Cell Biology

Nitric Oxide Upregulates Induction of PDGF Receptor-α Expression in Rat Renal Mesangial Cells and in Anti-Thy-1 Glomerulonephritis

Karl-Friedrich Beck, Gülmisal Güder, Liliana Schaefer, Miriam Pleskova, Andrea Babelova, Meik H. Behrens, Daniel Mihalik, Martina Beck, Roland M. Schaefer and Josef Pfeilschifter
JASN July 2005, 16 (7) 1948-1957; DOI: https://doi.org/10.1681/ASN.2004080638

Abstract

PDGF and nitric oxide (NO) have been shown to participate in the progression of several forms of glomerulonephritis. A potential influence of NO on PDGF-mediated signaling cascades was therefore examined. Treatment of rat mesangial cells (MC) with the NO donors diethylenetriamine NO (DETA-NO) or spermine-NONOate resulted in a time- and dose-dependent upregulation of PDGF receptor α (PDGFRα) but not PDGFRβ mRNA levels. Administration of DETA-NO also induced PDGFRα protein expression that was paralleled also by an enhanced receptor phosphorylation. Further experiments using 3-(5-hydroxymethyl-2-furyl)-1-benzylindazole (YC-1), an activator of the soluble guanylyl cyclase (sGC), the membrane-soluble cyclic GMP (cGMP) analog 8-Bromo-PET-cGMP, and the inhibitors of sGC ODQ and NS2028 suggest that elevated cGMP levels are responsible for the effects of NO. Importantly, NO-dependent autophosphorylation of PDGFRα drastically augmented PDGF-AA–evoked phosphorylation of PKB/Akt, a classical downstream target of PDGFRα signaling. Furthermore, in a rat model of anti-Thy-1 glomerulonephritis, expression and phosphorylation of PDGFRα but not PDGFRβ expression was markedly reduced in nephritic animals that were treated with the inducible NO synthase inhibitor l-N6(1-iminoethyl)lysine(dihydrochloride) (L-NIL) compared with non-L-NIL–treated nephritic rats as demonstrated by Western blotting and immunohistochemistry. Taken together, the data suggest that NO modulates PDGFRα-triggered signaling in a cGMP-dependent manner by induction of PDGFRα expression in MC and in a rat model of mesangioproliferative glomerulonephritis. The mechanistic details of this regulation have to be elucidated in further experiments.

Renal mesangial cells (MC) resemble smooth muscle cells, and besides their involvement in the regulation of the GFR, they are important players in glomerular inflammatory diseases (1,2). PDGF is a crucial mitogen for MC and represent a family of cytokines that participate in the course of several forms of glomerulonephritis. To date, four different isoforms of PDGF, namely PDGF-A, PDGF-B, PDGF-C, and PDGF-D, were characterized. PDGF-A and PDGF-B constitute homodimers or heterodimers (PDGF-AA, PDGF-BB, or PDGF-AB) and bind to two receptor isoforms, PDGFRα and PDGFRβ, that also aggregate to homodimers and heterodimers. PDGF-BB activates all combinations of PDGF receptor subunits, whereas PDGF-AA acts specifically on PDGFRα homodimers (3). Recently, two further isoforms, PDGF-C and PDGF-D, were characterized. Both growth factors act as homodimers that represent protease-activated ligands specific for the PDGFRα and PDGFRβ homodimers, respectively (4,5). The PDGF receptors consist of five extracellular Ig-like domains and an intracellular tyrosine kinase domain (6). The different receptor subtypes trigger more or less similar signaling cascades that lead mainly to proliferative signals to the cell but also mediate chemotaxis or changes in actin cytoskeleton organization (7). Interestingly, in most cell types, the β-receptor subtype is constitutively expressed, whereas the expression of PDGFRα is tightly controlled by different mitogenic or inflammatory stimuli (8,9). MC constitutively secrete PDGF-A at low levels, which may serve to downregulate PDGFRα expression and prevent proliferative responses (10). Unopposed proliferation of MC and extensive matrix expansion are hallmarks of different forms of glomerulonephritis and PDGF has been shown to be the main player in a complex network of growth factors and inflammatory mediators in the course of kidney diseases (3,9,11).

Renal MC synthesize nitric oxide (NO) after induction of the inducible form of the NO synthase (iNOS) by cytokines (12). In MC, high amounts of NO, which can be generated by the activity of iNOS, mediate cytotoxicity, and apoptosis (13,14). Moreover, NO is a potent mediator of gene expression in MC. This regulation occurs via the activation of the guanylyl-cyclase or by NO-induced changes of the redox state of the cell (15,16).

Since Cattell et al. reported on the synthesis of NO in glomeruli in experimental nephrotoxic nephritis in the rat (17), the role of NO as a modulator of inflammatory kidney diseases has been thoroughly investigated. Remarkably, in a rat model of anti-Thy-1 glomerulonephritis administration of the NOS inhibitor NG-monomethyl-l-arginine (L-NMMA) drastically reduced mesangiolysis, indicating a role for NO in mediating cell death (18). This observation was further corroborated by results that demonstrate that selective blockage of iNOS activity by l-N6(1-iminoethyl)lysine(dihydrochloride) (L-NIL) drastically reduces mRNA and protein levels of the chemoattractant MIP-2, and subsequently prevents neutrophil invasion (19). By contrast, in a chronic model of the disease, the activity of iNOS is necessary to prevent intraglomerular coagulation and fibrosis (20,21).

In cultured MC, PDGF induces proliferation (3), whereas NO antagonizes proliferative signals in MC (22,23). Importantly, PDGF inhibits cytokine-induced iNOS expression in MC (24,25), and this may shift the balance toward a proliferative state. In addition, NO was found to inhibit the expression of SPARC (secreted protein acidic and rich in cysteine), a potent inhibitor of PDGF signaling (26,27), and this may further contribute to a proliferative setting in the course of inflammatory glomerular diseases. Obviously PDGF and NO act in an opposing manner, and we provide a further facet in this study by analyzing the effects of NO on the expression of the different PDGFR isoforms PDGFRα and PDGFRβ.

