Abstract
Soluble gp130 (sgp130) is a soluble circulating receptor of IL-6 with “antagonistic” biologic activity. It is generated independently by either shedding of the extracellular domain of membrane gp130 or alternative mRNA splicing. This study was addressed to clarify the mechanisms underlying sgp130 synthesis and release in patients who undergo regular dialysis treatment (RDT) using dialytic membranes with different biocompatibility. Two groups of RDT patients were enrolled: 11 patients who were treated with cellulosic membranes (C) and 10 patients who were treated with synthetic membranes (S). Ten healthy subjects constituted the control group. Serum samples and peripheral blood mononuclear cells (PBMC) were harvested in all groups (before dialysis in RDT patients). PBMC were cultured for 24 h in the absence or presence of LPS. The serum levels of sgp130 were significantly higher in C group than in control and S patients (C, 603.1 ± 89.9; control, 396 ± 49.5; S, 423.4 ± 27.7 ng/ml; P < 0.01). PBMC from C patients, in the absence of any mitogenic stimulation, released a significantly greater amount of sgp130 as compared with S and control groups (C, 532.6 ± 161.2; S, 332.4 ± 148.6; control, 341.4 ± 125.4 pg/ml; P < 0.01). The sgp130 release was positively correlated with the release of both IL-6 (r = 0.336, P < 0.05) and sIL-6R receptor (r = 0.324, P < 0.05). A significantly higher gp130 gene expression was also observed in unstimulated PBMC from C patients when compared with control and S groups. It is interesting that the expression of the 85-bp exon characteristic of the alternative splicing mRNA for sgp130 was low in all groups. Finally, confocal microscopy analysis showed an increased expression of gp130 on cell surface in unstimulated PBMC from C patients as compared with control and S groups. Our results demonstrate that in patients on RDT with C membranes, the synthesis and release of sgp130 “antagonistic” receptor is significantly increased. This release is seemingly due to a shedding of membrane-bound gp130 receptor. The increased sgp130 release may partially counteract the inflammatory effects caused by IL-6.
There is an increasing body of evidence that IL-6 plays a prominent role in the course of several diseases (1); available data, indeed, suggest that IL-6 and its soluble receptor (sIL-6R) operate as central regulators of inflammatory processes (2,3). Elevated levels of IL-6 in patients with ESRD are associated with many negative issues, such as malnutrition, immunodeficiency, and cardiovascular events, and may predict the poor outcome of these patients (4–9). According to Stenvinkel et al. (10), IL-6 may play a central role in the genesis of inflammatory-driven malnutrition and may be regarded as a major atherogenic cytokine.
IL-6 effects on target cells occur via a complex receptor system, composed of a ligand binding subunit (IL-6R or gp80) and a signal-transducing glycoprotein (gp130), both expressed on the cell surface (11). After binding of IL-6 to IL-6R, the IL-6/IL-6R complex triggers the dimerization of the signal-transducing receptor component gp130 (11). This receptor–ligand interaction activates Janus kinases that phosphorylate the tyrosine residues of the cytoplasmic portion of gp130, activating a variety of members of signal transducers and activators of transcription family (12,13).
Soluble forms of both IL-6R and gp130 represent the circulating receptors of IL-6. These two soluble receptors are functionally different; sIL-6R, in fact, when complexed with circulating IL-6, may still induce dimerization of the membrane surface gp130 on cells that lack IL-6R and, therefore, represents, unlike other soluble cytokine receptors, a potent “agonistic” molecule (14,15). Soluble gp130 (sgp130), on the contrary, is a monomeric 100-kD glycoprotein that can efficiently bind the circulating binary IL-6/sIL-6R complex with “antagonistic” effects (16). Elevated plasma levels of sgp130 have been recently reported in patients with ESRD (17), but no clear modulation by different dialysis membranes was demonstrated (17).
