dwarakanath RS, Sahar S, Reddy MA, Castanotto D, Rossi JJ, Natarajan R: Regulation of monocyte chemoattractant protein-1 by the oxidized lipid, 13-hydroperoxyoctadecadienoic acid, in vascular smooth muscle cells via nuclear factor-kappa B (NF-kappa B). J Mol Cell Cardiol 36 : 585 –595, 2004
    OpenUrlCrossRefPubMed
  37. ↵
    Yamamoto T, Nakamura T, Noble NA, Ruoslahti E, Border WA: Expression of transforming growth factor β is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci U S A 90 : 1814 –1818, 1993
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Iwano M, Kubo A, Nishino T, Sato H, Nishioka H, Akai Y, Kurioka H, Fujii Y, Kanauchi M, Shiiki S, Dohi K: Quantification of glomerular TGF- β1 mRNA in patients with diabetes mellitus. Kidney Int 49 : 1120 –1126, 1996
    OpenUrlCrossRefPubMed
  39. ↵
    Elbashir SM, Lendeckel W, Tuschl T: RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15 : 188 –200, 2001
    OpenUrlAbstract/FREE Full Text
  40. Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K: Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci 114 : 4557 –4565, 2001
  41. ↵
    Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T: Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411 : 494 –498, 2001
    OpenUrlCrossRefPubMed
  42. ↵
    Wang L, Ma R, Flavell RA, Choi ME: Requirement of mitogen-activated protein kinase kinase 3 (MKK3) for activation of p38alpha and p38delta MAPK isoforms by TGF-beta1 in murine mesangial cells. J Biol Chem 277 : 47257 –47262, 2002
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Chin BY, Mohsenin A, Li SX, Choi AM, Choi ME: Stimulation of pro-alpha (1)(I) collagen by TGF-beta(1) in mesangial cells: Role of the p38 MAPK pathway. Am J Physiol Renal Physiol 280 : F495 –F504, 2001
  44. ↵
    Hayashida T, Poncelet AC, Hubchack SC, Schnaper HW: TGF-β1 activates MAP kinase in human mesangial cells: A possible role in collagen expression. Kidney Int 56 : 1710 –1720, 1999
    OpenUrlCrossRefPubMed
  45. ↵
    Cech TR, Bass BL: Biological catalysis by RNA. Annu Rev Biochem 55 : 599 –629, 1986
    OpenUrlCrossRefPubMed
  46. ↵
    Rossi JJ: Therapeutic ribozymes. Principles and applications. Bio Drugs 9 : 1 –10, 1998
  47. ↵
    Gu JL, Pei H, Thomas L, Nadler JL, Rossi JJ, Lanting L, Natarajan R: Ribozyme-mediated inhibition of rat leukocyte-type 12-lipoxygenase prevents intimal hyperplasia in balloon injured rat carotid arteries. Circulation 103 : 1446 –1452, 2001
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Kang SW, Natarajan R, Shahed A, Nast CC, LaPage J, Mundel, P, Kashtan C, Adler SG: Role of 12-lipoxygenase in the stimulation of p38 mitogen activated protein kinase and collagen alpha5(IV) in experimental diabetic nephropathy and in glucose-stimulated podocytes. J Am Soc Nephrol 14 : 3178 –3187, 2003
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Novel Interactions between TGF-β1 Actions and the 12/15-Lipoxygenase Pathway in Mesangial Cells
Young-Sook Kim, Zhong-Gao Xu, Marpadga A. Reddy, Shu-Lian Li, Linda Lanting, Kumar Sharma, Sharon G. Adler, Rama Natarajan
JASN Feb 2005, 16 (2) 352-362; DOI: 10.1681/ASN.2004070568
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section