Materials and Methods

Reagents

Human recombinant IL-1β was obtained from Cell Concept (Umkirch, Germany). Nylon blotting membranes were purchased from NEN Life Science Products (Köln, Germany), Immobilon P (polyvinylidene difluoride) membranes (Millipore Eschborn, Germany), media and sera were from Life Technologies-BRL (Eggstein, Germany), and tissue culture plastic was from Falcon (Becton-Dickinson, Heidelberg, Germany). (Z)-1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA-NO), (Z)-1-{N-[-aminopropyl]-N-[4-(3-aminopropylammonio) butyl]-amino}-diazen-1-ium-1,2-diolate] (spermine NONOate, 1H-(1,2,4)oxadiazole[4,3-a]quinoxalin-1-one (ODQ), 4H-8-bromo-1,2,4-oxadiazolo(3,4-d)benz(b) (1,4)oxazin-1-one (NS-2028), 3-(5-hydroxymethyl-2-furyl)-1-benzylindazole (YC-1), L-NMMA, and L-NIL were purchased from Alexis (Grünberg, Germany); PDGF-AA was from Biomol (Hamburg, Germany). PDGF-BB and all other chemicals were purchased from Sigma (Deisenhofen, Germany). Polyclonal affinity purified antibodies against PDGFRα, PDGFRβ (rabbit), as well as against the phosphorylated forms of p-PDGFRα (Tyr 720), PDGFRα (Tyr 731), and PDGFRα (Tyr 857) (all goat), actin (goat), and a monoclonal antibody against β-tubulin (mouse) were from Santa Cruz Biotechnologies (Heidelberg, Germany). A sheep polyclonal antibody used for the detection of PKB/Akt was from Biomol. A rabbit polyclonal antibody against serine phosphorylated PKB/Akt (pSer-473) was purchased from New England Biolabs (Frankfurt, Germany). Secondary horseradish peroxidase conjugated antibodies for goat, mouse, rabbit, or sheep IgG were purchased from Santa Cruz Biotechnologies.

Cell Culture

Rat glomerular MC were cultivated as described previously (28) and grown in RPMI 1640 medium supplemented with 10% FCS, 2 mM glutamine, 5 ng/ml insulin, 100 U/ml penicillin, and 100 μg/ml streptomycin. Quiescent cells were obtained by incubating MC for 24 h in serum-free Dulbecco’s minimal essential medium supplemented with 0.1 mg/ml of essentially fatty acid-free BSA before stimulation with cytokines or NO donors. Most experiments were conducted using DETA-NO as an NO donor that slowly releases NO and decomposes after first-order kinetics. We tested this compound previously and determined a half-life of 16.5 h under comparable conditions that we used for this study (29). This fits well to the half-life of 20 h reported in the literature (30). To confirm our results obtained with DETA-NO, we also used spermine NONOate, which decomposes with a half-life of 39 min (31). MC were used between passages 12 and 18.

Nitrite Determination

Determination of the stable NO oxidation product nitrite in culture supernatants was performed using the Griess method (32).

Isolation of Total RNA, Reverse-Transcription, Semiquantitative, and Quantitative PCR

Total RNA from MC was isolated as described previously (33). For reverse-transcriptase PCR (RT-PCR), 2 μg total RNA were reversed-transcribed with reverse-transcriptase (MBI-Fermentas, St. Leon-Rot, Germany). Thereafter, semiquantitative PCR was performed with 22 cycles (30 s at 94°C; 45 s at 53°C, 60 s at 72°C) using the PDGFRα-specific primers (5′-ATGTTTCTAGACTCGCAGCTCA 3′ and 5′-ATAAACAAAGGCAGTGATACAG-3′; Invitrogen, Karlsruhe, Germany) and the PDGFRβ-specific primers (5′-TCCAGCTGTGCCTCAGGCTCTG-3′ and 5′-GACCAGTTCTACAATGCCATCA-3′) that were designed according the sequences deposited in the GENBANK library [accession number: M63837 (34) and AY090783, respectively]. To correct for unequal amounts of RNA, a further PCR reaction was performed using primers 5′-CCTTCATTGACCTCAACTAC-3′ and 5′-GGAAGGCCATGCCAGTGAGC-3′ specific for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA. The PCR products were run in a 1% agarose gel and analyzed using a GelDoc system (BioRad, München, Germany).

Quantitative PCR was performed using a GeneAmp 7700 System (Applied Biosystems, Weiterstadt, Germany) according to the manufacturers instructions). The reactions were performed with 40 cycles (15 s at 95°C; 1 min at 60°C). Each sample was measured in triplicate. Quantification was performed using the ΔΔCt method. The following oligonucleotides were used for real-time PCR:

Forward primer: 5′ ATCAGGCCCACCTTTGGC 3′ (1084-1101)

Reverse primer: 5′ GGTAGGCCTGCACCTCCAC 3′ (1162-1144)

TaqMan probe: 5′ TGGAAACTGTGAACCTGCATCAGGTCAG 3′ (1106-1133)

To correct for unequal amounts of RNA, mRNA levels for GAPDH were analyzed using a primer set provided by Applied Biosystems.

Western Blot Analysis

Homogenates of MC or of isolated glomeruli were boiled for 5 min in Laemmli buffer and subjected to SDS-PAGE (7.5% acrylamide gel). After transfer to a polyvinylidene difluoride membrane PDGFRα, p-PDGFRα, PDGFRβ, p-PDGFRβ, PKB, and p-PKB were detected by using the respective antibodies. Suitable secondary antibodies and the ECL detection system (Amersham, Braunschweig, Germany) were used to visualize protein signals. To demonstrate equal loading, blots were stripped and analyzed with a monoclonal antibody against α-actin or β-tubulin.