Both sIL-6R and sgp130 are generated independently by either one of these two mechanisms: Shedding of the extracellular domain because of proteolytic cleavage and alternative splicing of mRNA (14,18). The first mechanism, which should take place mainly under mitogenic stimulation, involves an increased receptor synthesis and expression on the cell surface (18). Upon inflammatory stimulation, the membrane-bound receptors then are proteolytically cleaved by highly specific “shedding” enzymes and released as soluble proteins (sIL-6R and sgp130) (19). Shedding enzymes are cellular proteases, present on the surface of peripheral blood mononuclear cells (PBMC) and members of a family of matrix metalloproteinases (MMP) that contain a disintegrin domain (ADAM family) (20). As far as the second mechanism is concerned, Diamant et al. (21) reported the presence of an alternatively spliced mRNA directly encoding for a soluble form of gp130 that is missing the transmembrane domain. In this mRNA, they demonstrated the presence of a new 85-bp exon located in the sequence encoding the extracellular region of the receptor. This exon leads to a frame shift, resulting in a stop codon just before the transmembrane coding sequence (21). We previously reported the role of membrane biocompatibility on IL-6 and sIL-6R gene expression and protein synthesis (22–27). Because IL-6 plays a key role in cardiovascular mortality of patients with ESRD and sgp130 is a potent circulating “antagonist” that potentially neutralizes the negative clinical effects of IL-6, it is surprising that studies that specifically address the mechanisms underlying sgp130 synthesis and release or elucidate the critical role of this protein in the modulation of IL-6 inflammatory effects in patients who undergo regular dialysis treatment (RDT) are not found in the literature.
These issues constitute the object of this study. In particular, this study was addressed (1) to measure sgp130 circulating levels in patients who have ESRD and are dialyzed with either cellulosic or synthetic dialysis membranes, (2) to evaluate sgp130 synthesis and release from PBMC harvested from the same patients, and (3) to investigate which mechanism (shedding or alternative mRNA splicing) is operating in these patients on the sgp130 release in either basal conditions or after LPS stimulation.
Materials and Methods
Patient Selection and Dialysis Procedures
We enrolled two groups of patients who have ESRD and undergoing RDT; the first group included 11 patients who have ESRD and had been undergoing standard dialysis (three times a week) for at least 1 yr before the study with cellulosic (Hemophan) membrane (Bellco, Mirandola, Italy; membrane surface 1.36 to 1.72 m2, membrane thickness 8 μm; sterilization: ethylene oxide). The second group included 10 patients who had been on RDT for at least 1 yr before the study with more biocompatible synthetic membranes (six patients: polysulfone, low flux F-series, steam sterilization, Fresenius Medical Care, Bad Homburg, Germany; and four patients: EVAL membrane, KF201 1.6, Kuraray, Japan).
None of the patients had clinical or laboratory evidence of infective, neoplastic, or inflammatory disease for at least 3 mo before the study; none of the patients was clinically malnourished or had diabetes. Approximately 40% of patients with ESRD of each group assumed antihypertensive therapy with a good control of BP values; no patient presented other comorbidities (e.g., congestive heart failure, dyslipidemias, coronary or peripheral vascular disease) and risk factors. Underlying diseases that led to end-stage renal failure were chronic glomerulonephritis (three patients in the cellulosic group and two in the synthetic group), cystic disease (one patient in the cellulosic group and one in the synthetic group), hypertension (four patients in the cellulosic group and three in the synthetic group), and unknown (three patients in the cellulosic group and four in the synthetic group). All patients gave their informed consent. Ten healthy laboratory staff volunteers were also included in the study as healthy control subjects. In Table 1, the main clinical features of all subjects (ESRD patients and healthy control subjects) who were enrolled in the study are reported.