In Vivo Model of Anti-Thy-1 Glomerulonephritis

All animal experiments were conducted according to the German law for protection of animals. Anti-Thy-1 glomerulonephritis (anti-Thy-1-GN) was induced in adult male Wistar rats weighing 180 to 200 g (Charles-River, Sulzfeld, Germany) by a single intravenous injection of mouse anti-rat Thy-1.1 IgG, clone OX-7 (BioTrend, Cologne, Germany) at a dose of 1 mg/kg body weight. Control animals were receiving a single intravenous injection of PBS only. Previous results from our group showed expression of iNOS in isolated glomeruli from anti-Thy-1 nephritic rats between 1 h and 16 h after injection of the antibody (19). To find out the maximal effect of NO on the expression of PDGFRα, kidneys were harvested at 2, 4, 8, 16, and 24 h (data not shown) and all further experiments were performed 16 h after induction of the disease.

L-NIL, a selective inhibitor of iNOS was administered intravenously at a dose of 5mg/kg body weight to control and nephritic rats 45 min before anti-Thy 1-GN was induced. Systolic BP was monitored by tail plethysmography (35). Animals were anesthetized with hexobarbital (150 mg/kg). Kidneys were removed and glomeruli were isolated as described by Krakower (36) by sequential sieving. Glomeruli from each kidney preparation were washed three times, examined by light microscopy (purity of isolates >95%), counted thrice in a Fuchs-Rosenthal chamber, and processed for Western blotting.

Immunohistochemistry

Kidney tissue samples were fixed in 4% formaldehyde in PBS and embedded in paraffin. Sections (4-μm) were stained with periodic acid-Schiff reaction and processed for immunohistochemical studies by immunoperoxidase techniques (37). Before incubation with the primary antibody, endogenous peroxidase was blocked with 0.2% hydrogen peroxidase in methanol and endogenous biotin was blocked using the Avidin/Biotin Blocking Kit (Vector Lab, Burlingame, CA). Primary antibodies included affinity-purified rabbit anti-human PDGFRα, goat–anti-human phospho-PDGFRα (Tyr720) phosphorylated at Tyr720 and rabbit–anti-human PDGFRβ, which react with the respective forms of PDGFRα or PDGFRβ of rat origin (dilution 1:200, applied for 1 h at 37°C), respectively. Unspecific binding was blocked with 4% fat-free milk powder/Tris-buffered saline/0.1% Triton X-100 followed by incubation for 1 h at 37°C with an affinity-purified biotinylated goat anti-rabbit IgG (Vector Lab; dilution 1:200) or biotinylated rabbit–anti-goat IgG (Dianova, Hamburg, Germany; dilution 1:200), respectively. To complete the sandwich technique the conjugate of extravidin-peroxidase (Sigma, Munich, Germany; dilution 1:500) was applied for 1 h at 37°C and sections were developed with the Diaminobenzidine Substrate Kit (Vector Lab). Counterstaining was performed with methyl green. The specificity of immunostaining was tested by omitting the primary antibody and by using nonimmune serum “unspecific” IgG.

Statistical Analyses

Data are expressed as percent of controls (mean ± SD). Significance was tested by Student t test or ANOVA (ANOVA) and P < 0.05 were considered to be statistically significant.

Results

Effects of DETA-NO on PDGFRα and PDGFRβ mRNA Expression

To test whether PDGFRα and PDGFRβ mRNA are present in MC and affected by NO, cells were stimulated for different time periods with DETA-NO (100 μM) and total RNA from DETA-NO treated and untreated MC was subjected initially to semiquantitative RT-PCR. A significant increase of PDGFRα mRNA levels was observed between 2 h and 12 h of DETA-NO treatment and PDGFRα expression declined to basal levels after 24 h (Figure 1). By contrast, administration of DETA-NO exerted no significant changes in PDGFRβ mRNA steady-state levels (Figure 1). The time- and concentration-dependency of the effects of NO on PDGFRα mRNA expression were further analyzed by quantitative RT-PCR. To this end, rat MC were treated for 2, 8, 12, 24, and 32 h with DETA-NO and total mRNA was subjected to real-time PCR. Similarly to the results obtained by semiquantitative RT-PCR, a marked increase of PDGFRα mRNA steady-state levels was observed after 2 h that returned nearly to basal levels after 24 h (Figure 2a). In a next step, we determined the concentration of DETA-NO sufficient to induce PDGFRα expression. MC were treated for 8 h with different concentrations of DETA-NO. As shown in Figure 2b, 25 μM DETA-NO were sufficient to significantly increase PDGFRα mRNA steady-state levels. Maximal induction was reached at 50 μM DETA-NO and higher doses of DETA-NO were not able to further enhance PDGFRα mRNA expression. To exclude NO-independent effects of DETA-NO, MC were treated with spermine NONOate, a second NO donor. Comparable to the dose response data obtained by treatment with DETA-NO, a concentration of 25 μM was sufficient to markedly increase PDGFRα mRNA steady-state levels (Figure 2c).

Figure 1.
Figure 1.

Analysis of nitric oxide (NO)-mediated PDGFRα and PDGFRβ mRNA expression by semiquantitative reverse-transcriptase (RT)-PCR. Quiescent mesangial cells (MC) were treated with DETA-NO (100 μM) for the indicated time periods Thereafter, mRNA was extracted and RT-PCR was performed using oligonucleotides specific for rat PDGFRα, PDGFRβ, or for GAPDH. The products were analyzed on a 1% agarose gel (a). Data are expressed as 100% of unstimulated controls and are means ± SD for densitometrical analysis for PDGFRα (gray bars) and PDGFRβ (white bars) corrected for GAPDH. *P < 0.05 versus unstimulated controls (b).

Figure 2.
Figure 2.

Quantitative real-time PCR analysis of NO-mediated PDGFRα expression. Quiescent MC were treated for the indicated time periods with DETA-NO (a) or for 8 h with the indicated concentrations DETA-NO (b) or spermine-NONOate (c) or vehicle (con), respectively. Each 100-ng reverse-transcribed cDNA was subjected to real-time PCR using primers and probes for PDGFRα and GAPDH. The time-dependent effects of DETA-NO on PDGFRα mRNA expression were calculated by dividing ΔΔCT values for stimulated cells (NO) by ΔΔCT values of unstimulated controls (c). Data are expressed as fold increase ΔΔCT(NO)/ ΔΔCT(c), means ± SD of three independent experiments (*P < 0.05 versus unstimulated controls) are depicted in (a). Data shown in (b) and (c) are expressed as fold increase (means ± SD of three independent experiments, *P < 0.05 versus unstimulated controls).

Effects of DETA-NO on PDGFRα Protein Expression and PDGFRα Autophosphorylation

To confirm that changes in the mRNA steady-state levels are followed by an increase of PDGFRα protein, quiescent MC were stimulated for different time periods with DETA-NO (100 μM) and total protein extracts were subjected to Western blotting. PDGFRα protein levels were markedly increased after 5 h and declined nearly to control levels after 48 h of DETA-NO treatment (Figure 3a). Different concentrations of DETA-NO enhanced PDGFRα protein levels approximately two-fold, as shown in Figure 3b; 5 μM DETA-NO was sufficient to significantly increase PDGFRα protein levels (Figure 3b). The PDGF receptor tyrosine kinase becomes activated by autophosphorylation of tyrosine residues, which leads to the activation of downstream signaling cascades like the PI3 kinase pathway (38). To test whether the effect of NO on PDGFRα expression is functionally relevant and results in an enhanced phosphorylation of the receptor, MC were treated for 15 h with different concentrations of DETA-NO and, to induce receptor phosphorylation, additionally with PDGF-BB (20 ng/ml) 15 min before preparation of cellular extracts for Western blotting. As displayed in Figure 4a, the phosphorylation of PDGFRα on Tyr 720 in DETA-NO–treated samples was comparable to the NO-mediated changes in PDGFRα protein expression, at least at lower concentrations of DETA-NO (Figure 3b). This indicates that the enhanced phosphorylation at Tyr720 is a result of enhanced PDGFRα expression rather than a result of NO-mediated changes in the tyrosine kinase/tyrosine phosphatase equilibrium. Analysis of the same samples with a PDGFRα phospho-Tyr731 antibody resulted in a comparable staining as for Tyr 720 (data not shown), indicating that NO and PDGF-BB treatment similarly affects phosphorylation sites of the receptor. Similar experiments were performed using an antibody that recognizes the phosphorylated form of PDGFRβ. No differences in PDGFRβ phosphorylation could be detected (Figure 4b).

Figure 3.
Figure 3.

Analysis of NO-mediated PDGFRα protein expression. Quiescent MC were treated with DETA-NO (100 μM) for the indicated time periods (a) or for 15 h with the indicated concentrations of DETA-NO (b). Thereafter, total protein was subjected to Western blotting and PDGFRα expression was analyzed using a PDGFRα specific antibody. Blots were reprobed using an antibody specific for α-actin. Bands for PDGFRα and α-actin were visualized using the ECL system and analyzed by densitometry. Values for PDGFRα were corrected for α-actin. Data shown in the upper panels are means ± SD. *P < 0.05 versus unstimulated controls (c).

Figure 4.
Figure 4.

DETA-NO–induced phosphorylation of PDGFRα (a) and PDGFRβ (b). To analyze phosphorylation of the PDGF receptors, MC were treated for 15 h with the indicated concentrations of DETA-NO and additionally for 15 min with PDGF-BB to force autophosphorylation of the receptor subtypes. A representative Western blot experiment for p-PDGFRα (Tyr 720) is shown in (a). Data analysis was performed after reprobing the blot with an α-actin antibody as described for Figure 3. Data shown in the upper panel are means ± SD. *P < 0.05 versus unstimulated controls. A representative Western blot experiment for PDGFRβ in which an antibody for β-tubulin was used to correct for unequal loading is shown in (b).

Effect of NO on PDGFRα Expression Is Mediated by Cyclic GMP

A significant effect of low amounts of NO suggests a cyclic GMP (cGMP)-directed mechanism rather than a direct effect of NO on PDGFRα expression (15,39,40). Therefore, we tested the effects of ODQ, an inhibitor of the soluble guanylyl cyclase (sGC), as well as the synthetic activator of sGC YC-1 on PDGFRα expression. ODQ (200 μM) completely blocked the effect of DETA-NO (100 μM and 200 μM) on PDGFRα expression (Figure 5). A comparable inhibition was seen with NS-2028, a second sGC inhibitor (data not shown). Furthermore, YC-1 (10 μM and 30 μM) mimicked the DETA-NO effects and markedly upregulated PDGFRα protein levels (Figure 5a). In addition, the membrane soluble cGMP analog 8-Br-PET-cGMP concentration-dependently upregulated PDGFRα protein levels (Figure 5b). These data clearly indicate a cGMP-dependent action of NO on PDGFRα expression.

Figure 5.
Figure 5.

Effects of cGMP, YC-1, and inhibition of sGC activity on PDGFRα expression. Quiescent MC were treated as indicated for 15 h and total protein was subjected to Western blotting using antibodies against PDGFRα and α-actin. Values for PDGFRα were corrected for α-actin. Data shown in the bar graph (a) are means ± SD. *P < 0.05 versus DETA-NO, &P < 0.05 versus unstimulated controls. A representative blot of four similar experiments to examine the effects of 8-Br-PET-cGMP on PDGFRα expression is shown in (b).