Clinical features of all subjects (ESRD patients who were undergoing dialysis treatment with cellulosic or synthetic membranes and healthy control subjects) who were included in the studya
All hemodialysis (HD) patients were using dialysate prepared by bicarbonate dry powder cartridges and filtered through hydrophobic membranes (Diasafe filters; Fresenius Medical Care) to achieve a high grade of dialysate purity. Endotoxin content of the dialysate, assessed by LAL test (Coatest Kabi Vitrum, Uppsala, Sweden), was <0.05 EU/ml. Dialysis efficiency was estimated, as spKt/V urea, every 15 d for at least 3 mo before the study using Daugirdas equation; in all patients, spKt/V was kept at ≥1.3.
PBMC Isolation and Culture
Blood samples (30 ml of heparinized blood) were collected from both HD patients and healthy control subjects to obtain plasma samples and isolate PBMC. In HD patients, the samples were drawn, in the absence of any intercurrent clinical problem, before the onset of the second dialysis of the week.
PBMC were isolated by Ficoll-Hypaque (Flow Laboratories, Irvine, UK) gradient density centrifugation (400 × g for 30 min). Mononuclear cells were washed twice with PBS (Sigma, Milan, Italy) and resuspended in RPMI culture medium (Sigma) supplemented with 1% heat-inactivated FCS (Sigma) and antibiotics (penicillin and streptomycin). Cells then were counted, and their viability was determined by trypan blue dye exclusion (>95% PBMC were viable). After this step, PBMC were incubated in culture tubes (Falcon) at a concentration of 1 × 106/ml and cultured for 24 h at 37°C in a 5% CO2 saturated humidity incubator, either in the absence or in the presence of a mitogenic stimulator, i.e., 200 ng/ml bacterial (Escherichia coli) LPS (Sigma). At the end of the incubation period, cell-free supernatants were collected by centrifugation and stored at −80°C.
Cytokine Assays
The concentration of sgp130 in both plasma and cell supernatant was measured by ELISA using a mouse monoclonal neutralizing antibody (Biosource International, Camarillo, CA). This antibody (clone B-R3) recognizes both soluble (sgp130) and membrane-bound gp130 receptors. In particular, for detection of sgp130, we used an ELISA procedure that is not commercially available; the antibody was coated onto the microwell plate by using a coating buffer and the high protein binding Dynex Immunlon 2 (Biosource). Standards, plasma samples, and PBMC supernatants were added to the wells, and the sgp130 soluble receptor was bound by the immobilized antibody. After different incubations at 37°C, the wells were washed and a polyclonal antibody against sgp130 soluble receptor, conjugated to horseradish peroxidase, was added. After a second incubation and further washing, a substrate solution was added; a color developed, the intensity of which was proportional to the amount of protein bound in the initial step. Color development was stopped with a solution of 2 N sulfuric acid, and its intensity was measured at 450 nm. The lower detection limit for this assay was <35 pg/ml; the variation coefficient of both inter- and intra-assay was <5%.
The concentrations of sIL-6R and IL-6 in plasma samples and PBMC culture supernatants were evaluated by ELISA using two different commercially available kits (Quantikine, R&D Systems, Minneapolis, MN, for both IL-6 and sIL-6R assay), as described elsewhere (25). The lower detection limit of sIL-6R assay was <3.5 pg/ml, and the variation coefficient of inter- and intra-assay was <10%. The lower detection limit of IL-6 assay was <0.70 pg/ml, and the variation coefficient of both inter- and intra-assay was <5%. All samples for a given assay were always analyzed in duplicate.
RNA Extraction and Reverse Transcription–PCR
Total RNA was extracted from lysed PBMC (1 × 106/ml), after 24 h of incubation with and without LPS, using TRIzol reagent (Life Technologies, Grand Island, NY). One microgram of total RNA was reverse-transcribed into complementary DNA (cDNA) and then amplified by using a reverse transcriptase–PCR (RT-PCR) kit (Perkin Elmer, Foster City, CA). PCR was carried out in the reaction mixtures that contained 0.25 μM of primer; 1 U of Taq polymerase, the buffer supplied by the kit (PCR buffer 1×); 1.5 mM of MgCl2; 200 μM of deoxy-NTP; and 1 μl of cDNA. The sequences of the primers used for PCR amplification are listed in Table 2.
Sequences of the PCR primers used in the studya
After an initial denaturation at 94°C for 5 min, PCR reactions were carried out using 30 cycles of 94°C for 1 min, the temperature for annealing for 1 min, and 72°C for 1 min in a Perkin Elmer Cetus 480 thermal cycler (Perkin Elmer). PCR products were separated by gel electrophoresis on a 2% agarose gel and stained with ethidium bromide. The bands obtained were quantified by densitometric analysis. All signals were normalized to the mRNA levels of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase and expressed as a ratio.
Alternative Splicing of gp130
The alternative splicing of gp130 was studied by RT-PCR using the following primers: forward GCTTGAGTCTTGCCAACGAGGACCTT and reverse GCCGCTCCTCTGAATCTAAC. The forward primer is located within the 85-bp exon characterizing the sgp130 and missing in the membrane-linked form of the receptor (15). Thus, the presence of a 591-bp PCR product will suggest the expression of a specific mRNA coding for sgp130. PCR was carried out in the reaction mixtures previously described that contained 2 μl of cDNA. After an initial denaturation at 94°C for 5 min, PCR reactions were carried out using 30 cycles of 94°C for 1 min, the temperature for annealing for 1 min, and 72°C for 90 s in a Perkin Elmer Cetus 480 thermal cycler. PCR products were separated by gel electrophoresis on 2% agarose gel and stained with ethidium bromide. The bands obtained were quantified by densitometric analysis. All signals were normalized to the mRNA levels of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase.
Laser Confocal Scanning Microscopy
PBMC that were isolated from normal subjects and HD patients were grown (15,000 cells/ml) in RPMI culture medium (Life Technologies) on glass coverslips, washed with PBS, and fixed in 4% paraformaldehyde in PBS for 15 min at room temperature. The coverslips were blocked for 1 h at room temperature with 1% BSA in PBS. For detection of gp130, PBMC were incubated for 2 h at room temperature with a goat polyclonal anti-gp130 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:200 in 1% BSA/PBS. The slides were washed twice in PBS, incubated for 1 h and 30 min at room temperature with goat anti-rabbit IgG-FITC conjugated (Molecular Probes, Eugene, OR), diluted 1:300, washed, and mounted. Laser confocal scanning images were obtained using a TCS confocal system (Leica Instruments).
Statistical Analyses
Statistical analysis was performed using the ANOVA followed by Bonferroni, as post hoc test, and the linear regression analysis (Pearson correlation coefficient). Unless otherwise reported, results are expressed as mean ± SD; statistical significance was defined as P < 0.05.
Results
Cytokine Plasma Levels
As shown in Table 3, ESRD patients who were undergoing dialysis treatment with cellulosic membranes showed significantly (P < 0.01) higher circulating levels of sgp130 as compared with both patients who had ESRD and were dialyzed with more biocompatible synthetic membranes and healthy control subjects. No significant difference was observed between the last two groups. In addition, in patients with ESRD who were dialyzed with cellulosic membranes, we observed higher circulating levels of both sIL-6R and IL-6, as compared with other two groups (Table 3). The circulating levels of sgp130 showed a positive, statistically significant relationship with both sIL-6R (r = 0.509, P < 0.001) and IL-6 (r = 0.692, P < 0.001). Analogously, we found a statistically significant positive relationship between the circulating levels of sIL-6R and IL-6 (r = 0.606, P < 0.001).
Plasma circulating levels of sgp130, sIL-6R, and IL-6 in 10 healthy control patients, 11 patients who had ESRD and were undergoing dialysis treatment with cellulosic membranes, and 10 ESRD patients who were treated with synthetic membranesa
Effects of HD Membrane on Cytokine Release by PBMC
Release of sgp130 by Unstimulated and Stimulated PBMC.