Effects of Endogenously Produced NO on PDGFRα Expression

Recently, Fukuoka et al. (41) reported that IL-1β induces PDGFRα expression at the transcriptional level via the transcription factors CCAAT/enhancer-binding protein β and δ in vascular smooth muscle cells. To elucidate whether IL-1β triggers PDGFRα expression also in MC and to test whether endogenously produced NO takes part in IL-1β–induced PDGFRα expression, MC were stimulated with IL-1β (0.3 nM) and, to block endogenous NO formation, additionally with different concentrations of the NOS inhibitor L-NMMA for 24 h. In IL-1β–treated MC, PDGFRα expression and NO formation (measured as nitrite, data not shown) was drastically increased (Figure 6). Co-administration of L-NMMA reduced IL-1β–evoked PDGFRα expression in part (Figure 6) and blunted IL-1β–induced NO formation (data not shown). We conclude from these data that endogenously produced NO at least partially triggers IL-1β–driven PDGFRα expression.

Figure 6.
Figure 6.

Effects of endogenously produced NO on PDGFRα expression in MC. Quiescent MC were treated as indicated for 24 h and total protein was subjected to Western blotting using antibodies against PDGFRα and α-actin. Values for PDGFRα were corrected for α-actin. Data shown in the upper panel are means ± SD. *P < 0.05 versus unstimulated controls.

NO-Directed PDGFRα Expression Mediates Enhanced Susceptibility for PDGF-AA–Induced PKB/Akt Phosphorylation

PDGF signaling results in an activation of the PI3 kinase, followed by phosphorylation of PKB/Akt. To analyze further downstream signaling events triggered by NO-induced PDGFRα expression, MC were forced to increase PDGFRα expression by prestimulation with DETA-NO for 15 h. Thereafter, the cells were treated with PDGF-AA (20 ng/ml) for 15 min and subsequently extracts were analyzed for phosphorylated PDGFRα (pTyr720), phosphorylated PKB/Akt (pSer 473), and total PKB/Akt. As displayed in Figure 7, prestimulation of MC with NO results in an enhanced phosphorylation of the PDGFRα as well as PKB on PDGF-AA exposure, thus demonstrating the functional relevance of NO-induced upregulation of PDGFRα expression.

Figure 7.
Figure 7.

Effects of NO on PDGFRα triggered PKB/Akt phosphorylation. Quiescent MC were stimulated with (D) or without (c) DETA-NO [100 μM] for 15 h. Thereafter, phosphorylation of PDGFRα was induced by adding PDGF-AA (20 ng/ml) for 15 min. Each 80-μg protein was subjected to Western blotting using specific antibodies for phosphorylated PDGFRα (pTyr 720), phosphorylated PKB/Akt(p-PKB/Akt), and an antibody that reacts with PKB/Akt protein independently from its phosphorylation, respectively Three experiments were analyzed densitometrically and the data for p-PKB/Akt are shown in the upper panel are expressed as means ± SD. *P < 0.05 versus unstimulated controls.

NO-Dependent Regulation or PDGFRα in Anti-Thy-1 Glomerulonephritis

To test whether the NO-mediated upregulation of PDGFRα observed in cultured MC occurs also in vivo, we analyzed PDGFRα expression in a rat model of anti-Thy-1 glomerulonephritis. This model of mesangioproliferative nephritis shows a potent induction of the inducible NOS in the glomerulus and is therefore well suited to analyze NO-driven gene expression in vivo (19,42,43). Western blot experiments using glomerular protein extracts revealed a marked upregulation of PDGFRα expression in rat glomeruli 16 h after injection of the anti-Thy1.1 antibody (Figure 8). This effect was markedly reduced in rats that were additionally treated with the iNOS-specific inhibitor L-NIL, indicating a role for NO in PDGFRα expression in vivo (Figure 8). To further evaluate whether the enhanced expression of PDGFRα observed in whole glomeruli is mediated by MC, immunohistochemistry was performed and PDGFRα expression was studied using antibodies specific for unphosphorylated and phosphorylated forms of the receptor. In accordance to the results obtained by Western blotting, staining for PDGFRα (Figure 9a) or phospho-PDGFRα (Tyr 720) (Figure 9b) was reduced in MC of nephritic rats that received L-NIL to block iNOS-driven NO formation when compared with vehicle-treated nephritic rats (Figure 9). Furthermore, these effects were specific for PDGFRα, because the immunostaining pattern and intensity of PDGFRβ remained either unchanged or was slightly decreased in some glomeruli from nephritic rats and no differences were seen between nephritic rats which received L-NIL or vehicle (Figure 9c).

Figure 8.
Figure 8.

Western blot analysis of PDGFRα in isolated glomeruli from control and THY-1-GN rats. (A) One example of a Western blot for PDGFRα in equal amounts of isolated glomeruli from control and nephritic rat kidneys (16 h) with and without administration of L-NIL. (B) Quantification of Western blots for PDGFRα (six samples in each group) is given as optical density (OD) from 103 of glomeruli (means ± SEM). An asterisk positioned directly over the bar indicates significant differences between THY 1-nephritic and non-nephritic glomeruli. The asterisk between gray and striped gray bars indicates statistical differences between Thy-1–nephritic glomeruli with or without L-NIL treatment, P < 0.05.

Figure 9.
Figure 9.

Immunostaining for PDGFRα (A), p-PDGFRα (Tyr720) (B), and PDGFRβ (C) in glomeruli from control and THY-1-GN kidneys. In Thy 1 nephritis, there was increased mesangial staining for PDGFRα (A) (brown color) and its phosphorylated form (B) (brown color) 16 h after induction of disease. Pretreatment with L-NIL reduced the intensity of staining for the phosphorylated and unphosphorylated PDGFRα. In contrast, the immunostaining pattern and intensity of PDGFRβ remained either unchanged or slightly decreased in some glomeruli from nephritic rats without differences between nephritic rats that received L-NIL or vehicle (C) (brown color). There was no difference in controls receiving L-NIL or vehicle. Negative controls, shown here in a tissue section from a Thy-1–nephritic kidney as an example, were performed by omitting the primary antibodies. The bar indicates magnification.