As shown in Figure 1, the release of sgp130 by unstimulated PBMC was significantly (P < 0.01) higher in HD patients who were dialyzed with cellulosic membranes (532.7 ± 161.2 pg/ml) than in control subjects (341.4 ± 125.4 pg/ml) and in patients who had ESRD and were dialyzed with synthetic membranes (332.4 ± 148.6 pg/ml). No difference was observed between the last two groups. After 24 h of LPS stimulation, PBMC released a significantly (P < 0.05) greater amount of sgp130 in all groups (448.2 ± 164.6 pg/ml in controls, 686.5 ± 173.6 pg/ml in patients who had ESRD and were dialyzed with cellulosic membranes, and 456.6 ± 166.4 pg/ml in patients who had ESRD and were dialyzed with synthetic membranes), but the value obtained in patients who had ESRD and were dialyzed with cellulosic membranes remained significantly (P < 0.01) higher than in the other two groups. The release of sgp130 from PBMC that were cultured in the absence of any mitogenic stimulation positively and significantly correlated with sgp130 circulating values (r = 0.417, P < 0.01).
Soluble IL-6 “antagonistic” receptor (sgp130) release by unstimulated (basal condition [Bas]) and stimulated (+LPS) peripheral blood mononuclear cells (PBMC) that were harvested from 10 healthy control subjects (Control), 11 ESRD patients who were dialyzed with cellulosic membranes (Cellulosic), and 10 ESRD patients who were dialyzed with synthetic membranes (Synthetic). The results are expressed as mean ± SD. *P < 0.05 versus corresponding unstimulated value; §P < 0.005 versus unstimulated, °P < 0.01 versus unstimulated Control and Synthetic; **P < 0.01 versus stimulated Control and Synthetic.
Release of sIL-6R by Unstimulated and Stimulated PBMC.
As shown in Figure 2, the release of sIL-6R by unstimulated PBMC was significantly (P < 0.01) higher in HD patients who were dialyzed with cellulosic membranes (221.8 ± 74.4 pg/ml) than in both healthy control subjects (139.9 ± 43.0 pg/ml) and patients who had ESRD and were dialyzed with synthetic membranes (150.6 ± 56.2 pg/ml); when the PBMC were stimulated with LPS, the release of sIL-6R was significantly (P < 0.001) increased, as compared with unstimulated corresponding values, in all groups (335.9 ± 63.9 pg/ml in control subjects, 325.8 ± 99.7 pg/ml in patients who had ESRD and were dialyzed with cellulosic membranes, and 330.2 ± 76.4 pg/ml in patients who had ESRD and were dialyzed with synthetic membranes).
sIL-6R release by unstimulated (Bas) and stimulated (+LPS) PBMC that were harvested from the same groups in Figure 1. The results are expressed as mean ± SD. *P < 0.001 versus corresponding unstimulated value; °P < 0.01 versus unstimulated Control and Synthetic.
IL-6 Production by Unstimulated and Stimulated PBMC.
As shown in Figure 3, the release of IL-6 by unstimulated PBMC was significantly (P < 0.005) higher in HD patients who were dialyzed with cellulosic membranes (201.7 ± 62.4 pg/ml) than in healthy control subjects (122.4 ± 44.1 pg/ml) and HD patients who were dialyzed with synthetic membranes (130.2 ± 54.2 pg/ml). After LPS stimulation, PBMC released a significantly (P < 0.001) greater amount of IL-6, as compared with the release in basal condition, in all groups (441.1 ± 21.0 in control subjects, 414.9 ± 30.3 pg/ml in HD patients who were dialyzed with cellulosic membranes, and 430.6 ± 26.8 pg/ml in HD patients who were dialyzed with synthetic membranes). The value obtained in healthy control subjects, however, was significantly (P < 0.05) higher than in HD patients who were dialyzed with cellulosic membranes. No difference was observed between the results obtained with Polysulfone or EVAL membrane. The sgp130 concentrations in the supernatant were significantly and directly correlated (P < 0.05) with the release values of both IL-6 (r = 0.325) and sIL-6R (r = 0.314). Similarly, a highly positive correlation (r = 0.716, P < 0.001) was found between the release of IL-6 and that of sIL-6R.
IL-6 release in unstimulated (Bas) and stimulated (+LPS) PBMC that were harvested from the same groups in Figure 1. The results are expressed as mean ± SD. *P < 0.001 versus corresponding unstimulated value; °P < 0.005 versus unstimulated Control and Synthetic; §P < 0.05 versus stimulated Cellulosic.
gp130, IL-6R (gp80), and IL-6 Gene Expression in Unstimulated and Stimulated PBMC
As reported in Figure 4, gp130 mRNA expression, studied by RT-PCR, was significantly (P < 0.05) higher in unstimulated PBMC that were harvested from HD patients who were dialyzed with cellulosic membranes than in healthy control subjects and in patients who were dialyzed with synthetic membranes. LPS (200 ng/ml) stimulation induced a significant increase of gp130 gene expression in all groups (P < 0.02 versus basal).
(A) In vitro gp130 (top) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; bottom) gene expression in PBMC from normal subjects (Control) and uremic patients who were treated with cellulosic or synthetic membranes, cultured without (Bas) and after LPS (200 ng/ml, 24 h; +LPS) stimulation. Image is representative of five experiments. (B) Densitometric analysis performed on the gels by computer-assisted image analysis system. gp130 gene expression was normalized to GAPDH and expressed as a ratio. *P < 0.02 versus basal; **P < 0.005 versus basal; °P < 0.05 versus basal control and synthetic.
IL-6R (gp80) gene expression is shown in Figure 5. mRNA expression, studied by RT-PCR, was significantly (P < 0.05) higher in unstimulated PBMC that were harvested from HD patients who were dialyzed with cellulosic membranes than in healthy control subjects and in patients who were dialyzed with synthetic membranes. LPS stimulation caused an increased mRNA abundance in all groups (P < 0.05).
(A) In vitro IL-6R (top) and GAPDH (bottom) gene expression in PBMC from normal subjects (control) and uremic patients who were treated with cellulosic or synthetic membranes, without (Bas) and after LPS (200 ng/ml, 24 h; + LPS) stimulation. Image is representative of five experiments. (B) Densitometric analysis performed on the gels by computer-assisted image analysis system. IL-6R gene expression was normalized to GAPDH and expressed as a ratio. *P < 0.05 versus basal; **P < 0.005 versus basal; °P < 0.05 versus basal control and synthetic.
As shown in Figure 6, IL-6 mRNA expression under basal conditions was significantly (P < 0.005) higher in HD patients who were dialyzed with cellulosic membranes than in healthy control subjects and in patients who were dialyzed with synthetic membranes. LPS stimulation induced a highly significant (P < 0.001) increase of IL-6 gene expression in all groups.
(A) In vitro IL-6 (top) and GAPDH (bottom) gene expression in PBMC from normal subjects (control) and uremic patients who were treated with cellulosic or synthetic membranes, without (Bas) and after LPS (200 ng/ml, 24 h; + LPS) stimulation. Image is representative of five experiments. (B) Densitometric analysis performed on the gels by computer-assisted image analysis system. IL-6 gene expression was normalized to GAPDH and expressed as a ratio. **P < 0.001 versus basal; °P < 0.05 versus basal control and synthetic.
gp130 Alternative Splicing Product in Unstimulated and Stimulated PBMC
To confirm definitively that the HD-induced increase in sgp130 was due to membrane shedding and not to alternative splicing, we investigated by RT-PCR the presence of the 85-bp exon featuring the soluble form of the receptor. As shown in Figure 7, HD patients (both dialyzed with cellulosic and synthetic membranes) and healthy control subjects had a low level of the mRNA specific for sgp130, and, more important, this expression was not modulated by LPS. Noteworthy, we could observe the specific expression of sgp130 only using the double of cDNA used to study gp130 gene expression.