Discussion

Both PDGF and NO have an important impact on the development and the course of several forms of inflammatory kidney diseases. At least in part, PDGF and NO act in an opposing manner. PDGF has been characterized as the main mediator of mesangial cell proliferation that may be followed by matrix deposition and eventually by sclerosis and scarring (9,11,44). Large amounts of NO that are produced by iNOS after exposure of MC or invading monocytes to inflammatory cytokines exert toxic, pro-apoptotic, and anti-proliferative effects on MC in the inflamed glomerulus. Furthermore, NO potently triggers gene expression in MC and a series of genes was found to be under the expressional control by NO (15,45). NO exerts its effects by cGMP-dependent and cGMP-independent pathways (15,37,45). Moreover, NO-driven regulation of gene expression may occur at the transcriptional, post-transcriptional, or post-translational level (19,46,47), thereby inducing the expression of both protective and harmful gene products.

An inhibition of cytokine-induced iNOS expression by PDGF has been shown earlier in rat MC (24,25). Therefore, PDGF may be ideally suited to limit an extensive and deleterious NO formation observed in the early phases of glomerulonephritis (19,48). Because PDGF affects NO formation, it is tempting to speculate that NO in turn may also regulate the PDGF systems to maintain a homeostasis of both factors in a given setting. In line with these considerations, Callsen et al. (49) demonstrated an enhanced phosphorylation of PDGFRβ induced by the NΟ donor S-nitrosoglutathione, which results from an inhibition of a phosphotyrosine phosphatase activity that targets the PDGFR in rat MC. NO-mediated phosphorylation of PDGFRβ may force cell proliferation and may therefore antagonize the anti-proliferative effect of NO. We analyzed the effects of NO on PDGF receptor expression and phosphorylation and observed that NO selectively induces PDGFRα but not PDGFRβ expression. Moreover, prestimulation of MC with the NO donor DETA-NO led to an enhanced PDGF-mediated downstream signaling as documented by the phosphorylation of protein kinase PKB/Akt. Therefore, NO obviously modulates PDGF signaling of both receptor subtypes by different mechanisms: the activity of PDGFRβ is modulated by high amounts of NO in a redox-dependent manner involving the inhibition of a protein phosphatase activity (49). By contrast, PDGFRα activity is enhanced by an increased receptor expression induced by low amounts of NO via an activation of the sGC/cGMP signaling pathway. This may provide an elegant mode of action by which MC are able to react to a range of concentrations of NO serving to fine-tuning PDGF-triggered signaling cascades. In this context, it is worth mentioning that MC constitutively secrete PDGF-AA that serves to downregulate PDGFRα surface expression. NO may overcome this physiologic feedback mechanism and reconstitute PDGFRα signaling. However, the detailed mechanisms that lead to the observed NO/cGMP-driven changes in PDGFRα expression have to be elucidated in further experiments.

Importantly, this NO-mediated changes in PDGFRα expression observed in cultured MC correlate well with data obtained in the rat model of anti-Thy-1 glomerulonephritis, suggesting that NO also impacts on PDGF signaling in vivo. In agreement with previous studies, the expression of PDGFRβ remained unchanged or was even slightly reduced in some glomeruli at early stages of anti-Thy-1 glomerulonephritis (50) and appeared to be not influenced by NO. The detailed knowledge of the crosstalk between NO and PDGF signaling may help to improve strategies for the treatment of mesangioproliferative glomerular diseases, in particular when blockage of NO formation or antagonization of growth factor signaling are considered.

Acknowledgments

Ute Schmidt’s valuable technical assistance is gratefully acknowledged. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 553, SFB 492, and PF 361/1-2), the Interdisciplinary Center of Clinical Research Münster (Schae2/004/04), and IMF SC 11 04 07.

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

    K.-F.B. and G.G. contributed equally to this work.