gp130 alternative splicing. The presence of alternative splicing was investigated by reverse transcriptase–PCR, as described in the Materials and Methods section, using a set of primers specific for the 85-bp exon featuring sgp130. Both hemodialysis (HD) patients (cellulosic and synthetic-treated patients) and normal subjects (control) present a low level of the mRNA specific for sgp130, and this expression was not modulated by LPS.
Effects of HD Membrane on Membrane Surface Receptors Expression
The confocal microscopy results of gp130 expression are shown in Figure 8. Under basal conditions, PBMC that were isolated from HD patients who were dialyzed with cellulosic membranes showed an overexpression of gp130 receptor on their cell surface, as compared with PBMC that were isolated from healthy control subjects and patients who had ESRD and were dialyzed with synthetic membranes. LPS induced a striking increase in gp130 expression in all groups.
gp130 protein expression by confocal microscopy in PBMC from normal subjects (control) and uremic patients who were treated with cellulosic or synthetic membranes, without (Basal) and after LPS (200 ng/ml; +LPS) stimulation (24 h). Image is representative of five experiments.
Discussion
The results of our study clearly demonstrate that patients who had ESRD and were dialyzed with cellulosic membranes show circulating levels of sgp130 significantly higher than healthy control subjects and patients who were dialyzed with more biocompatible synthetic membranes.
In this study, we also demonstrated that uremic patients who were dialyzed with a modified cellulosic membrane exhibit a spontaneous sgp130 release by PBMC significantly greater than that observed in both healthy control subjects and patients who had ESRD and were dialyzed with synthetic membranes. Taken together, these results are consistent with our previous studies (22–27) and confirm, in the absence of any dialysate endotoxin contamination, the key role of dialysis membranes in the biocompatibility of dialysis treatment.
The release of sgp130 by PBMC correlated positively with sIL-6R and, more important, with IL-6 release. This finding suggests that inflammatory stimuli may induce an increased synthesis and release of IL-6 by PBMC that is associated with an increased release of both soluble receptors to modulate accurately the effects of this proinflammatory cytokine. It is important to underline that PBMC response to LPS, particularly for IL-6, was considerably reduced in patients who were dialyzed with cellulosic membrane, as compared with other two groups. This phenomenon, already described by our group (24,25,27) and other authors (28), was also observed in cytokine gene expression studies and was explained with exhaustion of recurrently activated PBMC (24,25,27,28).
Our results are in agreement with those by Pereira et al. (29), who suggested that the high circulating levels of IL-1 soluble “antagonistic” receptor (IL-1Ra), observed in their HD patients, should be considered purely as a marker of inflammation, because they are, in their opinion, totally ineffective to counterbalance the negative actions of the corresponding proinflammatory cytokine (29).
We agree only in part with Pereira’s hypothesis. We think, in fact, that although the higher circulating levels of sgp130 found in HD patients who were dialyzed with cellulosic membranes are not adequate to neutralize completely the inflammatory effects of IL-6, a lower concentration or disappearance of this “antagonistic” receptor might really induce an overactivity of IL-6. This hypothesis seems to be supported by studies in mice in which the gene for IL-1Ra was knocked out: A spontaneous development of two distinct serious inflammatory diseases that were similar to rheumatoid arthritis and arteritis observed in humans occurred in these mice (30).