References

  1. ↵
    Pfeilschifter J: Cross-talk between transmembrane signalling systems: A prerequisite for the delicate regulation of glomerular haemodynamics by MC. Eur J Clin Invest 19 : 347 –361, 1989
    OpenUrlCrossRefPubMed
  2. ↵
    Pfeilschifter J: Mesangial cells orchestrate inflammation in the renal glomerulus. News Physiol Sci 9 : 271 –276, 1994
    OpenUrl
  3. ↵
    Abboud HE: Role of platelet-derived growth factor in renal injury. Annu Rev Physiol 57 : 297 –309, 1995
    OpenUrlCrossRefPubMed
  4. ↵
    Li X, Ponten A, Aase K, Karlsson L, Abramsson A, Uutela M, Backstrom G, Hellstrom M, Bostrom H, Li H, Soriano P, Betsholtz C, Heldin CH, Alitalo K, Ostman A, Eriksson U: PDGF-C is a new protease-activated ligand for the PDGFalpha-receptor. Nat Cell Biol 2 : 302 –309, 2000
    OpenUrlCrossRefPubMed
  5. ↵
    Bergsten E, Uutela M, Li X, Pietras K, Ostman A, Heldin CH, Alitalo K, Eriksson U: PDGF-D is a specific, protease-activated ligand for the PDGFbeta-receptor. Nat Cell Biol 3 : 512 –516, 2001
    OpenUrlCrossRefPubMed
  6. ↵
    Yarden Y, Escobedo JA, Kuang WJ, Yang-Feng TL, Daniel TO, Tremble PM, Chen EY, Ando ME, Harkins RN, Francke U, Fried AV, Ulrich A, Williams LT: Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors. Nature 323 : 226 –232, 1986
    OpenUrlCrossRefPubMed
  7. ↵
    Heldin CH, Westermark B: Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 79 : 1283 –1316, 1999
    OpenUrlCrossRefPubMed
  8. ↵
    Wang C, Stiles CD: Platelet-derived growth factor alpha receptor gene expression: Isolation and characterization of the promoter and upstream regulatory elements. Proc Natl Acad Sci U S A 91 : 7061 –7065, 1994
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Johnson RJ, Floege J, Couser WG, Alpers CE: Role of platelet-derived growth factor in glomerular disease. J Am Soc Nephrol 4 : 119 –128, 1993
    OpenUrlAbstract
  10. ↵
    Pfeilschifter J, Hosang M: Effects of homo- and heterodimeric isoforms of PDGF on signalling events in rat renal mesangial cells. Cell Signal 3 : 413 –424, 1991
    OpenUrlCrossRefPubMed
  11. ↵
    Johnson RJ, Raines EW, Floege J, Yoshimura A, Pritzl P, Alpers C, Ross R: Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor. J Exp Med 175 : 1413 –1416, 1992
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Pfeilschifter J, Schwarzenbach H: Interleukin 1 and tumor necrosis factor stimulate cGMP formation in rat renal mesangial cells. FEBS Lett 273 : 185 –187, 1990
    OpenUrlCrossRefPubMed
  13. ↵
    Mühl H, Sandau K, Brüne B, Briner VA, Pfeilschifter J: Nitric oxide donors induce apoptosis in glomerular mesangial cells, epithelial cells and endothelial cells. Eur J Pharmacol 317 : 137 –149, 1996
    OpenUrlCrossRefPubMed
  14. ↵
    Hruby Z, Beck KF: Cytotoxic effect of autocrine and macrophage-derived nitric oxide on cultured rat mesangial cells. Clin Exp Immunol 107 : 76 –82, 1997
    OpenUrlCrossRefPubMed
  15. ↵
    Pfeilschifter J, Eberhardt W, Beck KF: Regulation of gene expression by nitric oxide. Pflügers Arch 442 : 479 –486, 2001
    OpenUrlCrossRefPubMed
  16. ↵
    Pfeilschifter J, Beck KF, Eberhardt W, Huwiler A: Changing gears in the course of glomerulonephritis by shifting superoxide to nitric oxide-dominated chemistry. Kidney Int 61 : 809 –815, 2002
    OpenUrlCrossRefPubMed
  17. ↵
    Cattell V, Cook T, Moncada S: Glomeruli synthesize nitrite in experimental nephrotoxic nephritis. Kidney Int 38 : 1056 –1060, 1990
    OpenUrlPubMed
  18. ↵
    Narita I, Border WA, Ketteler M, Noble NA: Nitric oxide mediates immunologic injury to kidney mesangium in experimental glomerulonephritis. Lab Invest 72 : 17 –24, 1995
    OpenUrlPubMed
  19. ↵
    Walpen S, Beck KF, Schaefer L, Raslik I, Eberhardt W, Schaefer RM, Pfeilschifter J: Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J 15 : 571 –573, 2001
    OpenUrlCrossRefPubMed
  20. ↵
    Westenfeld R, Gawlik A, de Heer E, Kitahara M, Abou-Rebyeh F, Floege J, Ketteler M: Selective inhibition of inducible nitric oxide synthase enhances intraglomerular coagulation in chronic anti-Thy 1 nephritis. Kidney Int 61 : 834 –838, 2002
    OpenUrlCrossRefPubMed
  21. ↵
    Peters H, Daig U, Martini S, Ruckert M, Schaper F, Liefeldt L, Kramer S, Neumayer HH: NO mediates antifibrotic actions of L-arginine supplementation following induction of anti-thy1 glomerulonephritis. Kidney Int 64 : 509 –518, 2003
    OpenUrlCrossRefPubMed
  22. ↵
    Rupprecht HD, Akagi Y, Keil A, Hofer G: Nitric oxide inhibits growth of glomerular mesangial cells: Role of the transcription factor EGR-1. Kidney Int 57 : 70 –82, 2000
    OpenUrlCrossRefPubMed
  23. ↵
    Garg UC, Hassid A: Inhibition of rat mesangial cell mitogenesis by nitric oxide-generating vasodilators. Am J Physiol 257 : F60 –F66, 1989
  24. ↵
    Pfeilschifter J: Platelet-derived growth factor inhibits cytokine induction of nitric oxide synthase in rat renal mesangial cells. Eur J Pharmacol 208 : 339 –340, 1991
    OpenUrlCrossRefPubMed
  25. ↵
    Kunz D, Walker G, Eberhardt W, Messmer UK, Huwiler A, Pfeilschifter J: Platelet-derived growth factor and fibroblast growth factor differentially regulate interleukin 1beta- and cAMP-induced nitric oxide synthase expression in rat renal mesangial cells. J Clin Invest 100 : 2800 –2809, 1997
    OpenUrlCrossRefPubMed
  26. ↵
    Pichler RH, Bassuk JA, Hugo C, Reed MJ, Eng E, Gordon KL, Pippin J, Alpers CE, Couser WG, Sage EH, Johnson RJ: SPARC is expressed by mesangial cells in experimental mesangial proliferative nephritis and inhibits platelet-derived-growth-factor-medicated mesangial cell proliferation in vitro. Am J Pathol 148 : 1153 –1167, 1996
    OpenUrlPubMed
  27. ↵
    Walpen S, Beck KF, Eberhardt W, Apel M, Chatterjee PK, Wray GM, Thiemermann C, Pfeilschifter J: Downregulation of SPARC expression is mediated by nitric oxide in rat mesangial cells and during endotoxemia in the rat. J Am Soc Nephrol 11 : 468 –476, 2000