A third result obtained in this study is the understanding of the mechanisms underlying the sgp130 release. We have demonstrated, in fact, that the increased sgp130 release in patients who were treated with cellulosic membranes is almost entirely obtained by shedding of the gp130 present on the cell membrane surface. This is appropriately suggested by the increased gene and protein expression of gp130. Such overexpression indicates an enhanced synthesis of the gp130 membrane receptor followed by its localization on the cell surface, as confirmed by our confocal microscopy studies. In addition, the results obtained with the RT-PCR, using a set of primers specific for the 85-bp exon featuring the alternative spliced form of gp130, failed to show any increased expression in PBMC from patients who were treated with cellulosic membrane. PBMC incubation with LPS confirms the hypothesis that inflammatory stimuli may greatly increase gp130 gene expression, gp130 membrane surface expression, and sgp130 release by shedding; this effect is probably secondary to an increased synthesis and release of MMP by the same PBMC. Recent studies have suggested that proinflammatory cytokines (like IL-18) may upregulate the release of MMP from PBMC, whereas anti-inflammatory cytokines, e.g., IL-10, efficiently downregulate the release of these cell proteases (31).
The biologic activities of IL-6 are modulated by several factors (32,33). In healthy individuals, approximately 30% of circulating IL-6 is free and available for binding to membrane IL-6R. The IL-6/sIL-6R complex (the most important form of IL-6) can bind directly with the membrane gp130, probably because of its high affinity for it. The sgp130 is a potent “antagonist” soluble receptor that neutralizes the binary IL-6/sIL-6R complex (33). The physiologic plasma concentration of sgp130 in healthy individuals (approximately 400 ng/ml) (33) reduces by 55% the concentration of IL-6/sIL-6R. A 10-fold increase in sgp130 concentration reduces IL-6/sIL-6R activity by 87% (33). A simultaneous 10-fold increase of the concentration of both sIL-6R and sgp130 leads to nearly complete neutralization of free IL-6 and most of IL-6/sIL-6R (33). A high circulating level of sIL-6R, therefore, is essential for the modulation of the “antagonistic” activity of sgp130 (34).
Concerning the role of sgp130 on the modulation of the inflammatory state, it is important to underline that proinflammatory cytokines, in addition to their role in host defense, may become mediators of disease; a reduction of cytokine synthesis or effects (by specific anticytokine agents), therefore, might represent a therapeutic target in many diseases (30). Concerning this issue, Jostock et al. (35) obtained a recombinant sgp130 protein that has shown a binding capacity for IL-6/sIL-6R complex to specifically inhibit some IL-6/sIL-6R–mediated IL-6 effects. According to Stenvinkel et al. (10), a specific anticytokine therapy could represent a valuable way to counteract the IL-6–mediated alterations (MIA syndrome) that cause the still unacceptably high cardiovascular mortality of patients with ESRD (36–38).
In conclusion, our study demonstrates that uremic patients who are dialyzed regularly with cellulosic membranes, under basal conditions and in the absence of clinical symptoms, show higher circulating levels and an increased spontaneous release of sgp130 “antagonistic” receptor that is largely due to a shedding of the overexpressed membrane-bound gp130 receptor. The higher circulating levels of sgp130 are probably effective to counterbalance partially the inflammatory effects of IL-6 and, for this reason, might represent an interesting object of study to reduce IL-6–related mortality and morbidity of patients with ESRD.
Acknowledgments
This work was supported by the “Fondo per gli Investimenti della Ricerca di Base” (RBNE012B2K assigned to B.M. from “Ministero dell’Istruzione, dell’Università e della Ricerca,” 2002; by COFIN 2003 assigned to B.M., G.P., and G.G.; and by the Centro Eccellenza Genomica in Campo Biomedico ed Agrario).
Footnotes
Published online ahead of print. Publication date available at www.jasn.org.
- © 2005 American Society of Nephrology
References
Jump to section
More in this TOC Section
Cited By...
- A translational approach to micro-inflammation in end-stage renal disease: molecular effects of low levels of interleukin-6
- Chronic green tea extract supplementation reduces hemodialysis-enhanced production of hydrogen peroxide and hypochlorous acid, atherosclerotic factors, and proinflammatory cytokines