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Pfeilschifter J, Vosbeck K: Transforming growth factor beta2 inhibits interleukin 1beta- and tumour necrosis factor alpha-induction of nitric oxide synthase in rat renal mesangial cells. Biochem Biophys Res Commun 175 : 372 –379, 1991
    OpenUrlCrossRefPubMed
  29. ↵
    Mühl H, Chang JH, Huwiler A, Bosmann M, Paulukat J, Ninic R, Nold M, Hellmuth M, Pfeilschifter J: Nitric oxide augments release of chemokines from monocytic U937 cells: Modulation by anti-inflammatory pathways. Free Radic Biol Med 29 : 969 –980, 2000
    OpenUrlCrossRefPubMed
  30. ↵
    Maragos CM, Morley D, Wink DA, Dunams TM, Saavedra JE, Hoffman A, Bove AA, Isaac L, Hrabie JA, Keefer LK: Complexes of NO with nucleophiles as agents for the controlled biological release of nitric oxide. Vasorelaxant effects. J Med Chem 34 : 3242 –3247, 1991
    OpenUrlCrossRefPubMed
  31. ↵
    Keefer LK, Nims RW, Davies KM, Wink DA: “NONOates” (1-substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: Convenient nitric oxide dosage forms. Methods Enzymol 268 : 281 –293, 1996
    OpenUrlCrossRefPubMed
  32. ↵
    Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR: Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem 126 : 131 –138, 1982
    OpenUrlCrossRefPubMed
  33. ↵
    Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162 : 156 –159, 1987
    OpenUrlCrossRefPubMed
  34. ↵
    Lee KH, Bowen-Pope DF, Reed RR: Isolation and characterization of the alpha platelet-derived growth factor receptor from rat olfactory epithelium. Mol Cell Biol 10 : 2237 –2246, 1990
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Byrom FB, Wilson CA: A plethysmographic method for measuring systolic blood preasure in the intact rat. J Physiol 93 : 301 –304, 1938
  36. ↵
    Krakower CA, Greenspon SA: Localization of the nephrotoxic antigen within the isolated renal glomerulus. AMA Arch Pathol 51 : 629 –639, 1951
    OpenUrlPubMed
  37. ↵
    Schaefer L, Macakova K, Raslik I, Micegova M, Gröne H-J, Schönherr E, Robenek H, Echtermeyer FG, Grässel S, Bruckner P, Schaefer RM, Iozzo RV, Kresse H: Absence of decorin adversely influences tubulointerstitial fibrosis of the obstructed kidney by enhanced apoptosis and increased inflammatory reaction. Am J Pathol 160 : 1181 –1191, 2002
    OpenUrlCrossRefPubMed
  38. ↵
    Panayotou G, Bax B, Gout I, Federwisch M, Wroblowski B, Dhand R, Fry MJ, Blundell TL, Wollmer A, Waterfield MD: Interaction of the p85 subunit of PI 3-kinase and its N-terminal SH2 domain with a PDGF receptor phosphorylation site: Structural features and analysis of conformational changes. EMBO J 11 : 4261 –4272, 1992
    OpenUrlPubMed
  39. ↵
    Eigenthaler M, Lohmann SM, Walter U, Pilz RB: Signal transduction by cGMP-dependent protein kinases and their emerging roles in the regulation of cell adhesion and gene expression. Rev Physiol Biochem Pharmacol 135 : 173 –209, 1999
    OpenUrlCrossRefPubMed
  40. ↵
    Pilz RB, Casteel DE: Regulation of gene expression by cyclic GMP. Circ Res 93 : 1034 –1046, 2003
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Fukuoka T, Kitami Y, Okura T, Hiwada K: Transcriptional regulation of the platelet-derived growth factor alpha receptor gene via CCAAT/enhancer-binding protein-delta in vascular smooth muscle cells. J Biol Chem 274 : 25576 –25582, 1999
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Schaefer L, Beck KF, Raslik I, Walpen S, Mihalik D, Micegova M, Macakova K, Schonherr E, Seidler DG, Varga G, Schaefer RM, Kresse H, Pfeilschifter J: Biglycan, a nitric oxide-regulated gene, affects adhesion, growth, and survival of mesangial cells. J Biol Chem 278 : 26227 –26237, 2003
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Mosley K, Waddington SN, Ebrahim H, Cook T, Cattell V: Inducible nitric oxide synthase induction in Thy 1 glomerulonephritis is complement and reactive oxygen species dependent. Exp Nephrol 7 : 26 –34, 1999
    OpenUrlCrossRefPubMed
  44. ↵
    Couser WG: Pathogenesis of glomerular damage in glomerulonephritis. Nephrol Dial Transplant 13 : 10 –15, 1998
    OpenUrlCrossRefPubMed
  45. ↵
    Bogdan C: Nitric oxide and the regulation of gene expression. Trends Cell Biol 11 : 66 –75, 2001
    OpenUrlCrossRefPubMed
  46. ↵
    Akool el-S, Kleinert H, Hamada FM, Abdelwahab MH, Forstermann U, Pfeilschifter J, Eberhardt W: Nitric oxide increases the decay of matrix metalloproteinase 9 mRNA by inhibiting the expression of mRNA-stabilizing factor HuR. Mol Cell Biol 23 : 4901 –4916, 2003
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Franzen R, Fabbro D, Aschrafi A, Pfeilschifter J, Huwiler A: Nitric oxide induces degradation of the neutral ceramidase in rat renal mesangial cells and is counterregulated by protein kinase. J Biol Chem 277 : 46184 –46190, 2002
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Cattell V: Nitric oxide and glomerulonephritis. Kidney Int 61 : 816 –821, 2002
    OpenUrlCrossRefPubMed
  49. ↵
    Callsen D, Sandau KB, Brüne B: Nitric oxide and superoxide inhibit platelet-derived growth factor receptor phosphotyrosine phosphatases. Free Radic Biol Med 26 : 1544 –1553, 1999
    OpenUrlCrossRefPubMed
  50. ↵
    Floege J, Eng E, Young BA, Couser WG, Johnson RJ: Heparin suppresses mesangial cell proliferation and matrix expansion in experimental mesangioproliferative glomerulonephritis. Kidney Int 43 : 369 –380, 1993
    OpenUrlCrossRefPubMed
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Nitric Oxide Upregulates Induction of PDGF Receptor-α Expression in Rat Renal Mesangial Cells and in Anti-Thy-1 Glomerulonephritis
Karl-Friedrich Beck, Gülmisal Güder, Liliana Schaefer, Miriam Pleskova, Andrea Babelova, Meik H. Behrens, Daniel Mihalik, Martina Beck, Roland M. Schaefer, Josef Pfeilschifter
JASN Jul 2005, 16 (7) 1948-1957; DOI: 10.1681/ASN.2004080638
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section